ID: 1018143024

View in Genome Browser
Species Human (GRCh38)
Location 6:160858718-160858740
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018143021_1018143024 8 Left 1018143021 6:160858687-160858709 CCAACTGCTCAAACCATGTTCAA No data
Right 1018143024 6:160858718-160858740 AACACCGTGCTGTAACAACCAGG No data
1018143020_1018143024 22 Left 1018143020 6:160858673-160858695 CCGATCACAGGCAGCCAACTGCT No data
Right 1018143024 6:160858718-160858740 AACACCGTGCTGTAACAACCAGG No data
1018143023_1018143024 -5 Left 1018143023 6:160858700-160858722 CCATGTTCAAAAAAGGCAAACAC No data
Right 1018143024 6:160858718-160858740 AACACCGTGCTGTAACAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018143024 Original CRISPR AACACCGTGCTGTAACAACC AGG Intergenic
No off target data available for this crispr