ID: 1018167965

View in Genome Browser
Species Human (GRCh38)
Location 6:161117130-161117152
Sequence CTCAGTCGCGCGAGACACGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 18
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 17}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018167965_1018167968 14 Left 1018167965 6:161117130-161117152 CCTCCGTGTCTCGCGCGACTGAG 0: 1
1: 0
2: 0
3: 0
4: 17
Right 1018167968 6:161117167-161117189 CGTAGTGTTTTGACCTTTCTAGG 0: 1
1: 0
2: 0
3: 5
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018167965 Original CRISPR CTCAGTCGCGCGAGACACGG AGG (reversed) Exonic
1084390888 11:68876046-68876068 CTCAGTCTCCTGGGACACGGTGG + Intergenic
1103373641 12:120438265-120438287 CCCACTCGGGCGAGACAGGGAGG + Intronic
1125200751 15:37099058-37099080 CCGAGCCGCGCGAGCCACGGCGG + Intronic
1132893205 16:2214625-2214647 CTCGGGCGCGCCAGGCACGGCGG + Exonic
1133322008 16:4919996-4920018 CTCAGTCAGGCCAGGCACGGTGG + Intronic
1140051395 16:71484479-71484501 CTCAGTGGAGGGAGACAGGGCGG - Intronic
1142356807 16:89605207-89605229 CTCAGTCCCCCCAGACACTGGGG - Intergenic
1147150393 17:38510668-38510690 CGCTGTCGCCCGAGACCCGGCGG + Exonic
1167001182 19:46746457-46746479 CGCAGGCGCGCGAGGCACAGCGG - Exonic
928120620 2:28581303-28581325 CTCAGTAGCCCCAGACACTGAGG + Intronic
944873672 2:203939724-203939746 CTCAGACGCTGGAGACACTGAGG - Intronic
947632383 2:231662499-231662521 CCCAGACGCGGGAGACGCGGCGG - Intergenic
950670063 3:14520529-14520551 CTCCGTCATGCCAGACACGGTGG - Exonic
997259933 5:132457888-132457910 CTCAGTGGAGTGAGACACTGGGG - Intronic
1006220257 6:32484059-32484081 CTCAGTGACGCGAGGCACAGGGG - Intergenic
1018167965 6:161117130-161117152 CTCAGTCGCGCGAGACACGGAGG - Exonic
1020247581 7:6441875-6441897 CTCAGTCGCTCGAGTCATTGTGG - Intronic
1061829884 9:133284999-133285021 CTCAGTGGGGCCAGGCACGGTGG + Intergenic