ID: 1018141032

View in Genome Browser
Species Human (GRCh38)
Location 6:160837499-160837521
Sequence GCCCTTGAATCCTACATTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018141026_1018141032 6 Left 1018141026 6:160837470-160837492 CCGTGACATCCCTTTGCTCCTCC No data
Right 1018141032 6:160837499-160837521 GCCCTTGAATCCTACATTAAGGG No data
1018141024_1018141032 30 Left 1018141024 6:160837446-160837468 CCGTTGCCTTCTAGGCGGTTCTG No data
Right 1018141032 6:160837499-160837521 GCCCTTGAATCCTACATTAAGGG No data
1018141025_1018141032 24 Left 1018141025 6:160837452-160837474 CCTTCTAGGCGGTTCTGACCGTG No data
Right 1018141032 6:160837499-160837521 GCCCTTGAATCCTACATTAAGGG No data
1018141027_1018141032 -3 Left 1018141027 6:160837479-160837501 CCCTTTGCTCCTCCGCTTGTGCC No data
Right 1018141032 6:160837499-160837521 GCCCTTGAATCCTACATTAAGGG No data
1018141028_1018141032 -4 Left 1018141028 6:160837480-160837502 CCTTTGCTCCTCCGCTTGTGCCC No data
Right 1018141032 6:160837499-160837521 GCCCTTGAATCCTACATTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018141032 Original CRISPR GCCCTTGAATCCTACATTAA GGG Intergenic
No off target data available for this crispr