ID: 1018151176

View in Genome Browser
Species Human (GRCh38)
Location 6:160940728-160940750
Sequence ATGGACAAAAGTGCCTCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018151176_1018151185 29 Left 1018151176 6:160940728-160940750 CCCACAGAGGCACTTTTGTCCAT No data
Right 1018151185 6:160940780-160940802 AGGAGACGGAGGATGCAAGCTGG No data
1018151176_1018151184 18 Left 1018151176 6:160940728-160940750 CCCACAGAGGCACTTTTGTCCAT No data
Right 1018151184 6:160940769-160940791 TGTTTGTGTCAAGGAGACGGAGG No data
1018151176_1018151183 15 Left 1018151176 6:160940728-160940750 CCCACAGAGGCACTTTTGTCCAT No data
Right 1018151183 6:160940766-160940788 TGTTGTTTGTGTCAAGGAGACGG No data
1018151176_1018151182 9 Left 1018151176 6:160940728-160940750 CCCACAGAGGCACTTTTGTCCAT No data
Right 1018151182 6:160940760-160940782 CCAGATTGTTGTTTGTGTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018151176 Original CRISPR ATGGACAAAAGTGCCTCTGT GGG (reversed) Intergenic
No off target data available for this crispr