ID: 1018170450

View in Genome Browser
Species Human (GRCh38)
Location 6:161139679-161139701
Sequence TTCCCTTGGAAGCAGGGCCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 332
Summary {0: 1, 1: 1, 2: 3, 3: 35, 4: 292}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018170450_1018170462 21 Left 1018170450 6:161139679-161139701 CCGAGGCCCTGCTTCCAAGGGAA 0: 1
1: 1
2: 3
3: 35
4: 292
Right 1018170462 6:161139723-161139745 ACCGGGGCTCGGCAGAACTGGGG 0: 1
1: 0
2: 0
3: 3
4: 84
1018170450_1018170458 10 Left 1018170450 6:161139679-161139701 CCGAGGCCCTGCTTCCAAGGGAA 0: 1
1: 1
2: 3
3: 35
4: 292
Right 1018170458 6:161139712-161139734 ACACAGGTGCCACCGGGGCTCGG 0: 1
1: 0
2: 0
3: 13
4: 151
1018170450_1018170455 3 Left 1018170450 6:161139679-161139701 CCGAGGCCCTGCTTCCAAGGGAA 0: 1
1: 1
2: 3
3: 35
4: 292
Right 1018170455 6:161139705-161139727 CAGAGATACACAGGTGCCACCGG 0: 1
1: 0
2: 1
3: 19
4: 187
1018170450_1018170454 -6 Left 1018170450 6:161139679-161139701 CCGAGGCCCTGCTTCCAAGGGAA 0: 1
1: 1
2: 3
3: 35
4: 292
Right 1018170454 6:161139696-161139718 AGGGAATCGCAGAGATACACAGG 0: 1
1: 0
2: 2
3: 4
4: 124
1018170450_1018170457 5 Left 1018170450 6:161139679-161139701 CCGAGGCCCTGCTTCCAAGGGAA 0: 1
1: 1
2: 3
3: 35
4: 292
Right 1018170457 6:161139707-161139729 GAGATACACAGGTGCCACCGGGG 0: 1
1: 0
2: 0
3: 8
4: 118
1018170450_1018170456 4 Left 1018170450 6:161139679-161139701 CCGAGGCCCTGCTTCCAAGGGAA 0: 1
1: 1
2: 3
3: 35
4: 292
Right 1018170456 6:161139706-161139728 AGAGATACACAGGTGCCACCGGG 0: 1
1: 0
2: 0
3: 13
4: 149
1018170450_1018170461 20 Left 1018170450 6:161139679-161139701 CCGAGGCCCTGCTTCCAAGGGAA 0: 1
1: 1
2: 3
3: 35
4: 292
Right 1018170461 6:161139722-161139744 CACCGGGGCTCGGCAGAACTGGG 0: 1
1: 0
2: 0
3: 4
4: 76
1018170450_1018170460 19 Left 1018170450 6:161139679-161139701 CCGAGGCCCTGCTTCCAAGGGAA 0: 1
1: 1
2: 3
3: 35
4: 292
Right 1018170460 6:161139721-161139743 CCACCGGGGCTCGGCAGAACTGG 0: 1
1: 0
2: 1
3: 9
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018170450 Original CRISPR TTCCCTTGGAAGCAGGGCCT CGG (reversed) Intronic
900563435 1:3320014-3320036 TTCCCTAGAAAACAGTGCCTGGG + Intronic
900743054 1:4342305-4342327 TTCCCTTGCAAGCAGGGCCCCGG - Intergenic
901052504 1:6432366-6432388 TTCACCTGGCAGCAGGGCGTGGG + Intronic
901449142 1:9325494-9325516 CTCCCATAGAAGCAGGGCCTAGG - Intronic
901529515 1:9844360-9844382 TGCCCAAGGAGGCAGGGCCTGGG - Intergenic
902266602 1:15271379-15271401 TTCCCCTGGTTGCAGGGCCCTGG - Intronic
903891191 1:26571712-26571734 TTCCCTTGCCAGCTGGGCCAAGG - Intronic
904559040 1:31384580-31384602 TCCTCCTGTAAGCAGGGCCTGGG - Intergenic
904586257 1:31582581-31582603 TACCCTGGGAAGCAGGGCAAGGG + Intronic
905265987 1:36754718-36754740 TTCTCTTGGTAGCAGGATCTTGG - Intergenic
906256897 1:44357344-44357366 TTCCCTAGAAAACAGAGCCTGGG + Intergenic
907972877 1:59401932-59401954 GTACCTTGGAAGCAAGGCCTGGG - Intronic
908114109 1:60924507-60924529 TTACCTGGCAAGCAGGGGCTGGG + Intronic
911026608 1:93442521-93442543 TTCCCTTGAAAGCAGGGTGTTGG - Intergenic
911070804 1:93830547-93830569 TTCTCTTGGAGGCAGGGGCGGGG - Intronic
912245507 1:107957974-107957996 TTCTCTGGAAAGCAGAGCCTGGG - Intronic
912389213 1:109290314-109290336 CTCCAGTGGAAGCAGGACCTAGG - Intergenic
913203254 1:116513316-116513338 ATCCCTTGTATTCAGGGCCTAGG - Intergenic
915349217 1:155214088-155214110 TTGCTTTGGAAACTGGGCCTGGG - Intergenic
915352404 1:155234715-155234737 TTGCTTTGGAAACTGGGCCTGGG - Exonic
916025625 1:160830932-160830954 TTGCTTTGGAAGATGGGCCTGGG + Intronic
916294090 1:163197529-163197551 TTTCCATGGGAGCAGGGCATGGG + Intronic
917725635 1:177824895-177824917 TTCCCTTGCAGGCAGGGAGTAGG + Intergenic
918074659 1:181161077-181161099 GTCATTGGGAAGCAGGGCCTGGG + Intergenic
918238088 1:182599436-182599458 GTCTCTTGGAGGCAGGGCCCAGG - Exonic
918791377 1:188834589-188834611 TGCCTTTGGAAGCGGAGCCTGGG + Intergenic
919286416 1:195567438-195567460 TTTCCTTGGAAACAGGTACTGGG + Intergenic
919940843 1:202284957-202284979 TTCCCTTTGGAGGAGAGCCTGGG + Intronic
920434995 1:205941866-205941888 TTCACTTGGAAGCAGGGCCTGGG + Intronic
920946058 1:210529604-210529626 GTCCCTGAGAAGCTGGGCCTGGG - Intronic
922217059 1:223528441-223528463 TTCCCTTGGGAGCACTGCTTTGG + Intergenic
924859743 1:247908879-247908901 TTGCCGTGGCAGCAAGGCCTTGG - Intergenic
1063293930 10:4782306-4782328 TTCCCCCAGAAGAAGGGCCTGGG - Intergenic
1064305737 10:14164391-14164413 TTGCCTGGGATGCAGGACCTGGG - Intronic
1066667866 10:37803756-37803778 TTCCCTGAGAATCAAGGCCTGGG + Intronic
1067533024 10:47088218-47088240 TTCCTTGGGAAGCAGGCTCTGGG + Intergenic
1067737820 10:48872135-48872157 TTCCCATGAAAGCATGGCTTTGG - Intronic
1069847712 10:71384319-71384341 TTCCCTTCAAAGTAGGGCTTGGG + Intergenic
1070617496 10:77980063-77980085 TTCCCTTGGAAGCCTAGCCATGG + Intronic
1070971163 10:80568451-80568473 GCCTCTGGGAAGCAGGGCCTTGG + Intronic
1071365893 10:84900349-84900371 TTTCCCTAAAAGCAGGGCCTGGG + Intergenic
1071528168 10:86370293-86370315 TTTCTTTGCAGGCAGGGCCTGGG - Intergenic
1072780447 10:98247611-98247633 CTCCCATGGAGCCAGGGCCTGGG - Intergenic
1072783332 10:98264760-98264782 TTCCATCGGCAGCAGAGCCTTGG - Intronic
1074148828 10:110740462-110740484 CTCCCTCTGCAGCAGGGCCTTGG - Intronic
1074895424 10:117773264-117773286 TTCCCATGGAAGCATGGGCACGG - Intergenic
1075065046 10:119283596-119283618 TACCCTTGGAGGCTAGGCCTTGG + Intronic
1075616230 10:123892293-123892315 GTTCCCTGGGAGCAGGGCCTAGG + Intronic
1076620161 10:131781945-131781967 TTCACTGGGAACCATGGCCTTGG + Intergenic
1077251541 11:1563016-1563038 TTCCACTGGATGCAGGGCCAAGG + Intronic
1077376962 11:2209622-2209644 CCCCCTGGGAAGCAGGGCCAGGG - Intergenic
1077488279 11:2849066-2849088 TTCCCCTGGAAGCAGTGCCCAGG + Exonic
1077532079 11:3102061-3102083 GTCCCCTGGAAGCCGGCCCTCGG + Intronic
1078551790 11:12286185-12286207 TTCCCTTGGAACCAGGCCAAGGG + Intronic
1079139873 11:17801223-17801245 TTCAAGGGGAAGCAGGGCCTTGG + Intronic
1082029437 11:47594038-47594060 TTTCCTTGAAAGGAGGACCTGGG - Intronic
1083418727 11:62541824-62541846 TTCCTTTGGAACAAGGGCCTTGG - Intronic
1083540689 11:63509903-63509925 TTTCCTTGGGACCAAGGCCTGGG + Intronic
1083827861 11:65213364-65213386 TTCCCGAGAAAGCAGGGACTTGG - Intergenic
1084423614 11:69072561-69072583 CTCCCTTGGAACCCTGGCCTGGG - Intronic
1084915782 11:72428095-72428117 TTTCCTTGAGACCAGGGCCTGGG + Intronic
1085926971 11:81034679-81034701 TGCAGTTTGAAGCAGGGCCTGGG - Intergenic
1086609892 11:88743076-88743098 TTCTGTTGGAAGGAGAGCCTAGG - Intronic
1088245422 11:107813676-107813698 TTCCTTTGGAGACAGGGTCTTGG + Intronic
1089009126 11:115118642-115118664 TTCCCTTGGGAGCTGAGCCCAGG - Intergenic
1089747292 11:120626280-120626302 TTCCCTTGGTGGCAGAGACTTGG - Intronic
1091933335 12:4414909-4414931 TTGCCTTGGGTGCAGGGACTGGG + Intergenic
1091969789 12:4776849-4776871 TTCCAAAGGGAGCAGGGCCTTGG + Intronic
1092016736 12:5165578-5165600 TCCCCTTGGAAGCAGGGCAAAGG + Intergenic
1092250803 12:6895266-6895288 TTCCTTTAGAAACAGGGTCTTGG - Intronic
1096723403 12:53541474-53541496 TTCCCATGGAATAAGGGGCTTGG - Intronic
1097228922 12:57496993-57497015 TACCCTTGGGAGCAGAACCTAGG + Intronic
1098847890 12:75560878-75560900 TGCCCTTGGAAGCAGGAGATGGG + Intergenic
1102009081 12:109607016-109607038 TTCCTTTGGAAGCAGGGGGCTGG + Intergenic
1102426646 12:112849017-112849039 TTCCCCTGGCAGAAGGGCTTGGG - Intronic
1103933122 12:124460959-124460981 GTCCCCTGCAAGCTGGGCCTTGG - Intronic
1104671369 12:130682807-130682829 TTCCCTTGTGAGCACGGCTTTGG - Intronic
1104775874 12:131389831-131389853 TTCCATGGGAAGCAGAGCCAGGG - Intergenic
1104814492 12:131637889-131637911 GTGCCTGGGAAGCAGGGCCTGGG + Intergenic
1105016400 12:132788536-132788558 TTCCTGTGGAAGCTGAGCCTGGG - Intronic
1109589418 13:64458806-64458828 TTCCCATGGATGTAGGGCCATGG - Intergenic
1111337523 13:86841496-86841518 TTCCCAGGGCAGCAGGCCCTAGG + Intergenic
1112568023 13:100568008-100568030 TTCAATTGGAAGTAGGGCCCTGG - Intronic
1116317651 14:43417879-43417901 CTCCCTGGGAAGGAGTGCCTGGG - Intergenic
1120685555 14:87532545-87532567 GTTCCTTGGCAGCAGTGCCTGGG - Intergenic
1120940414 14:89942915-89942937 GCCCTTGGGAAGCAGGGCCTGGG + Intronic
1121329336 14:93040302-93040324 CTCCTATGAAAGCAGGGCCTCGG + Intronic
1121437751 14:93930103-93930125 TTCTCTTGTAAGCATGGTCTTGG + Intergenic
1121686836 14:95841892-95841914 AGCCCTGGGAAGCATGGCCTTGG + Intergenic
1122124651 14:99572422-99572444 TTCCCTGTGGAGCAGGGCCTTGG - Intronic
1122135758 14:99631968-99631990 TTCCCTTGGGATGGGGGCCTGGG + Intergenic
1122327168 14:100889766-100889788 GGGCCTTGGAAGCAGGGCCAGGG + Intergenic
1122837620 14:104437817-104437839 TGCCCTTGGAAGAACAGCCTGGG - Intergenic
1202855422 14_GL000225v1_random:47879-47901 TTTCCGTGTAAACAGGGCCTAGG + Intergenic
1124028466 15:25988528-25988550 TTCCCCTGGAAGCAGTGGTTCGG - Intergenic
1126189237 15:45862445-45862467 TTACCTTGAAAGTAGGGCATGGG + Intergenic
1126696037 15:51326279-51326301 GCCACTTGGAAGCTGGGCCTTGG - Intronic
1129970622 15:79774916-79774938 CTCCCTTGGAGGCAGGGGCAGGG - Intergenic
1131149370 15:90037268-90037290 TTCCCTTGGAAGAAAGTCCCTGG + Intronic
1131590913 15:93747202-93747224 TGCCCTGGGAAGCAGCTCCTGGG + Intergenic
1131871606 15:96769849-96769871 TTCCCCTGAAGGCAGTGCCTGGG - Intergenic
1132031375 15:98440928-98440950 TTCTCGTGGCAGCAGGGCCTTGG - Intronic
1132655271 16:1039329-1039351 TTCCCTCTGAACCAGGGGCTGGG + Intergenic
1133118424 16:3591422-3591444 TTCAAAGGGAAGCAGGGCCTGGG - Intronic
1134457547 16:14405854-14405876 GCCCCTTGGAGGCGGGGCCTCGG - Intergenic
1135191851 16:20360797-20360819 TTCCCTTGGAACCATGGCACTGG - Intronic
1135192261 16:20364144-20364166 TTTTCTTGGAAGTAGGGCCACGG - Intronic
1135511798 16:23091474-23091496 ATCCTTTGGAAGCACAGCCTAGG + Intronic
1135958440 16:26976169-26976191 TCTCCTTGGAAGCACGGCATTGG + Intergenic
1136413808 16:30091668-30091690 TTCACTTGGAGGCCGGGCCCTGG + Intronic
1137708971 16:50553562-50553584 TTCCCTTGGAATCTGGCACTCGG - Intronic
1137738051 16:50739665-50739687 TTGGCTTGGAATCAGGGTCTCGG + Intergenic
1137746045 16:50820879-50820901 TTCCCTTTGAAGGAGGGCTTCGG + Intergenic
1138650427 16:58457441-58457463 TTCCCTTGAAAGGTGGGACTTGG - Intergenic
1139138900 16:64237386-64237408 TTCCCTGGGAAGCAGATTCTAGG + Intergenic
1141151102 16:81565245-81565267 TTCCTTTGGAAGGTGGGCCATGG - Intronic
1141694723 16:85613992-85614014 TTCCTCGGGAAGCAGGGCGTGGG - Intronic
1142493254 17:292325-292347 GTCATTTGGCAGCAGGGCCTGGG - Intronic
1143731643 17:8885590-8885612 TTACCTAGGAGGCAGGGCCATGG - Intronic
1143731682 17:8885672-8885694 TTACCTAGGAGGCAGGGCCATGG - Intronic
1143731796 17:8885935-8885957 TTACCTAGGAGGCAGGGCCATGG - Intronic
1144281410 17:13730685-13730707 TTTCCTTAGCTGCAGGGCCTTGG - Intergenic
1146519432 17:33514903-33514925 ATCCCCTGGAAGCAGGACCTCGG + Intronic
1147887414 17:43693499-43693521 TGCTCATGGAAGCAGGGCCTTGG + Intergenic
1149082320 17:52673940-52673962 TTTCCTAGGATGCAGGGCTTAGG - Intergenic
1150658534 17:67056304-67056326 TTCCCCAGGAAGCGGGGTCTTGG + Exonic
1151340437 17:73467527-73467549 TTCCCTGGGATTCTGGGCCTAGG - Intronic
1151684054 17:75636517-75636539 TTCCCTTAGGAGCAGCGGCTGGG + Intronic
1152309433 17:79540599-79540621 TGCTTTTGGAAGCAGGGCCCGGG - Intergenic
1152629579 17:81404503-81404525 TCCCCTGAGAAGCAGGGCCTGGG + Intronic
1152726748 17:81950902-81950924 TGCCCTTGGAAGCAGAGCCAGGG + Intergenic
1155061246 18:22230750-22230772 TTCCCTGGGAAGCAAAGGCTGGG + Intergenic
1155556386 18:27023974-27023996 ATCCCTAGGAAGCACTGCCTAGG - Intronic
1156035935 18:32769167-32769189 TTCCTTTGCAAGCATCGCCTGGG + Intronic
1156945350 18:42822924-42822946 TGCCCTTGGAAGCAGAGTTTAGG + Intronic
1157571557 18:48715718-48715740 CTCCCTGGGAAGCAGGCTCTGGG + Intronic
1157841789 18:50966099-50966121 TTTCCTTGGGAGCAGGGGGTGGG - Intergenic
1158126244 18:54102586-54102608 TTTCCTTGGCAGCAGAGGCTGGG + Intergenic
1160279413 18:77473625-77473647 TTCACTGACAAGCAGGGCCTGGG + Intergenic
1160549025 18:79681239-79681261 TTCCTTTGGAGACAGAGCCTGGG + Intronic
1161675380 19:5644803-5644825 TTCCCCTGCAAGTAGGGCATAGG + Intronic
1162584703 19:11551782-11551804 TTCCCGAGGAGGCAGGGCCCTGG - Intronic
1163188591 19:15658788-15658810 TTCCCTTCTCAGCAGGGCCCAGG + Exonic
1163415010 19:17181053-17181075 CGCACTTGTAAGCAGGGCCTTGG - Intronic
1163441871 19:17326176-17326198 TTCTCTGGGAAGCAGGGGATCGG - Intronic
1164087781 19:21919448-21919470 ATCCCTTGTAAGCAGGGACCAGG - Intergenic
1165453916 19:35900101-35900123 TACCCCTAGAAGCAGGGACTAGG - Intronic
1165664719 19:37618311-37618333 TCCTCCTGGAAGCAGGGACTAGG - Intronic
1165777738 19:38414806-38414828 TACCCTTGGAAGCCCAGCCTGGG + Intronic
1165907941 19:39204950-39204972 CTCCCTGGGAGGCAGGACCTTGG + Intergenic
1167525134 19:49978958-49978980 CTCCCTGGGAAGCTGGGCCCTGG + Intronic
1167787402 19:51647120-51647142 CTCCCTGGGAGTCAGGGCCTCGG + Intergenic
927173993 2:20392590-20392612 TTTCCTTGGAACCAGGTTCTGGG + Intergenic
927211419 2:20641258-20641280 TTCCTTTGGCTGCTGGGCCTTGG - Intronic
927679134 2:25128632-25128654 TCTCCCTGGAAGCAGGGCCAAGG + Intronic
927886333 2:26721034-26721056 GGCCCTTGGCAGGAGGGCCTCGG - Intronic
929133561 2:38602376-38602398 CTCCCCGGGAAGCAGGGCCTCGG - Intronic
929464466 2:42132387-42132409 TTCTCTTCCAAGCAGGGTCTTGG - Intergenic
929917459 2:46148149-46148171 CTTCCTGGGAAGCAGGGGCTGGG - Intronic
930202652 2:48559875-48559897 TACCATTGGATGCTGGGCCTTGG - Intronic
930284296 2:49408927-49408949 GTACCTTGGAAGCAGAGCCTGGG - Intergenic
932453773 2:71833028-71833050 GCCCTTGGGAAGCAGGGCCTTGG + Intergenic
933476943 2:82803314-82803336 TACCATTGCAAGCAGTGCCTTGG + Intergenic
933892418 2:86783983-86784005 CTCCTGTGGAAGCAGGGCCTGGG - Intergenic
934040793 2:88126123-88126145 TTTCCTTGGAACCTGGCCCTGGG - Intronic
934649611 2:96083484-96083506 GGCCCTTGGAAGCAGGTCATGGG - Intergenic
935915673 2:107947106-107947128 TTCCCTGGAAAGCAGAGCCCAGG - Intergenic
936554278 2:113479832-113479854 TCCCCTTGGAGACAGGGTCTGGG + Intronic
937077305 2:119116687-119116709 TTCCCTTGGAATTGTGGCCTTGG - Intergenic
937451972 2:122009602-122009624 TTCCCATGGATGCAGGGCCTGGG + Intergenic
937975572 2:127580489-127580511 TTCCCTTCGACCCAGGGCCCTGG + Intronic
937980918 2:127614897-127614919 TGTCCTTGGCTGCAGGGCCTTGG + Intronic
937986488 2:127640424-127640446 GGCCCTGGGAGGCAGGGCCTGGG - Intronic
942149107 2:173057077-173057099 TTCCCTTTAGAGCAGGGCTTTGG - Intergenic
942172272 2:173299901-173299923 TTCCTTTGGAAGGAGGTCCTGGG - Intergenic
943985537 2:194613144-194613166 TTTTCTTGTAAGCAGGGCCATGG + Intergenic
948230992 2:236349199-236349221 ATCCCTTGGCAGCAGTGCCCAGG - Intronic
948982744 2:241503011-241503033 TTCCCCTGGACTCTGGGCCTGGG - Intronic
1169720209 20:8667930-8667952 TCCCCTTGTCAGCAGGGTCTAGG + Intronic
1171307482 20:24118696-24118718 TCCACTGGGCAGCAGGGCCTGGG - Intergenic
1171361864 20:24591762-24591784 TACCCTTGGAAGCATGACCTGGG - Intronic
1171414624 20:24969288-24969310 TTCCCCTGCTGGCAGGGCCTTGG - Intronic
1172276950 20:33685235-33685257 TTCCATGGCAACCAGGGCCTGGG + Intronic
1172513632 20:35517289-35517311 TTCCCTTGGCAGCTGGACCCTGG - Exonic
1173347979 20:42218465-42218487 TTCAGGTGGAAGAAGGGCCTAGG - Intronic
1173364813 20:42375513-42375535 TCCTCTTGGAAGAAGGGACTAGG + Intronic
1174983635 20:55424591-55424613 TTCCCCTGAAAGCAGAACCTAGG + Intergenic
1175567497 20:59991955-59991977 TTCCCTTTGCAGCAGAGCCCTGG - Intronic
1175847845 20:62067966-62067988 TTCCCTTGCAAGGAGGGTGTTGG + Intergenic
1175980460 20:62736118-62736140 GTCCCTTCGGGGCAGGGCCTGGG + Intronic
1175983662 20:62753762-62753784 CTCCATTGGAAGCCGGGCCATGG + Intronic
1176036817 20:63043688-63043710 TTCTTTTGGGATCAGGGCCTTGG - Intergenic
1177171683 21:17662338-17662360 CCCCCCTGGAAGAAGGGCCTTGG + Intergenic
1178297783 21:31425279-31425301 ATTCCTTGGAAGCAGTGACTTGG - Intronic
1179803988 21:43825849-43825871 TCCCCTTGGAGGAAGGACCTGGG + Intergenic
1180154255 21:45970569-45970591 TTCCCTTGGCTGCAGGGACTGGG - Intergenic
1180942052 22:19665985-19666007 TTGCTTTGGAAGGAGGGCCGGGG + Intergenic
1182033145 22:27175693-27175715 TTCACCTGGGAGCAGGGCCCTGG + Intergenic
1182124620 22:27807469-27807491 TTTCCTTGGAAACAGGGCTTGGG + Intergenic
1182124824 22:27808823-27808845 TTATTTTGGGAGCAGGGCCTGGG - Intergenic
1182125124 22:27810600-27810622 TTTCCTTGCTGGCAGGGCCTTGG - Intergenic
1184232925 22:43168257-43168279 TCCCCTGGGAATCAGGGCCCAGG - Intronic
1184423036 22:44392786-44392808 TTCCCCTGGAGGCTGGGGCTGGG - Intergenic
950106530 3:10392374-10392396 TTCCCCTGGCAGGAGGGCCTGGG - Intronic
950179557 3:10901493-10901515 TTCCCTGGGCAGCCGGCCCTGGG - Intronic
950487250 3:13281119-13281141 TTCCCATGAAAGCAGGGACTTGG + Intergenic
950569781 3:13792898-13792920 TCACCTTGGAAGGAGGGGCTGGG - Intergenic
951482378 3:23174900-23174922 GTTCCTTAGAAGCAGAGCCTGGG - Intergenic
952089707 3:29869782-29869804 TTCTCTTGAAAGTATGGCCTTGG - Intronic
952773726 3:37024832-37024854 GTCCCATGGAAGCAAGCCCTTGG + Intronic
953258519 3:41313945-41313967 TTCCCTGGGACGCAGTGGCTAGG - Intronic
955530248 3:59865524-59865546 TCCCCTTGGAGCCAGGGCCTGGG + Intronic
956793663 3:72699784-72699806 TTCCTCTGGAAGCAGCCCCTGGG + Intergenic
957817272 3:85317553-85317575 CTACCTTGGAAGCAGAGACTTGG - Intronic
958923019 3:100127312-100127334 TTCCCTCGAGAGCAGGGCCCAGG + Intronic
959487115 3:106939614-106939636 ATCACAAGGAAGCAGGGCCTAGG + Intergenic
963328852 3:143892134-143892156 TTCCCTAGGAAACAAAGCCTGGG - Intergenic
965384266 3:168027063-168027085 TTCACTTGTAGGCAGGGCCAAGG + Intronic
965444899 3:168763408-168763430 TTCCCATGGAAGCAGGCCCTGGG - Intergenic
965628080 3:170702165-170702187 TTCCCCTGCAGACAGGGCCTTGG - Intronic
966914530 3:184577541-184577563 GGCCCTTGGGAGCAAGGCCTTGG + Intronic
968591030 4:1459791-1459813 TTCTCTTGGCAGCCCGGCCTGGG - Intergenic
968647032 4:1746301-1746323 GAGCCTTGGAAGCAGGTCCTGGG - Intergenic
969570846 4:8007360-8007382 TTAGCTTCGAAGCAGGGGCTGGG - Intronic
970148842 4:13067958-13067980 TTACCCTGGAATCAGAGCCTAGG - Intergenic
972848407 4:43018211-43018233 TTCCCTTGGAACCAGGCCTTTGG - Intronic
973090107 4:46125053-46125075 TTCCGTGGGAAGCAGGCTCTTGG - Intergenic
974869828 4:67627551-67627573 TGCCCTTGGAAACATGGGCTGGG + Intronic
975037659 4:69704468-69704490 TGCCCTTGGGAGGAGGACCTGGG + Intergenic
976572280 4:86626203-86626225 GTCCTTTGAAAGCAGGGACTAGG + Intronic
979683671 4:123487636-123487658 TTCCTTTAGAAACAGGGTCTTGG - Intergenic
980134330 4:128845577-128845599 TGCCCTGGGAGGTAGGGCCTGGG + Intronic
980892756 4:138832487-138832509 TTCCCTTGAAAGGAGAGCATGGG - Intergenic
982574621 4:157093790-157093812 ATCCCTTGAAAGCAGAGCCAAGG - Intronic
984242910 4:177239125-177239147 TTTCTTTTGAGGCAGGGCCTTGG - Intergenic
985260689 4:188112191-188112213 CTCCATTAGAAGCAGGGGCTTGG + Intergenic
986199293 5:5567159-5567181 TTACCTGGGAAGCAGGTCCCAGG - Intergenic
987088716 5:14491863-14491885 TTCCCATGGCAGCAGAGCCTTGG + Intronic
988836391 5:35036819-35036841 GTCCCTAGGAAGCAGGGACATGG - Intronic
989394301 5:40936940-40936962 TTCACTTGGAAACAGGTTCTTGG - Intronic
991354121 5:65749851-65749873 TTCCATAGGGAGCAGGGCCAAGG - Intronic
992104394 5:73437577-73437599 TTCCCGTGGATGGAGGGCCCCGG + Intergenic
994634900 5:102332729-102332751 TTCCCCTAGAAACAGAGCCTGGG + Intergenic
998160985 5:139812968-139812990 TTTCCATCCAAGCAGGGCCTAGG + Intronic
998207147 5:140166043-140166065 ATCCCTGGGAGCCAGGGCCTAGG - Intergenic
998278596 5:140783002-140783024 TTCACATGCCAGCAGGGCCTTGG - Intergenic
999230758 5:150060583-150060605 GCTCCCTGGAAGCAGGGCCTAGG + Intronic
999778538 5:154830243-154830265 GTTCCTTGTAAGCAGGGTCTGGG + Intronic
1001114302 5:168926045-168926067 TTCTCTTGGGAGCGGTGCCTCGG + Intronic
1001350387 5:170957254-170957276 TTCCCTGGAAAACAGAGCCTTGG + Intronic
1001803090 5:174560192-174560214 GTTCCTTAGAAGCAGAGCCTGGG - Intergenic
1002425155 5:179170612-179170634 TTCCCTTGGACACAGGAGCTAGG + Intronic
1002443720 5:179277130-179277152 GTCCATCTGAAGCAGGGCCTGGG + Intronic
1003192570 6:3887477-3887499 TTCCCTGGGAACCTGGGCCACGG - Intergenic
1004348179 6:14867632-14867654 TGCTTATGGAAGCAGGGCCTGGG + Intergenic
1006304514 6:33211287-33211309 GTCGCTTGGGAGCAGGGCCTGGG - Exonic
1006620527 6:35360827-35360849 TTGGCTTGGATGCAGGGGCTGGG + Intronic
1006663208 6:35667303-35667325 GTTCCTTGGGAGCAGGGACTAGG - Intronic
1007415458 6:41688861-41688883 TTCCCTTGGTGGCATGGGCTGGG + Intronic
1010478638 6:76321500-76321522 CTCCCTTGCAAGTAGGGCATAGG + Intergenic
1012047130 6:94291477-94291499 ATTCCTTGGAAGCAGGGCTGTGG + Intergenic
1012323626 6:97885263-97885285 TTCCCTTGCAAGTAGGGGGTAGG + Intergenic
1012815757 6:104019589-104019611 ATCCCTTGGAGCCATGGCCTTGG - Intergenic
1014736152 6:125098319-125098341 TGCCCTTGGAAGCATGACTTTGG + Intergenic
1015417197 6:132963059-132963081 TTCCCTTGTAAACAGCACCTGGG + Intergenic
1015808175 6:137133315-137133337 TTCCCAGGGAAACAGCGCCTTGG + Intergenic
1016233099 6:141830200-141830222 TTCTCTTGCAAGCAGGGGGTGGG - Intergenic
1017840068 6:158214732-158214754 TTCCCTTAGAAGCAGTACATTGG + Intergenic
1018170450 6:161139679-161139701 TTCCCTTGGAAGCAGGGCCTCGG - Intronic
1018594153 6:165460341-165460363 TTCCCTGGAAAGCAGAGCCAGGG + Intronic
1018717481 6:166544662-166544684 TTCCATTCCAACCAGGGCCTAGG + Intronic
1019116219 6:169764679-169764701 TTCACGTGGCAGCAAGGCCTCGG + Intronic
1019728639 7:2617369-2617391 TTCCTTTGCGAGCCGGGCCTGGG - Intergenic
1020665501 7:11036482-11036504 TTCCCTTGGAACCCAGGCCTGGG - Exonic
1021241064 7:18201594-18201616 TTCCCTTGGCAGGAGGCCCTTGG - Intronic
1025744535 7:64231355-64231377 TTCCCTTGTGAGCAGGGCCCAGG + Intronic
1029645818 7:101855204-101855226 TTCACTGGGAGGCAGGGCCTGGG - Intronic
1029880432 7:103803016-103803038 TTCACTTTGAAATAGGGCCTGGG - Intronic
1034196661 7:149253703-149253725 TCCTCTTGGAAACAGGTCCTGGG + Exonic
1035020706 7:155798399-155798421 TTCCCCTGGAAGCAAAGGCTTGG + Intergenic
1035644812 8:1210727-1210749 TGCCATTGGAACCAGGGCCGGGG - Intergenic
1037896211 8:22658008-22658030 TCCCCTTGGAATCAGGGGCGTGG + Intronic
1038373673 8:27016429-27016451 TCCCATTAGCAGCAGGGCCTGGG + Intergenic
1039377140 8:37045735-37045757 CTGCCTAGGAAGCAGGGCCCAGG + Intergenic
1039461896 8:37752015-37752037 TTCCCAGGCTAGCAGGGCCTTGG + Intronic
1039916208 8:41862126-41862148 GTCCCTGGGAATCAGGTCCTTGG - Intronic
1040104621 8:43534713-43534735 TTCCCTTGTCAGCAGGGGCCTGG + Intergenic
1040816490 8:51513247-51513269 TGCACTTGCAGGCAGGGCCTCGG + Intronic
1040884401 8:52244084-52244106 TTCCCAAGGAAGTAGGGCATTGG + Intronic
1044640922 8:94380894-94380916 ATCACATGGGAGCAGGGCCTGGG - Intronic
1045257240 8:100536734-100536756 TTCCTTGGGAACCAGGGCCCTGG - Intronic
1045314021 8:101027756-101027778 CTCCCTTGGAAGCATGGTGTGGG + Intergenic
1047410322 8:124619370-124619392 GTCCCTTGGAGGCAGAGCATGGG - Intronic
1047766512 8:127994305-127994327 TTTCCCTGGGAGCAGAGCCTTGG + Intergenic
1048375892 8:133822193-133822215 TTCCCTTTGATGTAGGGTCTGGG + Intergenic
1049008203 8:139870936-139870958 TTCCCTTGGAAGTGGGGAGTGGG + Intronic
1049428634 8:142549153-142549175 CCCTCTGGGAAGCAGGGCCTGGG - Intergenic
1049450761 8:142660265-142660287 TGGCCTGGGAGGCAGGGCCTGGG - Intronic
1049898729 9:137346-137368 TCCCCTTGGAGACAGGGTCTGGG - Intronic
1050075206 9:1855845-1855867 TTCCCTCAAAAGCAGAGCCTGGG + Intergenic
1053741779 9:41147658-41147680 TCCCCTTGGAGACAGGGTCTGGG - Intronic
1054347043 9:63977468-63977490 TCCCCTTGGAGACAGGGTCTGGG - Intergenic
1054444773 9:65303805-65303827 TCCCCTTGGAGACAGGGTCTGGG - Intergenic
1054485498 9:65717698-65717720 TCCCCTTGGAGACAGGGTCTGGG + Intronic
1054686562 9:68283642-68283664 TCCCCTTGGAGACAGGGTCTGGG + Intronic
1055514922 9:77024205-77024227 CTCCCTTGGGATCAGGGCCTTGG - Intergenic
1055866579 9:80821402-80821424 TTCCCTGGGGAGCAGGTCCATGG - Intergenic
1057941323 9:99287808-99287830 TTCCAGTGCCAGCAGGGCCTAGG + Intergenic
1058789288 9:108425195-108425217 TTCCTTTGGAAGCATGGTATAGG + Intergenic
1059709718 9:116856394-116856416 TTCCCTGGTCAGCAGTGCCTGGG + Intronic
1060560664 9:124540073-124540095 TTCCCCTGGGAACAGGGCTTCGG - Exonic
1061038282 9:128125488-128125510 CACCCTTGGGGGCAGGGCCTGGG - Intronic
1061068723 9:128295545-128295567 TGCCCTGGGAAGCAAGCCCTGGG + Intergenic
1061805888 9:133137670-133137692 TTTTCTTAGAAGCAGGGCCCTGG + Intronic
1062450970 9:136615652-136615674 TTCTATTGGAGGCAGTGCCTGGG - Intergenic
1187439146 X:19302108-19302130 TTCCCTTGTAATCAAGTCCTTGG - Intergenic
1188428560 X:30077885-30077907 TTCCCTTGGAAACTGTGCCTGGG - Intergenic
1189629033 X:42932224-42932246 TTCCTTTGGAGGCAAGGGCTGGG + Intergenic
1189971219 X:46420196-46420218 TTACCTTGGAAGCAGAGACTGGG - Intergenic
1189984697 X:46543942-46543964 TTCCCCTGGAAGCAGGTGCCTGG + Intronic
1192161037 X:68787630-68787652 GTGCCTTGGAAGCATGCCCTAGG + Intergenic
1194832825 X:98645931-98645953 TTTCCATGGAAGCAGGGGGTTGG - Intergenic
1195069065 X:101262275-101262297 TTCCCTTGAGACCTGGGCCTTGG + Exonic
1198657526 X:138931281-138931303 TTCCCTAGGCAGCAGGGCTGTGG + Intronic
1199222700 X:145335722-145335744 TTCCCTTAAAATCAGAGCCTAGG + Intergenic
1199807465 X:151314643-151314665 TTGCTATGGAAGCAGGACCTTGG + Intergenic
1200860323 Y:7984216-7984238 TTCTCTTGGAAGAAGTGCCTAGG + Intergenic
1200892173 Y:8335717-8335739 TTCCCCTGTAGGCAGGGCTTAGG - Intergenic
1201973505 Y:19820352-19820374 TTCCCTTGGATGGAGGCCCCAGG + Intergenic
1202260660 Y:22967024-22967046 CTTTCTTGTAAGCAGGGCCTTGG - Intergenic
1202413647 Y:24600765-24600787 CTTTCTTGTAAGCAGGGCCTTGG - Intergenic
1202457138 Y:25069321-25069343 CTTTCTTGTAAGCAGGGCCTTGG + Intergenic