ID: 1018170146

View in Genome Browser
Species Human (GRCh38)
Location 6:161138072-161138094
Sequence AGCTTGCCCCCGCCCTACCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018170144_1018170146 1 Left 1018170144 6:161138048-161138070 CCTGCTATTGAAGCAGAAGGGTT 0: 1
1: 0
2: 0
3: 4
4: 96
Right 1018170146 6:161138072-161138094 AGCTTGCCCCCGCCCTACCAGGG No data
1018170141_1018170146 12 Left 1018170141 6:161138037-161138059 CCTTGCTGTTGCCTGCTATTGAA 0: 1
1: 0
2: 0
3: 33
4: 188
Right 1018170146 6:161138072-161138094 AGCTTGCCCCCGCCCTACCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018170146 Original CRISPR AGCTTGCCCCCGCCCTACCA GGG Intronic
No off target data available for this crispr