ID: 1018138948

View in Genome Browser
Species Human (GRCh38)
Location 6:160807491-160807513
Sequence TTGTTACTTAATAGAGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018138946_1018138948 17 Left 1018138946 6:160807451-160807473 CCCTTGGGTGGTTACAATATTTG No data
Right 1018138948 6:160807491-160807513 TTGTTACTTAATAGAGAAGAAGG No data
1018138945_1018138948 18 Left 1018138945 6:160807450-160807472 CCCCTTGGGTGGTTACAATATTT No data
Right 1018138948 6:160807491-160807513 TTGTTACTTAATAGAGAAGAAGG No data
1018138947_1018138948 16 Left 1018138947 6:160807452-160807474 CCTTGGGTGGTTACAATATTTGT No data
Right 1018138948 6:160807491-160807513 TTGTTACTTAATAGAGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018138948 Original CRISPR TTGTTACTTAATAGAGAAGA AGG Intergenic
No off target data available for this crispr