ID: 1018166895

View in Genome Browser
Species Human (GRCh38)
Location 6:161106374-161106396
Sequence TATCTATTCAGATAAACAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 665
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 641}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018166895_1018166897 28 Left 1018166895 6:161106374-161106396 CCTGCTGTTTATCTGAATAGATA 0: 1
1: 0
2: 2
3: 21
4: 641
Right 1018166897 6:161106425-161106447 ATATATTGCTCTATTTTTATTGG 0: 1
1: 0
2: 6
3: 66
4: 654
1018166895_1018166896 -4 Left 1018166895 6:161106374-161106396 CCTGCTGTTTATCTGAATAGATA 0: 1
1: 0
2: 2
3: 21
4: 641
Right 1018166896 6:161106393-161106415 GATAATAAGCTTTGCTGTAATGG 0: 1
1: 0
2: 1
3: 15
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018166895 Original CRISPR TATCTATTCAGATAAACAGC AGG (reversed) Intronic
900857808 1:5200089-5200111 TCCCTGTTCAGACAAACAGCAGG + Intergenic
902695524 1:18138300-18138322 GATGGATTGAGATAAACAGCTGG - Intronic
902858659 1:19228266-19228288 TTCCTACTCAGATAAACAACGGG - Intronic
904878526 1:33675857-33675879 CATCTATTGAGATAATCATCTGG - Intronic
906057229 1:42926815-42926837 AATCTATTCAGACAAGCAACAGG - Exonic
906355195 1:45099797-45099819 CATCTATTGAGATAAACATGTGG - Intronic
906565261 1:46795841-46795863 TATCTATTGAGATAATCATGTGG + Intronic
906752256 1:48275582-48275604 TATCTATTGAGATAATCACGTGG + Intergenic
906758448 1:48346226-48346248 TATCTATTGAGATAATCATGTGG - Intronic
907864111 1:58382316-58382338 TACCTATTCAATTATACAGCTGG + Intronic
908935076 1:69365537-69365559 TATCTATTCTGTTAAGCAACAGG + Intergenic
908969450 1:69809673-69809695 TATCTATTGAGATAATCATGTGG - Intronic
909456755 1:75858507-75858529 CATCTATTCAGATAATCATGTGG + Intronic
910925331 1:92392282-92392304 TATCTATTGAGATAATCATGTGG - Exonic
911272590 1:95821258-95821280 TATCTATTGAGATAATCATGTGG + Intergenic
911597386 1:99813053-99813075 TATCGATTCAGGCATACAGCAGG - Intergenic
911963250 1:104334247-104334269 TATCTATTGAGATAATCATATGG + Intergenic
911982973 1:104588825-104588847 CATCTATTCAGATAATCATGAGG - Intergenic
913627761 1:120677162-120677184 CATCTATTGAGATAAACATATGG - Intergenic
913721462 1:121600437-121600459 CATCTATTCAGATAATCATACGG + Intergenic
915064770 1:153215741-153215763 TTTCTCTTCAGATATACACCTGG + Intergenic
915833250 1:159150957-159150979 CATCTATTCAGATAATCATATGG + Intergenic
916593181 1:166213466-166213488 CATCTATTCAGATAATCATATGG + Intergenic
917006706 1:170423452-170423474 CATCTATTGAGATAATCAGTTGG + Intergenic
917041933 1:170814650-170814672 TATCTATTGAGATAATCATGTGG - Intergenic
917874010 1:179268974-179268996 AATGTATTTTGATAAACAGCAGG - Intergenic
919344083 1:196351947-196351969 TATCTATTGAGATAATCATGTGG + Intronic
919381348 1:196865271-196865293 TATCTATTGAGATAATCATGTGG - Intronic
919414622 1:197292809-197292831 TATCTATTGAGATAATCAAGTGG - Intronic
919655040 1:200189253-200189275 CATCTATTGAGATAATCAGGTGG - Intergenic
920656989 1:207884668-207884690 TATCCATTCAGATGAAAATCTGG + Intronic
921377984 1:214493657-214493679 AATCTATTCAGAGACACAGTGGG + Intronic
921401024 1:214723934-214723956 TATCTATTGAGATAATCATGTGG + Intergenic
921787787 1:219252526-219252548 TATCTATTGAGATAAGCATGTGG + Intergenic
922147392 1:222961368-222961390 TATCTATTGAGATAATCATGTGG - Intronic
922397210 1:225214150-225214172 TATCTATTGAGATAATCATGTGG + Intronic
922401919 1:225268227-225268249 TATCTATTGAGATAATCATGTGG - Intronic
923179802 1:231505524-231505546 TATCTATTGAGATAATCATGTGG + Intergenic
924179615 1:241427218-241427240 TATCTATTGAGATAATCATGTGG + Intergenic
924834184 1:247631951-247631973 CATCTATTGAGATAATCAGGTGG + Intergenic
1063305591 10:4896701-4896723 TATCTATTGAGATAATCATGTGG + Intergenic
1064758228 10:18591618-18591640 TATCTATTGAGATAATCATGTGG - Intronic
1064849290 10:19692973-19692995 TATCTATTGAGATAATCATGTGG - Intronic
1064921848 10:20527955-20527977 TATCTATTGAGATAATCATATGG + Intergenic
1065075651 10:22076568-22076590 TATCTATTGAGATAATCATGTGG + Intergenic
1065222240 10:23508173-23508195 CATCTATTCAGATAATCATGTGG + Intergenic
1066163341 10:32758497-32758519 TATCTATTGAGATAATCATGTGG - Intronic
1066273939 10:33850077-33850099 TATCTATTGAGATAATCATATGG + Intergenic
1066613328 10:37273253-37273275 CATCTATTCAGATAATCATGTGG + Intronic
1067675774 10:48375138-48375160 CATCTATTCAGATAATCATGTGG - Intronic
1068552272 10:58420018-58420040 TATCTATTGAGATAATCATGTGG + Intergenic
1068788792 10:61005127-61005149 CATCTATTGAGATAATCATCTGG + Intergenic
1069951787 10:72024017-72024039 TAACAATTCAGATAAAGAGAGGG - Intergenic
1070311679 10:75277971-75277993 CATCTATTGAGGTAATCAGCTGG + Intergenic
1070465635 10:76720812-76720834 TATCTATTCAGAAACAGAGTAGG - Intergenic
1070709593 10:78670280-78670302 TATCTATTGAGATAATCATGTGG - Intergenic
1071035117 10:81235547-81235569 TATCTATTGAGATAATCATGCGG + Intergenic
1071665530 10:87552687-87552709 AATCTATTTAGAGAAACAGCTGG + Exonic
1071818657 10:89257699-89257721 CCTCTATTTAGATAAACTGCTGG - Intronic
1072374174 10:94797234-94797256 TATCTATTGAGATAATCATGTGG + Intronic
1072388453 10:94957150-94957172 TATCTATTGAGATAATCATGTGG + Intronic
1072515951 10:96183249-96183271 GATCTTTTCAAAAAAACAGCTGG + Intronic
1073666821 10:105543116-105543138 TATCTATGCTTATAAACAGTAGG - Intergenic
1073746212 10:106471054-106471076 TATCTATTGAGATAATCATGTGG - Intergenic
1074251387 10:111753766-111753788 TATCTATTAAGATAATCATATGG + Intergenic
1074984802 10:118648531-118648553 TATCTATTGAGATAATCATGTGG + Intergenic
1075890842 10:125949017-125949039 TATCTATTGAGATAATCATGTGG - Intronic
1076239607 10:128894448-128894470 TATTTTTTCAGATAAACACTGGG - Intergenic
1077714002 11:4563226-4563248 CATCTATTGAGATAATCATCTGG - Intergenic
1078336773 11:10470213-10470235 CATCTATTCAGATAATCATGTGG - Intronic
1078383811 11:10869501-10869523 TATCAATTAAGATATACAGATGG - Intergenic
1078711458 11:13796068-13796090 CATCTATTGAGATAATCATCTGG + Intergenic
1078799658 11:14630407-14630429 CATCTATTGAGATAATCATCTGG + Intronic
1079285299 11:19124800-19124822 TACCTATTCAGAAAAGCAGGTGG + Intronic
1079466470 11:20735740-20735762 TATCTAACCCCATAAACAGCTGG - Intronic
1079903171 11:26213030-26213052 CATCTATTGAGATAATCAGGTGG - Intergenic
1080117842 11:28640456-28640478 CATCTATTCAGATAATCATGCGG - Intergenic
1081424999 11:42916534-42916556 CATCTATTGAGATAATCAGGTGG + Intergenic
1081877939 11:46423222-46423244 GATCTAAGCAGATCAACAGCTGG - Intronic
1082244236 11:49903344-49903366 TAGCTATAGAGCTAAACAGCTGG - Intergenic
1082247921 11:49946321-49946343 TATCTATTGAGATAATCATATGG + Intergenic
1082587158 11:54955114-54955136 TATCTATTGAGATAACCATGTGG + Intergenic
1082606038 11:55235069-55235091 TATCTATTGAGATAATCATGTGG + Intergenic
1083005944 11:59346416-59346438 CATCTATTGAGATAATCAGGTGG + Intergenic
1085434287 11:76485445-76485467 TATCTATTGAGATAAGCATGTGG - Intronic
1086839798 11:91670987-91671009 TATCTATTGAGATAATCAAGTGG - Intergenic
1087341374 11:96911814-96911836 CATCTATTGAGATAAACATGTGG - Intergenic
1087545594 11:99580072-99580094 TATCTATTGAGATAATCATGTGG + Intronic
1087576635 11:99997904-99997926 TATCTATTGAGATAATCATGTGG - Intronic
1087674197 11:101140175-101140197 TATATGTTAAGATAAACAGCTGG - Intergenic
1087859648 11:103138455-103138477 TATCTATTGAGATAATCATGTGG + Intronic
1087920057 11:103856328-103856350 CATCTATTGAGATAAACATGTGG - Intergenic
1088806200 11:113354703-113354725 TATCTATTGAGATAATCACATGG + Intronic
1088948240 11:114537179-114537201 CATCTATTGAGATAATCATCTGG - Intronic
1089815632 11:121172139-121172161 CATCTATTCAGATAATCATATGG + Intronic
1092572623 12:9741341-9741363 TTTCCATTCAGAGAAACATCGGG + Intergenic
1093243560 12:16707904-16707926 CATCTATTGAGATAATCAGGTGG + Intergenic
1093287819 12:17287120-17287142 AAACTATCCAGATGAACAGCAGG - Intergenic
1093402635 12:18764748-18764770 CATCTATTCAGATAATCATGTGG - Intergenic
1093568945 12:20643589-20643611 TATATGTTTAGATAAGCAGCTGG + Intronic
1093669338 12:21854281-21854303 TATCTATGCAGACAAATAGATGG - Intronic
1093808816 12:23468137-23468159 TATCTATTGAGATAATCATGTGG - Intergenic
1093979095 12:25454734-25454756 TATCTATTGAGATAATCATATGG - Intronic
1094437299 12:30434746-30434768 TATCTATTGAGATAATCATGTGG + Intergenic
1094734494 12:33219247-33219269 TATCTATTGAGATAATCACGTGG + Intergenic
1094877644 12:34669319-34669341 CATCTATTCAGATAATCATGTGG + Intergenic
1095488892 12:42712178-42712200 CATCTATTGAGATAATCACCTGG - Intergenic
1095663889 12:44771768-44771790 TTTATATTCAGATAACGAGCTGG + Intronic
1096032057 12:48427320-48427342 TATCTATTGAGATAATCATGTGG + Intergenic
1097372404 12:58800340-58800362 TATCTATTGAGATAACCATGTGG + Intronic
1097588257 12:61541195-61541217 TATCTATTGAGATAATCATGTGG - Intergenic
1097752262 12:63368660-63368682 TATCTATTGAGATAATCATGTGG + Intergenic
1097919312 12:65054498-65054520 TAGCTATGTAGATAAACAGCTGG - Intronic
1098077695 12:66750451-66750473 TGACAATTCATATAAACAGCTGG - Intronic
1098200315 12:68047556-68047578 CATCTATTGAGATAATCAGGTGG + Intergenic
1098371149 12:69761323-69761345 CATCTCTTCAGATAATAAGCTGG + Intronic
1098599985 12:72319245-72319267 TCTCTTTTCACCTAAACAGCTGG - Intronic
1098612596 12:72479515-72479537 TATCTACTCAGGTAAGCATCTGG + Intronic
1098694988 12:73541083-73541105 CATCTATTGAGATAATCATCTGG - Intergenic
1099549055 12:84020396-84020418 CATCTATTGAGATAATCAGGTGG - Intergenic
1099590249 12:84578000-84578022 TATCTATTGAGATAATCATTTGG - Intergenic
1099909122 12:88808113-88808135 AATCTATGCAGATATACAGCAGG - Intergenic
1100794238 12:98163778-98163800 CATCTATGGAGATAAGCAGCAGG + Intergenic
1100913818 12:99394857-99394879 CATCTATTCAGATATTCAGTAGG + Intronic
1100919612 12:99467188-99467210 CATCTATTGAGATAATCACCTGG - Intronic
1101069483 12:101059104-101059126 TATCTATTGAGATAATCATGTGG + Intronic
1101183961 12:102253381-102253403 TATCTATTGAGATAATCATGTGG + Intergenic
1101423933 12:104571956-104571978 CATCTATTCAGATAATCATGTGG + Intronic
1104451426 12:128871801-128871823 TATTTATTCAGCTGAACACCAGG - Intronic
1104456863 12:128922019-128922041 TGTCTATTCATATACACAGAAGG - Intronic
1104514972 12:129416785-129416807 CATCTATTGAGATAAACATGTGG + Intronic
1105651400 13:22382007-22382029 CATCTATTGAGATAAACATGTGG + Intergenic
1107090159 13:36470542-36470564 TATCTATTGAGATAATCATGTGG + Intergenic
1107324099 13:39222071-39222093 TATCTATTGAGATAATCATGTGG - Intergenic
1107673704 13:42773211-42773233 TATCTATTGAGATAATCATGTGG + Intergenic
1108170023 13:47731663-47731685 TATCTATTGAGATAATCATGTGG + Intergenic
1108308207 13:49159860-49159882 CATCTATTGAGATAAACATGTGG + Intronic
1108669590 13:52671124-52671146 TATGTATTCAGACAAGCAGAAGG - Intronic
1110135838 13:72066139-72066161 TATCTATTGAGATAATCATGTGG - Intergenic
1110460660 13:75741630-75741652 TATCTATTGAGATAATCATGTGG - Intronic
1110980921 13:81897145-81897167 TATCTATTGAGATAATCATGTGG - Intergenic
1111045524 13:82808976-82808998 AATCTATTGAGATAATCATCTGG - Intergenic
1111558784 13:89915934-89915956 TATATATTCATACACACAGCAGG - Intergenic
1111779031 13:92697938-92697960 TATCTATTGAGATAATCATGTGG + Intronic
1112400176 13:99070312-99070334 TACCTATTCACTTAAACAGCTGG + Intronic
1112949273 13:104971096-104971118 TATCAATACAGATATACAGATGG - Intergenic
1113974636 13:114217774-114217796 TATCTATTGAGATAATCATGTGG - Intergenic
1114275261 14:21137379-21137401 TATATATACAGAGAGACAGCGGG - Intergenic
1114633316 14:24173163-24173185 TATCTATTCGGATCTGCAGCTGG - Exonic
1114933316 14:27503156-27503178 TATCTATTGAGATAATCATGGGG + Intergenic
1115046557 14:29001894-29001916 CATCTATTGAGATAAACATGTGG + Intergenic
1115107541 14:29779036-29779058 CATCTATTCAGATAATCATGTGG - Intronic
1115132033 14:30065646-30065668 TATCTATTGAGATAATCATGTGG - Intronic
1116051754 14:39812459-39812481 CATGGATTCAGATAAACAACAGG - Intergenic
1116197985 14:41754006-41754028 CATCTATTGAGATAAACATGTGG + Intronic
1116320649 14:43457962-43457984 CATCTATTGAGATAATCAGTTGG - Intergenic
1116403510 14:44539580-44539602 TATCTATTGAGATAATCATATGG - Intergenic
1116484593 14:45432187-45432209 TATCTATTGAGATAATCATATGG + Intergenic
1117597680 14:57340330-57340352 TATCTATTGAGATAATCATGTGG + Intergenic
1117671663 14:58113619-58113641 TATCTAATCAGATATCCAGCAGG - Intronic
1117866991 14:60160371-60160393 TATCTTTTCAGATACAAAGTAGG - Intronic
1117944565 14:61005086-61005108 CATCTATTGAGATAAACATGTGG - Intronic
1118344974 14:64931942-64931964 TATCAATTTATATAAACAACAGG + Intronic
1118479345 14:66148012-66148034 TATCTATTGAGATAATCATATGG - Intergenic
1120571233 14:86119008-86119030 TATCTATTGAGATAATCATGTGG + Intergenic
1121222920 14:92299865-92299887 TATCTCTACAGATAATTAGCTGG + Intergenic
1121299235 14:92856712-92856734 CATCTATTGAGATAATCATCTGG - Intergenic
1121793971 14:96720473-96720495 TATCTCCCCAGGTAAACAGCTGG - Intergenic
1122358822 14:101144381-101144403 CATCTATTGAGATAAACATGTGG - Intergenic
1123452128 15:20374700-20374722 CATCTATTGAGATAATCAGGTGG + Intergenic
1123757856 15:23410960-23410982 TTTTTATTCTGATAAAGAGCAGG + Intergenic
1123786461 15:23679573-23679595 CATCTATTGAGATAATCAGGTGG + Intergenic
1123953928 15:25314087-25314109 CATCTATTGAGATAAACATATGG + Intergenic
1125354184 15:38799710-38799732 TATCTATTGAGATAATCATGTGG + Intergenic
1126206154 15:46047299-46047321 TATCTATTGAGATAATCATGTGG - Intergenic
1126262654 15:46712389-46712411 AATCTATTCTGACAAATAGCAGG + Intergenic
1126357966 15:47816270-47816292 AATGTATTCAGATAAAGAGGGGG + Intergenic
1126372736 15:47964416-47964438 TGTCTATTCAGACAAACACATGG - Intergenic
1126427749 15:48547584-48547606 TATCAAGACAGATAAACGGCAGG + Intronic
1126662166 15:51043979-51044001 TAGCTATTCTGTTAATCAGCAGG - Intergenic
1126715302 15:51509955-51509977 TATCTATTGAGATAATCATGTGG - Intronic
1127326579 15:57901488-57901510 TATCTATTGAGATAATCATGTGG + Intergenic
1129621642 15:77152731-77152753 TATCTATTGAGATAATCATGTGG + Intronic
1130619712 15:85449664-85449686 TATCTATTGAGATAATCATGTGG + Intronic
1130922605 15:88360956-88360978 TATCTATTGAGATAATCATGTGG - Intergenic
1131639790 15:94279847-94279869 CATCTATTCAGATAATCATGTGG + Intronic
1133387426 16:5381181-5381203 TCTCTATACAGATAAAGACCAGG - Intergenic
1134458473 16:14411795-14411817 CATTTATTCTGATAAAGAGCAGG - Intergenic
1135194361 16:20382356-20382378 TATTTATACAGTCAAACAGCAGG - Intronic
1136659504 16:31744366-31744388 TATCTATTGAGATAATCATGTGG + Intronic
1136872608 16:33821793-33821815 TCTTTAATCAGATAAACAGTTGG - Intergenic
1136992899 16:35167309-35167331 TATCTATTGAGATAATCATGTGG - Intergenic
1137347684 16:47680011-47680033 CATCTATTCAGATAATCATGTGG + Intronic
1137371802 16:47913747-47913769 CATCTATTGAGATAATCAGGTGG - Intergenic
1139002741 16:62533184-62533206 TATCAAGTCAGATAAATTGCTGG + Intergenic
1140444916 16:75018634-75018656 TATTTATTCAGATGATCATCTGG + Intronic
1140618187 16:76693153-76693175 CATCTATTGAGATAACCAGGTGG + Intergenic
1140767141 16:78170322-78170344 TCTCTATTCAGAGATACAGGTGG + Intronic
1203099564 16_KI270728v1_random:1294280-1294302 TCTTTAATCAGATAAACAGTTGG + Intergenic
1142931584 17:3289521-3289543 GATCTTTGGAGATAAACAGCAGG + Intergenic
1144083425 17:11785079-11785101 TCACTATTCAGATAAGCAGTTGG - Intronic
1145724085 17:27101398-27101420 CATCTATTGAGATAATCATCTGG + Intergenic
1145732285 17:27199992-27200014 TTTCTGTTCAGGTAAACTGCAGG - Intergenic
1146145153 17:30409098-30409120 TATCTATTGAGATAATCATGTGG + Intronic
1146237442 17:31180494-31180516 TATCTATTGAGATAATCATGTGG - Intronic
1146613970 17:34336666-34336688 CATCTATTCAGATAATCATGTGG + Intergenic
1147049626 17:37782924-37782946 TATCTATTGAGATAATCATGTGG + Intergenic
1147838531 17:43353339-43353361 TACATAATCAGATAAACTGCTGG - Intergenic
1148986269 17:51624782-51624804 TATCTATTGAGATAATCATGTGG - Intergenic
1149058889 17:52397877-52397899 CATCTATTCAGATAACCATGTGG + Intergenic
1149411403 17:56411730-56411752 TATCTATTGAGATAATCATATGG + Intronic
1203166643 17_GL000205v2_random:103249-103271 TATCTAATCAGGTGCACAGCTGG + Intergenic
1153064582 18:1031551-1031573 TATCTATTGAGATAATCATGTGG + Intergenic
1153717057 18:7860414-7860436 AATGGATTCAGATAAACAGATGG + Intronic
1154111668 18:11574349-11574371 GATCTATTGAGATAATCAGATGG - Intergenic
1155810313 18:30225002-30225024 CATCTATTGAGATAACCAGGTGG + Intergenic
1155985885 18:32230162-32230184 TATCTATTGAGATAATCATGTGG + Intronic
1156116308 18:33790771-33790793 CATCTATTGAGATAATCAGGTGG - Intergenic
1156142955 18:34138919-34138941 CATCTATTGAGATAAACATGTGG + Intronic
1156166380 18:34426204-34426226 TATCTATTGAGATAATCACGTGG + Intergenic
1156760973 18:40590015-40590037 TATCTATTTAGAAAAAAAGATGG - Intergenic
1157127738 18:44973119-44973141 CATCTATTGAGATAATCATCTGG + Intronic
1157360011 18:46967915-46967937 CCTTTCTTCAGATAAACAGCAGG + Intronic
1157360610 18:47021507-47021529 CCTTTCTTCAGATAAACAGCAGG + Intronic
1157361599 18:47027422-47027444 CCTTTCTTCAGATAAACAGCAGG + Intronic
1157420162 18:47541052-47541074 TATCTATTGAGATAATCATGTGG + Intergenic
1158337516 18:56429618-56429640 CATCTATTGAGATAATCAGGTGG - Intergenic
1158921271 18:62193606-62193628 TATCTATTGAGATAATCATGTGG + Intronic
1159281842 18:66295702-66295724 CATCTATTGAGATAAACATGTGG - Intergenic
1159359055 18:67377746-67377768 CATCTATTGAGATAAACATGTGG + Intergenic
1159398905 18:67904037-67904059 TTTTTATTCAGATAAATAGTTGG - Intergenic
1159485228 18:69047289-69047311 TATCTATTGAGATAATCATGTGG - Intronic
1160580387 18:79880846-79880868 CATCTGTTGAGATGAACAGCTGG - Intronic
1163941069 19:20494348-20494370 TATCTATTGAGATAATCATGTGG - Intergenic
1163955054 19:20630021-20630043 TATCTATTGAGATAATCATGTGG + Intronic
1164359496 19:27488077-27488099 TATTTCTTCAGATAAAAAGTAGG + Intergenic
1164500638 19:28816819-28816841 GATGGATTCAGATAAAAAGCTGG + Intergenic
1165283574 19:34818159-34818181 TATCTTTTAAGGTAAATAGCAGG + Intergenic
1165677635 19:37741579-37741601 TATCTATTGAGATAATCATGTGG - Intronic
1165980270 19:39716183-39716205 CATCTATTGAGATAATCATCTGG + Intergenic
924970689 2:124968-124990 CATCTATTCTGATAAAAAGAAGG + Intergenic
925642692 2:6001870-6001892 TGTCAATACAGATAAACTGCAGG + Intergenic
926074347 2:9929102-9929124 CATCTATTGAGATAATCAGGTGG + Intronic
926348465 2:11971841-11971863 TATCTATTGAGATAATCATATGG + Intergenic
926484848 2:13441575-13441597 CATCTATTGAGATAATCAGGTGG - Intergenic
926510336 2:13769198-13769220 TATCTATTCAGATATTCATCTGG + Intergenic
926617796 2:15015536-15015558 TATCTATTGAGATAATCATATGG - Intergenic
926775930 2:16423317-16423339 TGTCTATTCGGAGAAGCAGCTGG - Intergenic
926873514 2:17449461-17449483 AATCTATTTAGATAATCAGGTGG - Intergenic
926892624 2:17650954-17650976 TATCTTTTCTGATAACCTGCTGG - Intronic
926925715 2:17985359-17985381 TATCTATTGAGATAATCATGTGG + Intronic
926928659 2:18014246-18014268 TATCTATTGAGATAATCATGTGG + Intronic
927456738 2:23258429-23258451 AATCTTTGCAGAAAAACAGCTGG - Intergenic
928386789 2:30876259-30876281 TATCTATTGAGATAATCATGTGG - Intergenic
928486996 2:31742400-31742422 TATCTATTGAGATAATCATGTGG + Intergenic
928631523 2:33198140-33198162 CATCTATTGAGATAATCAGGTGG + Intronic
929262178 2:39877956-39877978 TATCTATTGAGATAATCATGTGG + Intergenic
930264369 2:49182749-49182771 CATCTATTGAGATAATCATCTGG + Intergenic
930457411 2:51622950-51622972 TATCTGTTTAGTTATACAGCAGG + Intergenic
930472514 2:51836912-51836934 TATCTATTGAGATAATCATGTGG - Intergenic
931818294 2:65926429-65926451 TATCTATTGAGATAATCATGTGG + Intergenic
931860471 2:66349125-66349147 CATCTATTGAGATAAACATGTGG + Intergenic
931985828 2:67741198-67741220 TATCTATTGAGATAATCATGTGG + Intergenic
932914246 2:75837871-75837893 TATCTATTGAGATAATCATGTGG - Intergenic
935604382 2:104955845-104955867 TATCTATTGAGATAATCACGTGG + Intergenic
935615862 2:105081086-105081108 TACCTATTTAAATGAACAGCAGG - Intronic
935900774 2:107790355-107790377 CATCTATTCAGATAATCATGTGG - Intergenic
936274351 2:111080920-111080942 TATCTATTGAGATAATCATGTGG - Intronic
936644937 2:114357979-114358001 CATCTATTGAGATAATCAGGTGG + Intergenic
936821203 2:116523665-116523687 TATCTATTGAGATAATCATGTGG + Intergenic
936832737 2:116668678-116668700 TATCTATTGAGATAATCATGTGG - Intergenic
937740224 2:125343387-125343409 CATCTATTGAGATAAACATATGG - Intergenic
939450742 2:142370782-142370804 TATCTACTCAGATAAAAAGTAGG - Intergenic
939840965 2:147186281-147186303 CATCTATTGAGATAATCAGGTGG - Intergenic
940066889 2:149640116-149640138 CATCTATTGAGATAATCATCTGG + Intergenic
940240466 2:151557767-151557789 TATCTATTGAGATAATCATGTGG - Intronic
940370911 2:152899767-152899789 TATCTATTGAGATAATCATGTGG - Intergenic
940595189 2:155782433-155782455 TATCTATTGAGATAATCATGTGG - Intergenic
940720413 2:157276063-157276085 CATCTATTCAGATAATCATGTGG + Intronic
941055913 2:160787899-160787921 GGTTTATTCAGATAAACTGCCGG - Intergenic
941668993 2:168270706-168270728 TATCTTTGCAGATAGACAGAGGG - Intergenic
942411411 2:175713013-175713035 CATCTATTCAGATAATCATGTGG - Intergenic
942875011 2:180784652-180784674 TATCTATTGAGATAACCATGTGG + Intergenic
943352829 2:186815721-186815743 CATCTATTGAGATAAGCATCTGG - Intergenic
943522400 2:188969232-188969254 TTTCTATTCAGATACACAATGGG - Intergenic
943527306 2:189032601-189032623 TTTCTTTTAAAATAAACAGCTGG - Exonic
944009488 2:194956277-194956299 CATCTATTGAGATAAACATGTGG + Intergenic
944147660 2:196523718-196523740 CATCTATTCAGATAATCATGTGG + Intronic
944262183 2:197689779-197689801 CATCTATTCAGATAATCATGTGG + Intergenic
944266507 2:197732709-197732731 CATCTATTCAGATAATCATGTGG - Intronic
944585448 2:201168374-201168396 TATCTATTGAGATAATCATGTGG - Exonic
945026192 2:205622088-205622110 TAACTGTTCAGTTAAACAGCAGG + Intergenic
945116423 2:206412300-206412322 CATCTATTGAGATAAACATGTGG + Intergenic
945525587 2:210884528-210884550 TATGTATTCAGATAAACCAATGG - Intergenic
945719606 2:213403456-213403478 CATCTATTGAGATAATCAGGTGG - Intronic
945761240 2:213918011-213918033 CATCTATTGAGATAATCATCTGG + Intronic
946137822 2:217662635-217662657 TATTTATTCAGAATCACAGCAGG + Intronic
946867318 2:224053756-224053778 TATATACTCAGATAAAAATCTGG + Intergenic
946993099 2:225358543-225358565 TATCTGTTCAGAAAAAGTGCTGG + Intergenic
947313622 2:228830890-228830912 CATCTATTGAGATAATCATCTGG - Intergenic
947335515 2:229078637-229078659 TATCTATTGAGATAATCATGTGG + Intronic
947424146 2:229967620-229967642 CATCTATTGAGATAAACATGTGG + Intronic
947440256 2:230114302-230114324 CATCTATTGAGATAAACACGTGG + Intergenic
947452547 2:230221782-230221804 GATCTATTCAGAGATACACCAGG + Intronic
1169064063 20:2683518-2683540 CATCTATTCAGATAATCATGTGG + Intergenic
1169626116 20:7571540-7571562 TATCTATTTAGTTAGACACCTGG + Intergenic
1170229012 20:14024614-14024636 TATCTATTAAGATAATCATGTGG + Intronic
1170294598 20:14810338-14810360 TATCTATTGAGATAATCATGTGG - Intronic
1171058867 20:21936369-21936391 TTTCTTTTAAAATAAACAGCAGG + Intergenic
1171809014 20:29725072-29725094 TATCTATTGAGATAATCATGTGG - Intergenic
1173774233 20:45690083-45690105 CATCTATTGAGATAATCAGGTGG + Intronic
1174971111 20:55276603-55276625 CATCTATTCAGATAATCATGTGG + Intergenic
1175041310 20:56053781-56053803 TATCTATTGAGATAATCATGTGG - Intergenic
1175297581 20:57919625-57919647 CATCTATACAAATTAACAGCTGG - Intergenic
1175504511 20:59472154-59472176 TGTCTATTCAGATGAGCCGCCGG + Intergenic
1176334899 21:5587317-5587339 TATCTAATCAGGTGCACAGCTGG - Intergenic
1176392858 21:6233631-6233653 TATCTAATCAGGTGCACAGCTGG + Intergenic
1176405109 21:6355848-6355870 TATCTAATCAGGTGCACAGCTGG - Intergenic
1176432048 21:6633256-6633278 TATCTAATCAGGTGCACAGCTGG + Intergenic
1176468561 21:7082543-7082565 TATCTAATCAGGTGCACAGCTGG - Intronic
1176492122 21:7464321-7464343 TATCTAATCAGGTGCACAGCTGG - Intergenic
1176508520 21:7674062-7674084 TATCTAATCAGGTGCACAGCTGG + Intergenic
1176919350 21:14668447-14668469 CATCTATTGAGATAATCAGGAGG - Intergenic
1177606852 21:23390747-23390769 TATCTGTTCTGGTAAAAAGCTGG + Intergenic
1177628112 21:23690928-23690950 TATATATATAGATAATCAGCTGG + Intergenic
1177829293 21:26119086-26119108 CATCTATTTAGATAATCAGAAGG + Intronic
1178226778 21:30728564-30728586 TATCTATTGAGATAATCATGTGG - Intergenic
1178394022 21:32224026-32224048 CATCTATTGAGATAATCATCTGG - Intergenic
1178560021 21:33629974-33629996 TATCTATTGAGATGATCAGAGGG + Intronic
1181143829 22:20828907-20828929 TATCTATTAAGATAATCACATGG + Intronic
1181342286 22:22191712-22191734 TATCTATTGAGATAATCATGTGG - Intergenic
1185129492 22:49030547-49030569 AATATTTTCAGATAAAGAGCTGG + Intergenic
949114547 3:303967-303989 TATCTATTGAGATAATCATGTGG + Intronic
949298026 3:2549441-2549463 CATCTATTGAGATAATCAGGTGG + Intronic
949401909 3:3673725-3673747 CATCTATTCAGATAATCATGTGG - Intergenic
949440517 3:4075241-4075263 TATCTATTGAGATAATCATGTGG - Intronic
949650564 3:6154232-6154254 TATATAAACAGCTAAACAGCTGG + Intergenic
949718110 3:6957015-6957037 TATCTATACATATAAATAGAAGG - Intronic
949816324 3:8062478-8062500 TATCTATTGAGATAATCATGTGG - Intergenic
951255197 3:20440502-20440524 TATCTTTTCAGAAAAACAAATGG + Intergenic
952615760 3:35271744-35271766 TATCTATTAAGATGATCATCTGG - Intergenic
953047588 3:39308451-39308473 CATCTATTGAGATAATCAGGTGG - Intergenic
953080954 3:39617237-39617259 TATCTATTGAGATAATCATGTGG + Intergenic
953101933 3:39838451-39838473 TATCTATTGAGATAATCATGTGG + Intronic
953238538 3:41127312-41127334 CAGCTATTAAAATAAACAGCAGG + Intergenic
954507826 3:51093910-51093932 CATCTATTGAGATAAACATGTGG + Intronic
954816925 3:53289743-53289765 AATGTATTCAGATAATTAGCTGG - Intronic
954836153 3:53470209-53470231 CATCTATTCAGATAACCATGTGG + Intergenic
955670908 3:61401565-61401587 CATCTATTAAGAAAAACATCAGG + Intergenic
955895768 3:63698139-63698161 TATCTATTGAGATAATCATGTGG - Intergenic
957130536 3:76218061-76218083 CATCTATTGAGATAATCATCTGG - Intronic
957306453 3:78464144-78464166 TATCTATTGAGATAATCATGTGG + Intergenic
957565758 3:81882013-81882035 CATCTATTGAGATAATCATCTGG - Intergenic
957850343 3:85799513-85799535 TATCTATTGAGATAATCATGTGG + Intronic
958010575 3:87873875-87873897 TATCTATTGAGATAATCATATGG - Intergenic
958028344 3:88075676-88075698 TGTCATTTCAGATAAGCAGCTGG + Intronic
958156098 3:89757623-89757645 TATCTATTGAGACAAACATGTGG + Intergenic
958208215 3:90432894-90432916 CATCTATTCAGATAATCATGTGG + Intergenic
959097068 3:101967633-101967655 TATCTATTGAGATAATCATGCGG + Intergenic
959821900 3:110745357-110745379 CATCTATTCAGATAATCAGGTGG - Intergenic
960476543 3:118136945-118136967 TATGTATTCAGATTATCATCTGG + Intergenic
960873042 3:122269456-122269478 TATCTATTCAGAAAATCATGTGG + Intronic
961675007 3:128559462-128559484 TATCTTTTTAAATACACAGCAGG + Intergenic
961903697 3:130240408-130240430 TATCTATTCAGATAATCATGTGG + Intergenic
962179477 3:133190699-133190721 TATCTCTTCAGTAAAGCAGCAGG + Intronic
962183589 3:133234499-133234521 TATCTATTGAGATAATCATGTGG - Intronic
962617442 3:137141253-137141275 CATCTATTGAGATAATCAGGTGG - Intergenic
962641918 3:137396414-137396436 TATCTATTGAGATAATCATGTGG - Intergenic
963626944 3:147684938-147684960 TATCTATTGAGATAATCATGTGG + Intergenic
964063661 3:152555920-152555942 TATCTTTTCAAATAATCAACGGG + Intergenic
964373178 3:156022838-156022860 TATATATATATATAAACAGCTGG + Intergenic
964595643 3:158424321-158424343 CATCTATTGAGATAAACATGTGG + Intronic
964901673 3:161667082-161667104 TATCTATTGAGATAATCATATGG + Intergenic
965393387 3:168132189-168132211 TATCTATTGAGATAATCATGTGG - Intergenic
965623551 3:170664612-170664634 TATCTATTGAGATAATCATGTGG + Intronic
965706826 3:171517281-171517303 TATCTATTGAGATAATCATGTGG + Intergenic
966338669 3:178900771-178900793 CACCTATTGAGATAAACATCAGG - Intergenic
967239775 3:187426652-187426674 CATCTATTGAGATAAACATGTGG + Intergenic
967536923 3:190615593-190615615 TATCTATTCTGATAAATAGCAGG - Intronic
969952289 4:10850377-10850399 TATCTATTGAGATAATCATCTGG + Intergenic
970305037 4:14722615-14722637 TATCTATTGAGATAATCATGTGG - Intergenic
970520888 4:16882648-16882670 TATCCTTTCAGACAAACACCTGG + Intronic
970642795 4:18086095-18086117 TATCTATTGAGATAATCATGTGG - Intergenic
970896980 4:21115418-21115440 TATTTATTCATTTAAACAACAGG - Intronic
970965769 4:21926031-21926053 TATATATTCAGCTAAAGAGTTGG + Intronic
971037376 4:22708768-22708790 TAACTATCCAGAAAAACAACTGG + Intergenic
971950333 4:33336653-33336675 TATCTATTGAGATAATCATATGG + Intergenic
972136036 4:35895425-35895447 CATCTATTGAGATAATCAGGTGG - Intergenic
972147077 4:36041075-36041097 TATCTATTGAGATAATCATTGGG + Intronic
972372103 4:38434439-38434461 CATCTATTGAGATAATCAGGTGG + Intergenic
972968518 4:44543244-44543266 TACCTTTTCATATAAACAGTTGG + Intergenic
973834935 4:54800077-54800099 TATCTATTGAGATAATCATGTGG - Intergenic
973836119 4:54810984-54811006 TATCTATTGAGATAATCATGTGG - Intergenic
973877322 4:55232866-55232888 TATCTATTGAGATAATCATGTGG + Intergenic
973921834 4:55694696-55694718 CATCTATTCAGATGAACATGTGG - Intergenic
974127987 4:57719023-57719045 CATCTATTGAGATAAACATGTGG - Intergenic
974339734 4:60600106-60600128 TATCTATTGAGATAATCATGTGG + Intergenic
974619446 4:64337175-64337197 TATCTATTGAGATAATCATGTGG - Intronic
974837667 4:67270429-67270451 TATCTATTGAGATAATCATGTGG + Intergenic
974851362 4:67408602-67408624 CATCTATTCAGATAATCATGTGG + Intergenic
975289005 4:72655037-72655059 TATCTATTGAGATAATCATGTGG - Intergenic
975520332 4:75293889-75293911 TATCTATTGAGATAATCATGTGG + Intergenic
976023393 4:80658474-80658496 CATCTATTGAGATAATCATCTGG + Intronic
976330557 4:83826344-83826366 CATCTATTGAGATAAACATGTGG - Intergenic
976533967 4:86189989-86190011 CATCTATTGAGATAAACATGTGG + Intronic
976754574 4:88484226-88484248 TATATATTCAGATAAATAAAAGG - Intronic
977519232 4:98059812-98059834 TATCTATTGAGATAATCATATGG - Intronic
977998683 4:103529041-103529063 CATCTATTGAGATAATCAGGTGG - Intergenic
978266319 4:106830246-106830268 TATCTATTGAGATAATCATGTGG - Intergenic
978538335 4:109786984-109787006 TAGCTATTCAGAGAAACACAAGG - Intronic
978699419 4:111624967-111624989 TATCTATTTAGATAATCATGTGG + Intergenic
979445301 4:120805600-120805622 TATCTATTGAGATAATCATGCGG - Intronic
979591673 4:122488161-122488183 CATCTATTGAGATAAACATGTGG + Intergenic
979827548 4:125257902-125257924 TATCTATTGAGATAATCATGTGG + Intergenic
979925298 4:126555601-126555623 TATCTATTGAGATAATCATGTGG - Intergenic
980426503 4:132633521-132633543 TATCTATTGAGATAATCATGTGG + Intergenic
980561469 4:134482067-134482089 TATCTATTGAGATAATCATATGG + Intergenic
980604880 4:135076887-135076909 CATCTATTGAGATAATCAGGTGG + Intergenic
980664195 4:135907201-135907223 CATCTATTCAGATAATCATGTGG + Intergenic
981109752 4:140921867-140921889 CATCTATTCAGATAATCATGTGG - Intronic
981131925 4:141166692-141166714 TATCTATTGAGATAATCATGTGG - Intronic
981141288 4:141272336-141272358 CATCTATTCAGATAATCATGTGG - Intergenic
981151255 4:141381661-141381683 CATCTATTCAGATAATCATGTGG - Intergenic
981152950 4:141400071-141400093 CATCTATTCAGATAATCATGTGG - Intergenic
982579482 4:157159575-157159597 CATCTATTGAGATAATCATCTGG + Intronic
982580825 4:157177136-157177158 CATCTATTGAGATAATCATCTGG + Intergenic
982733956 4:158985532-158985554 CATCTATTGAGATAATCATCTGG - Intronic
982917871 4:161235969-161235991 TATCTAATCAGATAAACAGGAGG - Intergenic
983052694 4:163067329-163067351 TAAATATAAAGATAAACAGCTGG + Intergenic
984525787 4:180858089-180858111 CATCTATTGAGATAATCATCTGG + Intergenic
984590644 4:181613712-181613734 GATTTATTCAGATAAACCACTGG + Intergenic
986189160 5:5477881-5477903 TATCTATTGAGATAATCATGTGG - Intronic
986879940 5:12157393-12157415 TATCTATTGAGATAATCATGTGG - Intergenic
987598836 5:20038592-20038614 TATCTATTGAGATAATCATATGG - Intronic
987635141 5:20529637-20529659 TGTCTATTGAGATAATCATCTGG - Intronic
988218357 5:28307090-28307112 TATTTTTTCAGATAAACACATGG - Intergenic
988719564 5:33862941-33862963 TATCTATTGAGATAATCATGTGG - Intronic
989284597 5:39684759-39684781 CATCTATTGAGATAAACATGTGG + Intergenic
989412570 5:41137271-41137293 CATCTATTCAGATAATCATGTGG - Intergenic
989739920 5:44758801-44758823 CATCTATTGAGATAAACATGTGG - Intergenic
990127555 5:52537121-52537143 CATCTATTGAGATAAACATGTGG - Intergenic
990226597 5:53662239-53662261 CATCTATTCAGATAATCATGTGG + Intronic
990665044 5:58062590-58062612 TAGATATTCAGAAAAAGAGCAGG + Intergenic
990707625 5:58547600-58547622 TAAACATTCAGATAAACAACAGG - Intronic
991199350 5:63973427-63973449 TATCTATTGAGATAATCATATGG - Intergenic
992016573 5:72581194-72581216 CATCTATTGAGATAATCATCTGG - Intergenic
993207267 5:84897547-84897569 TGTGTAATCAGATAAAAAGCAGG - Intergenic
993370659 5:87088302-87088324 TATCTATTGAGATAATCATATGG - Intergenic
993646108 5:90464781-90464803 TATCTATTGAGATAATCATATGG - Intronic
993663256 5:90664856-90664878 TATCTATTGAGATAATCATGTGG + Intronic
994143203 5:96364075-96364097 TATCTATTGAGATAATCATCTGG + Intergenic
994164524 5:96595223-96595245 TATCTACCTAGATAAACATCCGG - Intronic
994166153 5:96610418-96610440 TATCTATTGAGATAATCATATGG - Intronic
994290792 5:98026797-98026819 CATCTATTCAGATAATCATGTGG - Intergenic
994351017 5:98746221-98746243 TATCTATTGAGATAATCATGTGG - Intergenic
994488018 5:100403559-100403581 TATCTATTCTTATAAACACTAGG - Intergenic
994512045 5:100716662-100716684 TATCTATTGAGATAATCATGTGG + Intergenic
994659614 5:102637981-102638003 CATCTATTCAGATGACCAGAGGG - Intergenic
995325878 5:110889272-110889294 CATCTATTGAGATAATCAGGTGG + Intergenic
996427553 5:123331600-123331622 CATCTATTGAGATAATCAGGTGG + Intergenic
996490532 5:124089476-124089498 TATATAAACAGATAAAAAGCTGG + Intergenic
996569317 5:124915072-124915094 CATCTATTGAGATAATCAGGTGG - Intergenic
996784174 5:127220451-127220473 TATCTATTGAGATAATCATATGG - Intergenic
997120871 5:131171428-131171450 AGTTTATTCAGATAAACAGAAGG + Intronic
997343564 5:133167447-133167469 TATCTATTGAGATAATCACGTGG + Intergenic
998541625 5:142987738-142987760 TATCTATTGAGATAATCATGTGG + Intronic
998779785 5:145643755-145643777 TATCTATTGAGATAATCATGTGG + Intronic
1000057604 5:157621350-157621372 CATCTATTGAGATAATCAGGTGG - Intergenic
1000535947 5:162478411-162478433 CATCTATTGAGATAATCATCTGG - Intergenic
1000582460 5:163050739-163050761 TATCTATTGAGATAATCATGTGG - Intergenic
1002334583 5:178469140-178469162 TATCCATTCTGATAAACACGTGG + Intronic
1002686208 5:181012403-181012425 CATCTATTCAGATAATCATGTGG - Intergenic
1003820069 6:9886194-9886216 TATCTATTGAGATAATCATGTGG - Intronic
1004103078 6:12635138-12635160 TATCTATTGAGATAATCATGTGG + Intergenic
1004342626 6:14820846-14820868 TCTCCATTCAGATGAACAGGAGG + Intergenic
1004825919 6:19421116-19421138 TGTCTATTCAGATAATCATGTGG + Intergenic
1005378651 6:25211124-25211146 TATCTATTGAGATAATCATGTGG - Intergenic
1005710663 6:28501101-28501123 TTTCTATTTAGGTACACAGCAGG + Intergenic
1006197978 6:32259337-32259359 TATCTATTGAGATAATCATGTGG + Intergenic
1006200317 6:32282567-32282589 TATCTATTGAGATAATCATGTGG - Intergenic
1006616960 6:35335848-35335870 TATCTATTGAGATAATCATGTGG - Intergenic
1008006670 6:46417501-46417523 TATCAATTTGGATAAAAAGCAGG + Intronic
1008208461 6:48691289-48691311 TATCTATTGAGATAATCATGTGG - Intergenic
1009182858 6:60539248-60539270 TATCTATTGAGATAATCATGTGG - Intergenic
1009423417 6:63488110-63488132 TATCTTGTCAGAAAAGCAGCTGG - Intergenic
1009909305 6:69905476-69905498 CATCTTTGCAGATGAACAGCGGG - Intronic
1010295446 6:74191042-74191064 CATCTATTGAGATAATCAGGTGG + Intergenic
1010353864 6:74907653-74907675 CATCTATTGAGATAATCAGGTGG - Intergenic
1010607051 6:77903775-77903797 TATCTATTCAGATTATCATATGG + Intronic
1010675680 6:78740105-78740127 CATCTATTGAGATAATCATCTGG + Intergenic
1010839590 6:80632927-80632949 AATCTTTTCATATAAACAGTTGG - Intergenic
1010854739 6:80823885-80823907 CATCTATTGAGATAAACATGTGG - Intergenic
1010888125 6:81269460-81269482 CATCTATTGAGATAATCAGGGGG - Intergenic
1010956758 6:82098999-82099021 TATCTATTAAGATAATCATGTGG - Intergenic
1011828381 6:91338406-91338428 TATCTATTGAGATAATCATATGG + Intergenic
1011951249 6:92967670-92967692 AATGTTTTCAGATAAAGAGCTGG - Intergenic
1011979168 6:93350865-93350887 AATCTTTTCTGATAGACAGCGGG - Intronic
1012118614 6:95335822-95335844 CATCTATTAAGATAAACAGATGG + Intergenic
1012121858 6:95378730-95378752 TATCTATTGAGATAATCATGTGG - Intergenic
1012148873 6:95720477-95720499 CATCTATTGAGATAATCAGGTGG - Intergenic
1012540031 6:100351915-100351937 TATGTAATCAGTTAAAGAGCAGG + Intergenic
1012590613 6:100975587-100975609 TATCTATTGAGATAACCATGTGG - Intergenic
1013377919 6:109536846-109536868 CATCTATTGAGATAACCATCTGG + Intronic
1013708589 6:112870696-112870718 TATCTATTCAGATAATCATGTGG - Intergenic
1013901542 6:115162882-115162904 CATCTATTGAGATAATCATCCGG + Intergenic
1014375514 6:120667519-120667541 TATCTATTGAGATAATCATGTGG + Intergenic
1014868580 6:126562345-126562367 CATCTATTGAGATAAACATGTGG - Intergenic
1014924910 6:127258908-127258930 CATCTATTGAGATAATCATCTGG - Intergenic
1015247407 6:131090218-131090240 CATCTATTGAGATAATCAGGTGG - Intergenic
1015651702 6:135469258-135469280 TGTCTATTCAGATAATCATATGG - Intronic
1016227633 6:141759630-141759652 TATCTATTGAGATAATCATGTGG + Intergenic
1016787536 6:148028485-148028507 AAGCTATTTAGATAAACAGCAGG + Intergenic
1018108877 6:160515802-160515824 TATCTATTGAGATAATCATGTGG - Intergenic
1018166895 6:161106374-161106396 TATCTATTCAGATAAACAGCAGG - Intronic
1020330014 7:7008038-7008060 CATCTATTGAGATAAACATATGG + Intergenic
1020428980 7:8100027-8100049 TATCTATTGAGATAATCATGTGG - Intergenic
1020835060 7:13138892-13138914 TAGCTACTCAGAGAAAAAGCAGG + Intergenic
1020844554 7:13266484-13266506 TATGTATTCATAGAAACAGGTGG - Intergenic
1021954802 7:25813594-25813616 TCTCCACTCAGATAAACATCAGG + Intergenic
1024106407 7:46092095-46092117 TATCTATTCAGATGATCATGTGG + Intergenic
1024710376 7:52008860-52008882 TTTCTATGCAGAAAAACAGGAGG + Intergenic
1024821039 7:53330208-53330230 TATCTATTGAGATAACCATGTGG + Intergenic
1024900012 7:54308270-54308292 TATCTATTGAGATAATCATGTGG + Intergenic
1025597565 7:62950328-62950350 TATCTATTGAGATAATCATGTGG - Intergenic
1027923110 7:84421759-84421781 CATCTATTCAGATAATCATGTGG + Intronic
1028212716 7:88094754-88094776 TATTTAATCAGAAAGACAGCAGG - Intronic
1028369404 7:90073853-90073875 TATCTATTGAGATAATCACGTGG - Intergenic
1028436515 7:90810370-90810392 CATCTATTCAGATAATCATGTGG - Intronic
1028648602 7:93125226-93125248 TATCTATTGAGATAATCATGTGG - Intergenic
1028992126 7:97060388-97060410 TATCTATTGAGATAATCATGTGG - Intergenic
1029808371 7:103020223-103020245 TATCTATTGAGATAATCATGTGG - Intronic
1030331391 7:108274980-108275002 TATCTATTGAGATAATCATGTGG + Intronic
1030697362 7:112600715-112600737 TATCTATTGAGATAATCATGTGG - Intergenic
1031150028 7:118042966-118042988 TATCTATTCAGACATGCATCTGG + Intergenic
1032121990 7:129163257-129163279 TGTTTATTGAGATAAACAGAAGG + Intronic
1032883100 7:136111104-136111126 TATCTATTGAGATAATCATGTGG + Intergenic
1034371422 7:150600972-150600994 TATCTATTGAGATAATCATGTGG - Intergenic
1036448520 8:8844502-8844524 GATCTTTTCAGATAAGAAGCTGG - Intronic
1036515895 8:9443551-9443573 TATCTATTGAGATAATCATGTGG + Intergenic
1036828450 8:11999422-11999444 TATCTATGTTGATAAACAGCTGG + Intergenic
1036964964 8:13287131-13287153 AATCTCTTCAACTAAACAGCTGG + Intronic
1038121796 8:24625310-24625332 TCTCTTTTCAGTTTAACAGCTGG + Intergenic
1039154421 8:34539295-34539317 CATCTATTGAGATAATCATCAGG - Intergenic
1039832703 8:41228854-41228876 TATCTATTGAGATAATCATGTGG - Intergenic
1040367469 8:46732893-46732915 TATCTATTGAGATAAGCATGTGG - Intergenic
1041387857 8:57323188-57323210 TATCTATTGAGATAATCATGTGG + Intergenic
1041625720 8:60024427-60024449 CATCTATTGAGATAATCAGGTGG + Intergenic
1041859340 8:62494263-62494285 TATCTATTGAGATAATCATGTGG + Intronic
1042320046 8:67465703-67465725 TGTCTATTGAGATACACAGATGG + Intronic
1042597191 8:70462455-70462477 CATCTATTGAGATAAACATGTGG + Intergenic
1042808348 8:72796392-72796414 TTTTTATTGAGGTAAACAGCTGG + Intronic
1043001347 8:74763864-74763886 TATCTATTGAGATAATCATGTGG - Intronic
1043312129 8:78873811-78873833 CATCTATTCAGATAATCATGTGG + Intergenic
1043508793 8:80929799-80929821 TCTCTATTCAGAAAAACAGATGG - Intergenic
1043911589 8:85870535-85870557 TATCTATTGAGATAATCATGTGG + Intergenic
1044057423 8:87588462-87588484 GATCTATTAAGATCAACACCAGG + Intronic
1044185841 8:89251136-89251158 TGTCTATTGAGATAATCAGATGG + Intergenic
1044453575 8:92366433-92366455 CATCTATTGAGATAATCATCTGG + Intergenic
1044594861 8:93949191-93949213 TATCTATTGAGATAATCATGAGG + Intergenic
1045091575 8:98751001-98751023 TATCTATTGAGATAATCATGTGG - Intronic
1045202080 8:99994014-99994036 CATCTATTGAGATAATCATCTGG - Intronic
1045205339 8:100033863-100033885 CATCTATTGAGATAATCATCTGG - Intronic
1045291970 8:100841454-100841476 TGTATATTCAGAAAAAAAGCTGG + Intergenic
1045973743 8:108108047-108108069 TATCTATTGAGATAAACATGTGG - Intergenic
1046285282 8:112085712-112085734 TATCTATTGAGATAATCATGTGG - Intergenic
1046464338 8:114582588-114582610 TATCTATTGAGATAATCATGTGG + Intergenic
1046599890 8:116303962-116303984 TATCTCTTCAGACAAACCACTGG + Intergenic
1046645853 8:116784479-116784501 CCTCTATTCAGCTAACCAGCTGG + Intronic
1046840931 8:118856235-118856257 CATCTATTGAGATAATCACCTGG - Intergenic
1048647677 8:136440319-136440341 TATCTATTGAGATAATCATGTGG + Intergenic
1050177877 9:2887746-2887768 CATCTATTGAGATAATCAGATGG - Intergenic
1050825044 9:9934975-9934997 TATCTATTGAGATAATCATGTGG - Intronic
1051491952 9:17676175-17676197 TAGATATTAAGATTAACAGCAGG - Intronic
1051611270 9:18964013-18964035 TATCTATTGAGATAATCATGTGG + Intronic
1051758234 9:20429675-20429697 TATCTATTGAGATGAACAGATGG - Intronic
1051956627 9:22702830-22702852 TATCTATTGAGATAATCAGGTGG + Intergenic
1052153189 9:25146126-25146148 TATCTATTGAGATGATCAGATGG - Intergenic
1052164231 9:25303533-25303555 TATCTATTTACATAAAGAGAGGG - Intergenic
1055217712 9:73886852-73886874 TATCTATTGAGATAATCATGTGG + Intergenic
1058171038 9:101681666-101681688 GATATATTCAGATATACAGAGGG - Intronic
1058914912 9:109556405-109556427 TATATATACAGAGAAACAACTGG - Intergenic
1059022860 9:110595779-110595801 TATCTATTGAGATAATCATATGG + Intergenic
1059901342 9:118929773-118929795 TAAGGATTCAGATTAACAGCTGG + Intergenic
1059912888 9:119065659-119065681 TATCTATTGAGATAATCATGTGG + Intergenic
1060055474 9:120409305-120409327 TATGTTTGCAGATAAACAGAAGG - Exonic
1060212040 9:121716546-121716568 TAGTTCTTCACATAAACAGCAGG + Intronic
1060339693 9:122763730-122763752 CATCTATTGAGATAATCAGGTGG - Intergenic
1203426740 Un_GL000195v1:47602-47624 TATCTAATCAGGTGCACAGCTGG + Intergenic
1203439491 Un_GL000195v1:175456-175478 TATCTAATCAGGTGCACAGCTGG - Intergenic
1203491772 Un_GL000224v1:113227-113249 TATCTATTGAGATAATCATGTGG + Intergenic
1203504396 Un_KI270741v1:55098-55120 TATCTATTGAGATAATCATGTGG + Intergenic
1186315433 X:8364838-8364860 TATATTTTCAGATAAACAAGGGG + Intergenic
1187607486 X:20902007-20902029 TATCTATTGAGATAATCATGTGG + Intergenic
1188899917 X:35718562-35718584 TATCTATTCAGATGATCATGTGG + Intergenic
1188954427 X:36417343-36417365 CATCTATTCAGATAATCATGTGG + Intergenic
1189178841 X:38984103-38984125 TAACTATTCACATCAACAGAAGG - Intergenic
1189866826 X:45339181-45339203 TATCTATTGAGATAATCATGTGG - Intergenic
1191176311 X:57505626-57505648 TATCTATTGAGATAATCATGTGG - Intergenic
1191209180 X:57867042-57867064 TATCTATTGAGATAATCATGTGG - Intergenic
1191271551 X:58478489-58478511 CATCTATTCAGATAATCATGTGG - Intergenic
1191590780 X:62882006-62882028 TATCTATTGAGATAATCATGTGG - Intergenic
1191814470 X:65228282-65228304 CATCTATTGAGATAACCAGGTGG - Intergenic
1191925771 X:66308054-66308076 CATCTATTGAGATAATCAGGTGG + Intergenic
1191994098 X:67071875-67071897 TATCTATTGAGATAATCATGTGG - Intergenic
1192000651 X:67147275-67147297 CATCTATTCAGATAACCATGGGG + Intergenic
1192009594 X:67254091-67254113 TATCTATTTAGATAATCATGTGG - Intergenic
1192017491 X:67347166-67347188 TTTATAGTCAGAAAAACAGCAGG + Intergenic
1192655077 X:72984627-72984649 TATCTATTGAGATAATCATGTGG - Intergenic
1192701429 X:73478551-73478573 TATCTATTGAGATAATCATGTGG + Intergenic
1192867061 X:75145478-75145500 TATCTATTGAGATAATCATGTGG - Intronic
1192961082 X:76131387-76131409 CATCTATTGAGATAATCAGGTGG - Intergenic
1192972305 X:76245857-76245879 TTACTTTTTAGATAAACAGCAGG - Intergenic
1193037250 X:76965542-76965564 TATACATTCAAATAAATAGCAGG - Intergenic
1193228088 X:79009651-79009673 CATCTATTCAGATAATCATATGG + Intergenic
1193229644 X:79028838-79028860 TATCTATTGAGATAATCATGTGG + Intergenic
1193324788 X:80167455-80167477 TATCTATTGAGATAATCATGTGG + Intergenic
1193476263 X:81970327-81970349 CATCTATTCAGATAATCATGTGG + Intergenic
1193705059 X:84811283-84811305 TATCTATTGAGATAATCATGTGG + Intergenic
1193762542 X:85485471-85485493 CATCTATTCAGATAATCATGTGG + Intergenic
1193858438 X:86635266-86635288 CATCTATTGAGATAATCATCTGG - Intronic
1193897590 X:87132286-87132308 TATCTATTGAGATAATCAAGTGG - Intergenic
1194016563 X:88628562-88628584 TATCTATTGAGATAATCATGTGG - Intergenic
1194074420 X:89370810-89370832 CATCTATTCAGATAATCATGTGG - Intergenic
1194170265 X:90572365-90572387 CATCTATTCAGATAATCATGTGG - Intergenic
1194266233 X:91756561-91756583 CATCTATTGAGATAATCAGGTGG - Intergenic
1194954072 X:100158841-100158863 CATCTATTGAGATAATCAGGTGG + Intergenic
1195419283 X:104655414-104655436 CATCTATTGAGATAAACATGTGG + Intronic
1195442702 X:104916811-104916833 CATCTATTGAGATAATCAGGTGG + Intronic
1195514380 X:105756440-105756462 CATTTATTCAGATTACCAGCAGG + Intronic
1195723220 X:107887366-107887388 CATCTATTGAGATAATCATCTGG + Intronic
1195768089 X:108318122-108318144 CATCTATTGAGATAAACATGTGG - Intronic
1196269444 X:113694165-113694187 TATCTATTGAGATAATCATGTGG + Intergenic
1197058012 X:122143900-122143922 CATCTATTCAGATAATCACGTGG - Intergenic
1198082096 X:133249843-133249865 TATTTCTTCAGATAAACACTAGG - Intergenic
1198556222 X:137796197-137796219 TATCTATTGAGATAATCATGTGG - Intergenic
1199113550 X:143962140-143962162 TATCTATTGAGATAATCATGTGG + Intergenic
1199275910 X:145941579-145941601 CATCTATTCAGATAATCATAAGG + Intergenic
1199384108 X:147204185-147204207 CATCTATTCAGATAATCATAGGG - Intergenic
1199513089 X:148644788-148644810 TATCTATTAATATAAAGACCAGG + Intronic
1199554084 X:149087700-149087722 TATCTATTGAGATAATCATGTGG - Intergenic
1199752375 X:150832508-150832530 CATCTATTGAGATGAATAGCTGG - Intronic
1199891570 X:152088137-152088159 TATCTATTGAGATAATCATGTGG - Intergenic
1200516511 Y:4150131-4150153 CATCTATTCAGATAATCATGTGG - Intergenic
1200583389 Y:4977131-4977153 CATCTATTGAGATAAACATGTGG - Intergenic
1200729814 Y:6722337-6722359 CATCTATTCAGATAATCATGTGG - Intergenic
1200772351 Y:7138493-7138515 CATCTATTGAGATAATCAGGTGG - Intergenic
1200864542 Y:8028810-8028832 TATCTATTGAGATAATCATGTGG + Intergenic
1200948973 Y:8873776-8873798 TATCTATTGAGATAATCATGTGG + Intergenic
1201244607 Y:11990860-11990882 CATCTATTGAGATAAACATGTGG + Intergenic
1201350621 Y:13036952-13036974 TATCTATTGAGATAATCATGTGG - Intergenic
1201544711 Y:15149045-15149067 CATCTATTCAGATAATCATGTGG - Intergenic
1201644936 Y:16220103-16220125 CATCTATTGAGATAATCAGGTGG + Intergenic
1201657878 Y:16365219-16365241 CATCTATTGAGATAATCAGGTGG - Intergenic
1201691107 Y:16765963-16765985 TATCTATTGAGATAATCATGTGG - Intergenic
1201783654 Y:17749681-17749703 TATCTATTGAGATAATCATGTGG - Intergenic
1201817899 Y:18156306-18156328 TATCTATTGAGATAATCATGTGG + Intergenic
1202024276 Y:20503800-20503822 TATCTATTGAGATAATCATGTGG + Intergenic
1202092612 Y:21209421-21209443 CATCTATTCAGATAATCATGTGG - Intergenic
1202251121 Y:22874305-22874327 CATCTATTGAGATAATCAGGTGG - Intergenic
1202344792 Y:23910088-23910110 CATCTATTGAGATAATCAGGTGG + Intergenic
1202383161 Y:24296660-24296682 CATCTATTGAGATAATCAGGTGG + Intergenic
1202404110 Y:24508054-24508076 CATCTATTGAGATAATCAGGTGG - Intergenic
1202466669 Y:25162028-25162050 CATCTATTGAGATAATCAGGTGG + Intergenic
1202487623 Y:25373461-25373483 CATCTATTGAGATAATCAGGTGG - Intergenic
1202525978 Y:25759996-25760018 CATCTATTGAGATAATCAGGTGG - Intergenic