ID: 1018165391

View in Genome Browser
Species Human (GRCh38)
Location 6:161089507-161089529
Sequence CACACTGACTTTCATCAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 242}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018165391_1018165393 -6 Left 1018165391 6:161089507-161089529 CCTTTTTGATGAAAGTCAGTGTG 0: 1
1: 0
2: 1
3: 16
4: 242
Right 1018165393 6:161089524-161089546 AGTGTGTGGTAATGTGTGTAAGG 0: 1
1: 0
2: 5
3: 47
4: 581
1018165391_1018165394 9 Left 1018165391 6:161089507-161089529 CCTTTTTGATGAAAGTCAGTGTG 0: 1
1: 0
2: 1
3: 16
4: 242
Right 1018165394 6:161089539-161089561 GTGTAAGGTAATATCATCCAAGG 0: 1
1: 0
2: 0
3: 18
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018165391 Original CRISPR CACACTGACTTTCATCAAAA AGG (reversed) Intronic
901243549 1:7710289-7710311 CAGACTGGCTTACATAAAAAAGG + Intronic
903046609 1:20569039-20569061 TAAAATGGCTTTCATCAAAAAGG + Intergenic
906779383 1:48558819-48558841 CAAACTGACTTAAATAAAAAGGG - Intronic
907189584 1:52637385-52637407 AGGACTGACTTTCATGAAAAGGG - Intronic
907621449 1:55985134-55985156 CCCTCGGACTTTCATCAAAAAGG - Intergenic
909183879 1:72460577-72460599 CACATTGAATTCCTTCAAAATGG - Intergenic
911303704 1:96207105-96207127 CACAGTAATTTTCATCTAAAAGG + Intergenic
911661369 1:100505498-100505520 CACTCAGATTTTCATCAAACTGG - Intronic
912559268 1:110538490-110538512 GATACTGACTTTAATCAAACTGG + Intergenic
912587655 1:110781190-110781212 CCCACTGACTTTCTGCAAAGAGG + Intergenic
912600350 1:110925256-110925278 CAAACTGACCTTCCTCAAAGAGG + Intergenic
914406420 1:147378445-147378467 TACATCTACTTTCATCAAAAAGG + Intergenic
915254353 1:154614597-154614619 CAAACTGACTTTCGGCAAATTGG - Intronic
915655275 1:157354121-157354143 CACAGAGACTTTCAGCCAAATGG + Intergenic
916691884 1:167197894-167197916 AACACTCACTGTCATCTAAAGGG - Intergenic
918878924 1:190088238-190088260 CACAGTAACTTTGTTCAAAATGG + Intergenic
922813893 1:228435400-228435422 AACCCTGACTATCATCAACAAGG - Intergenic
924537029 1:244944201-244944223 CACTCTGCCTTTCTTAAAAAAGG + Intergenic
1063591492 10:7399959-7399981 CACAAAAGCTTTCATCAAAAAGG + Intronic
1064662506 10:17619929-17619951 CAGATTGAACTTCATCAAAATGG + Intergenic
1065213687 10:23429513-23429535 CATACTGACTTTAAAAAAAAAGG - Intergenic
1065242744 10:23724082-23724104 CTCACTCACTTTCATGAGAACGG + Intronic
1066531818 10:36349140-36349162 AGCACTATCTTTCATCAAAAGGG - Intergenic
1067096040 10:43300749-43300771 CACTCAAAATTTCATCAAAATGG - Intergenic
1067262211 10:44704016-44704038 CACACACAAATTCATCAAAAAGG - Intergenic
1069134400 10:64746061-64746083 CCCACTGACAATCAGCAAAAAGG - Intergenic
1069761158 10:70812547-70812569 CACTCTGACTTTGATCAAACTGG + Intergenic
1071443185 10:85722196-85722218 CACACTCACTGTCATCATATTGG - Intronic
1073567898 10:104551183-104551205 TACACTGAGTTTTAGCAAAAGGG - Intergenic
1073753175 10:106552686-106552708 CACACTGAGTTTCATGAAAAAGG - Intergenic
1073942106 10:108711459-108711481 CTCACTCACTATCATGAAAACGG + Intergenic
1074752344 10:116598903-116598925 TTTACTGAATTTCATCAAAATGG + Intronic
1075086688 10:119418559-119418581 CACCCTGACTGTCATCAGAGTGG + Intronic
1075189323 10:120291962-120291984 CACACTAACTATCATGAGAACGG + Intergenic
1078867222 11:15309123-15309145 CACATTGGCTTTCATTAAAAGGG - Intergenic
1078885587 11:15496801-15496823 AACACTGATTTTCCTCAAAGAGG - Intergenic
1079270691 11:18983137-18983159 CACTCAAAATTTCATCAAAATGG + Intergenic
1085145849 11:74196516-74196538 CAAACTGATTTTCAACAAAGGGG - Intronic
1085894852 11:80626805-80626827 GACACTGACTTTCACCCCAAGGG + Intergenic
1085925445 11:81014133-81014155 CATGCTATCTTTCATCAAAATGG + Intergenic
1087023858 11:93630260-93630282 AACACTGGCTTTCATCACACAGG - Intergenic
1087550994 11:99648385-99648407 TACAATGACTATTATCAAAAAGG + Intronic
1088923612 11:114279895-114279917 CACACTGACTTTGAACTAACAGG + Intronic
1089795514 11:120977409-120977431 CACATCGACATTCATCAGAAGGG - Intronic
1090751083 11:129747092-129747114 CCTACTGAGTGTCATCAAAATGG + Intergenic
1092959888 12:13586122-13586144 TAGAATGATTTTCATCAAAAGGG - Intronic
1092983259 12:13819170-13819192 CACACGGTCTTTCTTCTAAATGG - Intronic
1093426184 12:19031953-19031975 CACACTCACTATCATGAGAACGG + Intergenic
1095316394 12:40766830-40766852 CACAGTGACTCACATCTAAAAGG - Intronic
1095669555 12:44842585-44842607 TAAACTGTATTTCATCAAAATGG + Intronic
1095881063 12:47136866-47136888 TCCACTGACTCTCATCATAATGG - Intronic
1096146045 12:49279561-49279583 CACAGTGACTTGCACCAAACAGG - Intergenic
1098105546 12:67066791-67066813 TACACTGAAATTCATCCAAAAGG + Intergenic
1101985454 12:109442559-109442581 CACACTGCCTCTCACCAATAAGG - Intronic
1106686960 13:32070286-32070308 CACACAGTCTTTCTTCCAAATGG + Intronic
1107154351 13:37148879-37148901 CATAAAGACTTTCATAAAAAGGG + Intergenic
1107181728 13:37469252-37469274 TAAGCTGACTTTAATCAAAAGGG + Intergenic
1107298657 13:38941880-38941902 CTCACTGCCTTTCATCATATAGG + Intergenic
1107422592 13:40262537-40262559 CACACTGAGTTTTAAAAAAATGG - Intergenic
1108749740 13:53436407-53436429 CCCACTGACTTCCATCTAATAGG + Intergenic
1110244632 13:73308662-73308684 CATAATCTCTTTCATCAAAATGG + Intergenic
1110866177 13:80398802-80398824 CACTCAAAATTTCATCAAAATGG + Intergenic
1111220343 13:85197061-85197083 GACACTGACTTTCATTCAGATGG - Intergenic
1113189629 13:107729092-107729114 CACACTGAATTTGATCAAGCTGG + Intronic
1113242148 13:108349973-108349995 CACAATGACTTTCTACATAAAGG + Intergenic
1116983712 14:51197332-51197354 CACACTCTCTTTTATCAAATAGG - Intergenic
1117734920 14:58758918-58758940 CACACTGAGACTCCTCAAAAGGG - Intergenic
1117937076 14:60918643-60918665 CACACGTACTTTTAGCAAAATGG + Intronic
1118151150 14:63192253-63192275 AACTCTGACTGTAATCAAAAAGG - Intergenic
1119084850 14:71730333-71730355 GACACTGACCATCATCAACAGGG - Intronic
1119154858 14:72400722-72400744 CAGACTCACTTTTATAAAAATGG + Intronic
1119350934 14:73965061-73965083 CACACTGACTTTTATTACTAAGG - Exonic
1119381385 14:74231324-74231346 AACTCTGAATTTCACCAAAAAGG + Intergenic
1125975859 15:43950877-43950899 GACACTGACTTTTAACAACAGGG + Intronic
1126455229 15:48854284-48854306 CAGAATGACTATCATTAAAAAGG + Intronic
1126816226 15:52457577-52457599 TAGAATGACTTTTATCAAAAAGG + Intronic
1130611834 15:85368308-85368330 CACACTACCTGTCATTAAAAAGG + Intergenic
1130807374 15:87339613-87339635 TATAGTGACTTTCATCCAAAAGG + Intergenic
1133546890 16:6816364-6816386 AAGATTGACTTTCATCTAAAAGG - Intronic
1135886035 16:26308917-26308939 CACACTTGCCCTCATCAAAAAGG - Intergenic
1137003854 16:35254595-35254617 GACCCTGACTTTCATCAAGAGGG + Intergenic
1139477951 16:67212329-67212351 CCCACAGACCATCATCAAAAGGG + Intronic
1140145403 16:72301929-72301951 CACACAAACTTTCACAAAAATGG + Intergenic
1140305856 16:73802024-73802046 CACACTGTCCTTCATAAACAAGG - Intergenic
1140867651 16:79078004-79078026 CACACTAACCTTGATAAAAATGG - Intronic
1143780860 17:9228649-9228671 CAAAATGTCTTTCAACAAAAGGG - Intronic
1144554745 17:16272094-16272116 GACACTGACTTTCACAAAATGGG - Intronic
1144861104 17:18302762-18302784 CACACTGCCCTCCATCATAAAGG + Intronic
1147515680 17:41115546-41115568 AAGACTGACTTTCTTCAAAAAGG + Intergenic
1147665594 17:42145276-42145298 CACAGTGACTTTCTTCCAAAGGG + Intronic
1147960546 17:44164915-44164937 CACAGTGACTTCCTTCCAAAGGG - Intergenic
1149046293 17:52249600-52249622 CACACTGAATTTCTTTAAATAGG + Intergenic
1149217920 17:54379979-54380001 CACTCTTATTTTCATCATAATGG + Intergenic
1149533209 17:57412039-57412061 CAGAGTGACTTTCCTCAAAGAGG - Intronic
1150735828 17:67738216-67738238 CAAACTGAAATTCTTCAAAATGG + Exonic
1151769048 17:76147723-76147745 CACACTGACTTTCCGCAGACAGG - Intronic
1152887172 17:82859280-82859302 CACACTGGCTTTCAGAGAAAGGG + Intronic
1152887186 17:82859352-82859374 CACACTGGCTTTCAGGGAAAGGG + Intronic
1156973565 18:43188434-43188456 CCCACTGACTTTCTTCTAGAAGG - Intergenic
1158346797 18:56524161-56524183 CACACACACTTTAGTCAAAATGG + Intergenic
1160412169 18:78682519-78682541 CACACTGACACTCACCAAGAGGG - Intergenic
1163979503 19:20885685-20885707 CACACACACATTCATCAAAGTGG + Intergenic
1163982289 19:20912309-20912331 CACACACTCATTCATCAAAATGG + Intergenic
1164918455 19:32070596-32070618 CACTCCGACATTCACCAAAAAGG - Intergenic
1167978674 19:53254590-53254612 CACACTGACCTAAAGCAAAAAGG + Intronic
926336935 2:11870762-11870784 CACACTGACATTGCTCAGAAGGG + Intergenic
927489957 2:23514688-23514710 CACACTGACCTTCTTCCTAACGG - Intronic
929747511 2:44674066-44674088 CACACAGACTTTCATTACAGGGG - Intronic
929916837 2:46143442-46143464 CACACTCACTTTCTTCATGAAGG - Intronic
930291896 2:49505003-49505025 CACACAGACTTTAATCATAATGG - Intergenic
930596543 2:53396420-53396442 TAGATTGAATTTCATCAAAATGG + Intergenic
933362547 2:81306028-81306050 CTCACTGACTATCATGAGAAGGG - Intergenic
934604597 2:95684475-95684497 GACACTGACTATGATAAAAATGG - Intergenic
934675429 2:96246521-96246543 GACACTGATTTTCTTCAAGAAGG + Intergenic
935001757 2:99024412-99024434 CAAACGGAATTGCATCAAAAAGG - Intronic
935703254 2:105832509-105832531 AATACTGAATTTTATCAAAATGG + Intronic
936538050 2:113327004-113327026 GACACTGACTATGATAAAAATGG - Intergenic
937598092 2:123694595-123694617 GACACTTACTTTCTTCCAAAAGG - Intergenic
937981208 2:127616831-127616853 CACTCAAAATTTCATCAAAATGG - Intronic
938199732 2:129362875-129362897 CACACTCACTGGCATTAAAATGG - Intergenic
938851990 2:135270575-135270597 CACAGAGAATATCATCAAAAAGG - Intronic
939302067 2:140356237-140356259 GGGATTGACTTTCATCAAAATGG - Intronic
941223620 2:162816383-162816405 AAAATTGACTTTCATTAAAATGG + Intronic
944300036 2:198113216-198113238 CACACTGACATTTATAAATAAGG + Intronic
946252744 2:218423562-218423584 CACAGTGACTTTGCTCAATAAGG - Intronic
948780214 2:240316444-240316466 TACACTGGACTTCATCAAAATGG + Intergenic
1169631159 20:7633720-7633742 CACACTGTTTTTCATCAGTATGG - Intergenic
1172810767 20:37646478-37646500 CTCAATGACTTTCAACAATAAGG + Intergenic
1173373431 20:42460644-42460666 CTCACTCACTATCATGAAAATGG - Intronic
1173661128 20:44734510-44734532 ACCACTGGCTTTCATGAAAAAGG + Intergenic
1174157609 20:48526650-48526672 CACACTGAATTTTTTAAAAAAGG + Intergenic
1177454846 21:21323963-21323985 CACCCTAACTTACATCAATATGG - Intronic
1177643192 21:23870307-23870329 CACCTTGATTTTCATCTAAATGG - Intergenic
1179585756 21:42373207-42373229 CACGTTGACTTTCCTCACAATGG + Intronic
1182710538 22:32320198-32320220 CACCCTGACACTGATCAAAAGGG + Intergenic
949119775 3:372336-372358 CACACTGTATTTCAGCAAAGTGG + Intronic
949569392 3:5277422-5277444 CTCACTGCCTTTCATTAAACAGG - Intergenic
950723999 3:14904195-14904217 CAAACTGACTTTCTTCCAAAGGG - Intronic
951901071 3:27658052-27658074 CATACTGTAATTCATCAAAAAGG - Intergenic
952453830 3:33454486-33454508 CAGACTGACTTTCTGTAAAATGG + Intergenic
953497702 3:43402666-43402688 CACACTGGCTCTTTTCAAAATGG + Intronic
953897275 3:46812166-46812188 CACACACACTATCATCAACATGG - Intronic
955143925 3:56297435-56297457 CACTCTGACTTTGCTTAAAATGG - Intronic
956962127 3:74415414-74415436 CATGCTGACTTTAATCCAAAAGG + Intronic
959256889 3:104026782-104026804 CAAAATGACTTTCTTCCAAAGGG - Intergenic
959369045 3:105500022-105500044 CACACTGACCTTCTACAAAGAGG - Intronic
959521328 3:107326041-107326063 CACACAGACATTCCTCAAATAGG + Intergenic
961570530 3:127794892-127794914 CACATTAACTTTCTTCCAAAAGG - Intronic
962170228 3:133094165-133094187 CACATTGAGGTTCATCAGAAGGG - Intronic
963061423 3:141230239-141230261 CACACTAACTTAAATCACAAAGG - Intronic
963817244 3:149845185-149845207 CACACTAATCATCATCAAAACGG + Intronic
964145604 3:153458800-153458822 TAGAATGACTATCATCAAAAAGG + Intergenic
965549620 3:169951023-169951045 CAAACTGACTTAAATCATAAAGG + Intergenic
967205503 3:187116898-187116920 CTCACAGCCTTTCATCAGAATGG - Intergenic
967837754 3:193978926-193978948 ATCACTGATTTTCATCAACAAGG + Intergenic
968191627 3:196672315-196672337 AACACTGACTTGCATTCAAAAGG - Intronic
969545079 4:7820726-7820748 CACTCTGCCTTTCATTAAAATGG - Intronic
970062271 4:12048306-12048328 CACTCTCACTATCACCAAAATGG - Intergenic
970454349 4:16207358-16207380 CACACTGACATAAAACAAAAAGG + Intronic
970639041 4:18043070-18043092 CAGATTGACTTTCTCCAAAACGG - Intergenic
971326672 4:25650212-25650234 CACACTGATTTTCCTCTAAATGG - Intergenic
971582873 4:28365209-28365231 CACACACACATTGATCAAAATGG - Intronic
971645178 4:29190154-29190176 CACACTCACTTTCTTCACACTGG - Intergenic
973209601 4:47601097-47601119 CACATTGATTTTCCTAAAAATGG - Intronic
974331324 4:60482855-60482877 GACAATGATTTTAATCAAAATGG + Intergenic
975104578 4:70553359-70553381 CACTCAAAATTTCATCAAAATGG - Intergenic
976346579 4:84010045-84010067 AACACAACCTTTCATCAAAAAGG + Intergenic
976970406 4:91095668-91095690 CACACTGTCTTTCATAGAATTGG + Intronic
979481776 4:121227544-121227566 CAGAATGACTTTCTTAAAAAAGG - Intergenic
979778353 4:124618253-124618275 CTCACTCACTATCATAAAAATGG - Intergenic
981114937 4:140978895-140978917 GAAACTGACTTTAATGAAAATGG - Intronic
982759799 4:159267745-159267767 CACACAGACTCCCCTCAAAAAGG - Exonic
983004973 4:162473233-162473255 CACAATGACATTCGCCAAAATGG - Intergenic
983567419 4:169168184-169168206 CACACTGGCTTTCAAGAGAATGG + Intronic
985858538 5:2450241-2450263 CACACTGACATTCTTCTTAAAGG + Intergenic
985868533 5:2535634-2535656 CACAGTGACTTTCAAAAACAGGG + Intergenic
985895234 5:2746060-2746082 CACACAGGTTTTCATTAAAAAGG + Exonic
986102331 5:4625453-4625475 CACCCTGACTGTCAACTAAAAGG + Intergenic
987148956 5:15019456-15019478 CACACTGTCTTTCAGAAAATGGG - Intergenic
987692397 5:21283561-21283583 CACTCAAAATTTCATCAAAACGG - Intergenic
987813932 5:22876077-22876099 TAAAATAACTTTCATCAAAAAGG - Intergenic
987845151 5:23274396-23274418 CTCACTGACTGTCAGCAACATGG + Intergenic
987948919 5:24651476-24651498 CACTCAAAATTTCATCAAAACGG + Intergenic
988115869 5:26890379-26890401 GACACTGTCTTTCATCAAAGTGG - Intronic
988541912 5:32117872-32117894 CATACTGACTTTCAAATAAAAGG + Intergenic
989508070 5:42250707-42250729 CTCACTTAATATCATCAAAATGG + Intergenic
991747961 5:69766489-69766511 CACTCAAAATTTCATCAAAACGG + Intergenic
991799537 5:70346337-70346359 CACTCAAAATTTCATCAAAACGG + Intergenic
991829060 5:70663701-70663723 CACTCAAAATTTCATCAAAACGG - Intergenic
991891896 5:71345766-71345788 CACTCAAAATTTCATCAAAACGG + Intergenic
996531520 5:124532530-124532552 CACACTGACTTAAGGCAAAAGGG + Intergenic
997013972 5:129908324-129908346 CACACTGAGTCCCACCAAAACGG - Exonic
997381087 5:133438966-133438988 TACACTGACTTCCACCAAAGTGG - Intronic
998504531 5:142661309-142661331 TAGGCTGGCTTTCATCAAAAAGG + Intronic
998873174 5:146573230-146573252 CAAACTGACTTTCTTCAAGAAGG - Intergenic
1000260316 5:159581893-159581915 CAAGCTGTCTTTCCTCAAAATGG - Intergenic
1001098647 5:168796122-168796144 CAGCCTGACATTCATCAAACTGG + Intronic
1002984137 6:2171770-2171792 CACAAAGACTTCCATGAAAAAGG + Intronic
1003892514 6:10576038-10576060 CACACGGACGTGCATGAAAACGG + Intronic
1004776649 6:18853929-18853951 CACACTGACTATCACAAGAAAGG + Intergenic
1008381646 6:50844479-50844501 CACACAGGCTTTGATTAAAAAGG - Exonic
1009429489 6:63550504-63550526 CACACCAACTTTCATGATAAAGG + Intronic
1011218756 6:85032700-85032722 CTCACTGACTATCATGAGAATGG + Intergenic
1011380594 6:86738549-86738571 CATAGTGACTTTCTTCCAAAGGG - Intergenic
1013968722 6:115988934-115988956 CTGACTGACTTTCATCACCAGGG + Intronic
1014626996 6:123738535-123738557 CATAGTGACTTTCTTCTAAAGGG - Intergenic
1016553683 6:145311573-145311595 CATACTGAGTTTCAACAAAGTGG - Intergenic
1016697331 6:147012706-147012728 CATAGTGACTTTCTTCCAAAAGG + Intergenic
1017367572 6:153662796-153662818 CTCACTGAGTTTCTTTAAAATGG + Intergenic
1018165391 6:161089507-161089529 CACACTGACTTTCATCAAAAAGG - Intronic
1018564752 6:165139470-165139492 CACACTCATGTACATCAAAATGG + Intergenic
1023997087 7:45166336-45166358 CAGAATGGCTATCATCAAAAAGG - Intronic
1024188971 7:46985881-46985903 CACACTACCTTTCATGAAAAAGG - Intergenic
1026184193 7:68069208-68069230 CACACTGTATTTCAACAAAGTGG + Intergenic
1028288327 7:89032677-89032699 CAAACTGACTTTCATCCTCAAGG - Intronic
1030207302 7:106963481-106963503 CACACTGACCTTTATGAGAAAGG + Intergenic
1031283580 7:119837656-119837678 CAAAATTACTTTCAGCAAAATGG + Intergenic
1032313666 7:130813689-130813711 CACACTGACCTTCATTAAACAGG - Intergenic
1032627007 7:133602224-133602246 CACACTGGCTTTTATGAAATTGG + Intronic
1034369672 7:150584107-150584129 CACTCAAAGTTTCATCAAAATGG + Intergenic
1034595454 7:152186085-152186107 GACACTGAGTTTCATATAAATGG - Intronic
1034965429 7:155387780-155387802 CACACTGCCTTTCATCAGTGTGG + Intronic
1035921057 8:3676697-3676719 CACACTGAGTTTGATAGAAATGG - Intronic
1038264556 8:26028223-26028245 CACAATGACCTTCATTCAAAAGG - Intronic
1038482485 8:27911178-27911200 CACACTAACTTTCAGCACACTGG - Intronic
1039651728 8:39348234-39348256 CACTCTGACTTATTTCAAAATGG - Intergenic
1041230386 8:55744835-55744857 CACACTGAAGTTCTTCAAATGGG - Intronic
1041305171 8:56450051-56450073 AACACTGACTTTCCTTAAAATGG - Intergenic
1043882701 8:85563229-85563251 AACACAGTCTTTAATCAAAAAGG - Intergenic
1046144904 8:110145783-110145805 CACACTGACTTCCACAAAGATGG + Intergenic
1047250191 8:123176243-123176265 CAAAGTGACCCTCATCAAAAAGG - Intergenic
1050826201 9:9949942-9949964 CACACTGACTTACAGAAAAATGG - Intronic
1051872360 9:21753349-21753371 CCAACTGACCTTCATTAAAATGG - Intergenic
1052355602 9:27501975-27501997 AACACTCACTCTCAACAAAAAGG + Intronic
1053532842 9:38898958-38898980 CACAGAGACTTTCATCCTAATGG + Intergenic
1054205068 9:62123387-62123409 CACAGAGACTTTCATCCTAATGG + Intergenic
1054633291 9:67464983-67465005 CACAGAGACTTTCATCCTAATGG - Intergenic
1054815401 9:69470003-69470025 CACACTTACTGTAGTCAAAAAGG - Intronic
1056420555 9:86422185-86422207 CAACCTGATTTCCATCAAAAGGG + Intergenic
1057151374 9:92798942-92798964 CACAGAGACTTTCATCCTAACGG - Intergenic
1059144420 9:111885561-111885583 CACACTGAGTTTTTCCAAAATGG - Intergenic
1061396372 9:130346032-130346054 AACACTGATTATCATCAGAAAGG - Intronic
1186442168 X:9595583-9595605 CTCACTGGCTTTTAGCAAAATGG + Intronic
1186872753 X:13788688-13788710 CAAACGGTCTTTCATCCAAATGG + Intronic
1187419130 X:19120086-19120108 CAAGGTGACTTTCATTAAAAGGG - Intronic
1188117055 X:26257360-26257382 TACACTGACTTCCAGCACAAGGG - Intergenic
1188198335 X:27266863-27266885 AACACTGACTTTCATTCAGAAGG + Intergenic
1194597821 X:95880766-95880788 CACAATGGCTATTATCAAAAAGG - Intergenic
1194744882 X:97617414-97617436 AACATGGAATTTCATCAAAAGGG + Intergenic
1197582033 X:128295150-128295172 CTCACTCACTGTCATAAAAATGG - Intergenic
1198151131 X:133910987-133911009 CCCACTGTCTTTCATCCAATTGG + Intronic
1198375539 X:136035361-136035383 GATTCTGACTTTCATCAACATGG + Intronic
1198609084 X:138377405-138377427 TACACTGACTTTGGTGAAAAGGG - Intergenic
1198789837 X:140332515-140332537 CACAGTGGCTATTATCAAAAAGG - Intergenic
1199201207 X:145091314-145091336 CTCACTGAGTTTCATGGAAAAGG + Intergenic
1199502646 X:148525325-148525347 AATATTGACTTTAATCAAAAAGG + Intronic
1200836592 Y:7738284-7738306 CACATCTATTTTCATCAAAATGG + Intergenic
1201269199 Y:12237986-12238008 ATCACTGACTTTCACCACAATGG + Intergenic
1201680887 Y:16642702-16642724 CACACAGTCTTTCATAAAATTGG + Intergenic
1201981228 Y:19912105-19912127 CTCACTGACTCTCATGAGAATGG - Intergenic