ID: 1018169340

View in Genome Browser
Species Human (GRCh38)
Location 6:161132093-161132115
Sequence CTCCGGTTTTGGAGTGCAGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 94}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018169332_1018169340 12 Left 1018169332 6:161132058-161132080 CCTGTGATGACTGGAACCTGGGC 0: 1
1: 0
2: 1
3: 19
4: 135
Right 1018169340 6:161132093-161132115 CTCCGGTTTTGGAGTGCAGAGGG 0: 1
1: 0
2: 0
3: 7
4: 94
1018169337_1018169340 -10 Left 1018169337 6:161132080-161132102 CCTTCATTACGGGCTCCGGTTTT 0: 1
1: 0
2: 0
3: 1
4: 29
Right 1018169340 6:161132093-161132115 CTCCGGTTTTGGAGTGCAGAGGG 0: 1
1: 0
2: 0
3: 7
4: 94
1018169335_1018169340 -4 Left 1018169335 6:161132074-161132096 CCTGGGCCTTCATTACGGGCTCC 0: 1
1: 0
2: 0
3: 8
4: 89
Right 1018169340 6:161132093-161132115 CTCCGGTTTTGGAGTGCAGAGGG 0: 1
1: 0
2: 0
3: 7
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018169340 Original CRISPR CTCCGGTTTTGGAGTGCAGA GGG Exonic
900561374 1:3308752-3308774 CTCCAGTTCTGGGGTCCAGACGG + Intronic
902688858 1:18097035-18097057 ATTGGGTTTTGGAGGGCAGAAGG - Intergenic
903718887 1:25389816-25389838 CTCCGGTTCTGGAGTAGTGAAGG - Intronic
916832169 1:168504273-168504295 CTCAGCTTTGGGAGTGCAGTTGG + Intergenic
918090377 1:181288314-181288336 CTCCTTTTTTGGCTTGCAGATGG + Intergenic
921488512 1:215745178-215745200 CTTGAGTTTTGGAGTGAAGAAGG - Intronic
923427017 1:233881012-233881034 CTCTGGTTTTGCAGAGCTGAGGG + Intergenic
1063377478 10:5562619-5562641 CTTCGGTTCTGGGGTGGAGATGG - Intergenic
1075055438 10:119214988-119215010 CTGCAGTTCTGGAGTGAAGACGG + Intronic
1076947744 10:133663802-133663824 CTCCTGATGTGGAGTGCTGAAGG - Intergenic
1077076508 11:704809-704831 CACCCGTTTAGGAGTGGAGAGGG + Intronic
1079677048 11:23242325-23242347 CACTGGTTTTGAAGTGCTGATGG - Intergenic
1090377890 11:126304212-126304234 CTCCGGCTTCAGACTGCAGAAGG + Exonic
1090837351 11:130462953-130462975 CTCCGGTCTTAGAGTCAAGAAGG - Intronic
1091278850 11:134370584-134370606 CTCCGGCCTTGGAGCTCAGAGGG + Intronic
1094649089 12:32357670-32357692 CTCCGTCCTTGGATTGCAGAAGG + Intronic
1096353814 12:50923078-50923100 CTCAGGATTAGGAATGCAGAAGG + Intergenic
1096963747 12:55607484-55607506 CTCGGGTTTTGCACTGCACATGG - Intergenic
1097058752 12:56267052-56267074 CTCCGCCTTTGGAGTGAGGAGGG + Exonic
1102033938 12:109760346-109760368 CTCCGGTTATGGAGGAAAGAGGG + Intronic
1102655737 12:114480943-114480965 CTCAGGTCCTGGAGTCCAGAAGG - Intergenic
1105351362 13:19619205-19619227 CTCCTGACTTGGAGTGCTGATGG - Intergenic
1113815948 13:113171340-113171362 CTTCTGTTTTGGAGTGCAGTGGG - Intronic
1115113501 14:29853564-29853586 CTTCGGTGTAGGAATGCAGATGG - Intronic
1119160028 14:72444782-72444804 CCCTGGTTTAGGAGTGCATATGG + Intronic
1120342716 14:83242806-83242828 CCCTGGTTTTGGATTGCAGATGG - Intergenic
1126934935 15:53696337-53696359 CTAGGGTTTTGGAGTTCACAGGG - Intronic
1127611799 15:60644386-60644408 CTCCTGTTTTGGGGGGCTGACGG + Intronic
1128559305 15:68654262-68654284 CTCTGGATTTGGAGTCCAGGGGG + Intronic
1132745563 16:1434794-1434816 CTCCGGCTGTGGAGTGAGGAGGG - Exonic
1137424107 16:48363108-48363130 CTCAGGTTTTGGTATGGAGAAGG + Intronic
1140341886 16:74172746-74172768 CCCAGGTTTTTAAGTGCAGAGGG - Intergenic
1141924732 16:87160640-87160662 CTCAGGTGCTGGAATGCAGAAGG + Intronic
1158326606 18:56319826-56319848 CTCTGGTTCTGGAGTTCAGAAGG - Intergenic
1159780695 18:72657318-72657340 CTCCGATGTTGGAGGGCAGGAGG - Intergenic
1161225977 19:3146161-3146183 CTCCAGGGTTGGCGTGCAGAGGG - Intronic
1163994929 19:21035702-21035724 CTCTGGGTTTGTAGTGGAGAGGG + Intronic
1164001230 19:21101311-21101333 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164007994 19:21169514-21169536 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164253284 19:23503658-23503680 CTCTGGGTTTGTAGTGAAGAGGG - Intergenic
1164269638 19:23660196-23660218 CTCTGGGTTTGTAGTGGAGAGGG - Intronic
1164279102 19:23752696-23752718 CTCTGGGTTTGTAGTGGAGAGGG - Intronic
1164297140 19:23922048-23922070 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164317628 19:24107842-24107864 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1166835328 19:45664190-45664212 CTCCTGTCCTGGAGTGGAGAGGG - Intergenic
929495510 2:42438861-42438883 CCCAGGTTTCTGAGTGCAGATGG + Intergenic
931678367 2:64720758-64720780 CTCTGGTTTTGTGATGCAGACGG - Intronic
932739754 2:74282612-74282634 CACTGGGTCTGGAGTGCAGAGGG + Intronic
934742463 2:96734856-96734878 CTCGGCTTTTAGAGTACAGATGG + Intronic
934813562 2:97305063-97305085 CACCTATTTTGGAGTGTAGAAGG + Intergenic
934824134 2:97403417-97403439 CACCTATTTTGGAGTGTAGAAGG - Intergenic
940910038 2:159202426-159202448 TACTGGTTTTGGAGAGCAGAGGG + Intronic
1172587463 20:36094584-36094606 CACAGGATTTGGAGTGCAAAGGG + Intronic
1173675272 20:44829113-44829135 CTCGGGTTTTTGACTGCACAGGG - Intergenic
1174007678 20:47423481-47423503 AACCGGTTTGGAAGTGCAGAAGG - Intergenic
1174331875 20:49826541-49826563 ATGTGCTTTTGGAGTGCAGATGG - Intronic
1176100042 20:63360700-63360722 CTCCGGTTTAGGGGATCAGAGGG - Intronic
1178338635 21:31766370-31766392 CTCTGCTTGGGGAGTGCAGAAGG + Intergenic
1182011830 22:27007474-27007496 CTGAGGTTTGGGAGAGCAGAAGG - Intergenic
949490293 3:4582475-4582497 CTCCGGTGTGGGTGTGAAGATGG + Intronic
950613312 3:14139768-14139790 CCCAGGTTTTGGAGTGAGGAAGG - Intronic
951982514 3:28581278-28581300 CTCAGGTCTTGGTGGGCAGAAGG + Intergenic
955060010 3:55486150-55486172 CTCCGCTTTGGGAGAGCAGGCGG - Intronic
956775564 3:72562632-72562654 CACAGGATTTGGAGTCCAGACGG + Intergenic
962886456 3:139632423-139632445 CTCCAGTTCTGTAGGGCAGAGGG - Intronic
966821416 3:183927789-183927811 CTACGGCTTTGGACTTCAGAAGG - Intronic
966852504 3:184172762-184172784 CTGGGGTTTTGGTGTGCAGAGGG + Exonic
967836252 3:193965793-193965815 CTTCAGTTTTGGAGGGCTGAGGG + Intergenic
969292894 4:6252090-6252112 CTCAAGTATTGGAGTGCAAAAGG + Intergenic
985451198 4:190064601-190064623 CTCCTGATGTGGAGTGCTGAAGG - Intergenic
985982440 5:3482086-3482108 CTCTTGTTTTGGCTTGCAGATGG + Intergenic
987472478 5:18350460-18350482 CTCAGTTTTTGGAGTGCACCGGG + Intergenic
988956395 5:36324267-36324289 CTCCCCTTTAGGAGTGGAGAGGG - Intergenic
1002102224 5:176863247-176863269 AACCGGTTAGGGAGTGCAGAAGG + Intronic
1002271560 5:178075823-178075845 CCCCCGTTGTGGAATGCAGAAGG - Intergenic
1004286946 6:14329982-14330004 CTCAGGGATTGGAGTTCAGAGGG + Intergenic
1006116219 6:31777409-31777431 CCCTGGTTCTGGAGGGCAGAGGG - Intergenic
1009699758 6:67161046-67161068 CTCTGGTAGGGGAGTGCAGAAGG + Intergenic
1011382956 6:86762294-86762316 CTCCACTTTTGCAGAGCAGAAGG - Intergenic
1013471748 6:110472393-110472415 TTTGGGTTTTGCAGTGCAGAGGG - Intronic
1015796359 6:137016048-137016070 CTCAGGTTTTGGGCTGCAGGAGG + Intronic
1015952024 6:138562815-138562837 CTCTGGTTATGGCGTGCAGAAGG - Intronic
1018169340 6:161132093-161132115 CTCCGGTTTTGGAGTGCAGAGGG + Exonic
1021316377 7:19153021-19153043 CTCCAGTTTTGTAGTACAAAAGG + Intergenic
1022416157 7:30178883-30178905 CTCAGATTTTGGAGTTCAGAGGG - Intergenic
1023025928 7:36049559-36049581 CTCCTGTGTTTGAGTGAAGAAGG + Intergenic
1025149722 7:56539059-56539081 CTCCGGTTGGAGAGGGCAGAGGG - Intergenic
1025774010 7:64542182-64542204 CTCTGGGTTTGTAGTGGAGAGGG - Intronic
1025791649 7:64693508-64693530 CTCTGGGTTTGTAGTGGAGAGGG + Intronic
1025816693 7:64920105-64920127 CTCTGGGTTTGTAGTGGAGAGGG + Intronic
1025866854 7:65390463-65390485 CTCTGGGTTTGTAGTGGAGAGGG + Intronic
1029621973 7:101695844-101695866 CGCCAGTGTTGGAGTGCAGTGGG - Intergenic
1031366550 7:120906998-120907020 CTCAGGTTTTGCACTGCACATGG - Intergenic
1043424310 8:80133445-80133467 ATCTGGTTTTGGAGGGAAGAAGG - Intronic
1046604040 8:116350950-116350972 CTCAGGGTTTGGAGTAGAGACGG - Intergenic
1051676172 9:19560542-19560564 CTTCCGTTTTGGTTTGCAGATGG - Intronic
1058118739 9:101115153-101115175 CTAGGGTTTTGGAGTGGAAATGG - Intronic
1060047744 9:120354005-120354027 CTCAGCTGTTGGAGTGCAGATGG - Intergenic
1192467518 X:71367709-71367731 CTCCGAGGTTGGAGTGCAGTGGG + Intronic
1194902553 X:99531009-99531031 CTCTGTTTTTGGATTGTAGATGG - Intergenic
1195576150 X:106453290-106453312 CCCCAGTTTTGGAGTGCAATGGG + Intergenic
1201990146 Y:20014920-20014942 CTCTGCTATGGGAGTGCAGAAGG + Intergenic