ID: 1018154504

View in Genome Browser
Species Human (GRCh38)
Location 6:160973303-160973325
Sequence GGCTGGACTGCATTCCCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018154504_1018154512 3 Left 1018154504 6:160973303-160973325 CCCCCAGGGAATGCAGTCCAGCC No data
Right 1018154512 6:160973329-160973351 GAACAAATGTAGCACACACAAGG No data
1018154504_1018154513 18 Left 1018154504 6:160973303-160973325 CCCCCAGGGAATGCAGTCCAGCC No data
Right 1018154513 6:160973344-160973366 ACACAAGGCAATCAAGTCTCAGG No data
1018154504_1018154514 24 Left 1018154504 6:160973303-160973325 CCCCCAGGGAATGCAGTCCAGCC No data
Right 1018154514 6:160973350-160973372 GGCAATCAAGTCTCAGGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018154504 Original CRISPR GGCTGGACTGCATTCCCTGG GGG (reversed) Intergenic
No off target data available for this crispr