ID: 1018171695

View in Genome Browser
Species Human (GRCh38)
Location 6:161148415-161148437
Sequence TGTAGGGCCCCTGGATTTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 116}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018171681_1018171695 27 Left 1018171681 6:161148365-161148387 CCAAAATATCTCCCAGGAAAGCC 0: 1
1: 0
2: 5
3: 33
4: 247
Right 1018171695 6:161148415-161148437 TGTAGGGCCCCTGGATTTTCAGG 0: 1
1: 0
2: 0
3: 9
4: 116
1018171687_1018171695 6 Left 1018171687 6:161148386-161148408 CCTGGACGTTTGGTGTGGCCTGG 0: 1
1: 0
2: 1
3: 5
4: 102
Right 1018171695 6:161148415-161148437 TGTAGGGCCCCTGGATTTTCAGG 0: 1
1: 0
2: 0
3: 9
4: 116
1018171685_1018171695 15 Left 1018171685 6:161148377-161148399 CCAGGAAAGCCTGGACGTTTGGT 0: 1
1: 0
2: 1
3: 5
4: 124
Right 1018171695 6:161148415-161148437 TGTAGGGCCCCTGGATTTTCAGG 0: 1
1: 0
2: 0
3: 9
4: 116
1018171680_1018171695 30 Left 1018171680 6:161148362-161148384 CCACCAAAATATCTCCCAGGAAA 0: 1
1: 0
2: 1
3: 32
4: 290
Right 1018171695 6:161148415-161148437 TGTAGGGCCCCTGGATTTTCAGG 0: 1
1: 0
2: 0
3: 9
4: 116
1018171683_1018171695 16 Left 1018171683 6:161148376-161148398 CCCAGGAAAGCCTGGACGTTTGG 0: 1
1: 0
2: 0
3: 13
4: 142
Right 1018171695 6:161148415-161148437 TGTAGGGCCCCTGGATTTTCAGG 0: 1
1: 0
2: 0
3: 9
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018171695 Original CRISPR TGTAGGGCCCCTGGATTTTC AGG Intronic
900598762 1:3494199-3494221 TCTCGGGCCCCTGGATTGGCGGG - Intronic
904037112 1:27564893-27564915 TCTAGGGCCCCTCGTTTTACAGG + Intronic
904958327 1:34307713-34307735 TATAGGCCCCCTATATTTTCTGG - Intergenic
905307616 1:37030431-37030453 TGCTGGGCCCCTGTATATTCAGG + Intronic
906215330 1:44035020-44035042 TGTAGGGACCCTGGTTATGCAGG - Intergenic
907891903 1:58644734-58644756 TGTAGGGCCCCTTCATTCACTGG + Intergenic
908689588 1:66763319-66763341 TCAAGGGCCCTGGGATTTTCAGG + Intronic
909674595 1:78225276-78225298 TGGAGTTCCCCTGGATTTCCTGG + Intergenic
909691255 1:78410011-78410033 TGTAGGGCAGCTGGCTTTGCTGG - Intronic
912605860 1:110987623-110987645 TGTCTGGCCCCTGGATAGTCTGG - Intergenic
915899712 1:159837680-159837702 TTTAGGGCCGTTGCATTTTCTGG - Intronic
919355039 1:196511379-196511401 TTTAGGGACCCTGGTTTTTGTGG - Intronic
919487805 1:198165678-198165700 TTAAGGGCCCTAGGATTTTCAGG + Intronic
1066116331 10:32243526-32243548 GGCAGTGCCCCTGGAGTTTCAGG + Intergenic
1071055939 10:81507590-81507612 TGTTAGGCCCCTGGAATTTGGGG + Intergenic
1071665436 10:87551242-87551264 TTTAGTGCATCTGGATTTTCTGG - Intronic
1074383183 10:112996636-112996658 TGGAGGGCACCTGGGATTTCCGG + Intronic
1075447166 10:122521126-122521148 AGTAGGGCCCCAGTCTTTTCAGG + Intergenic
1079325818 11:19491156-19491178 TTAAGGGCCCTAGGATTTTCAGG + Intronic
1081968497 11:47183564-47183586 TGCAGGGCCCCTCGTATTTCTGG - Intronic
1087625901 11:100595767-100595789 TGTAAAGCCCCTGGATTTGGTGG - Intergenic
1087729077 11:101758134-101758156 CTCAGGGTCCCTGGATTTTCTGG - Intronic
1092714741 12:11377420-11377442 TGGATGGCACCTGGATTATCAGG + Intronic
1092983328 12:13819864-13819886 TGTATGGACCCTGGACCTTCTGG - Intronic
1096661190 12:53125082-53125104 CTTAGGGACCCTGGATTTTTTGG - Intergenic
1100090923 12:90970051-90970073 TGAAGGGCTCGTAGATTTTCTGG + Exonic
1100619483 12:96257264-96257286 TTTAAGGCCACAGGATTTTCAGG + Intronic
1104764980 12:131324239-131324261 TGTAGGGCCCCTGCATGTCGTGG + Intergenic
1105050964 12:133050366-133050388 TGCAGGGACCCTGGACATTCTGG - Intronic
1113818756 13:113195306-113195328 TGTGGGGCCCCAGGATGATCAGG - Intronic
1115379084 14:32713305-32713327 TTAAGGGCCCTAGGATTTTCAGG + Intronic
1115594420 14:34895414-34895436 GGTAGGGCCCCTGTATCTTCTGG + Intergenic
1117201747 14:53397033-53397055 TTAAAGGCCCCAGGATTTTCAGG - Intergenic
1118170930 14:63387811-63387833 TATAAGGCCCCTGTATTATCTGG - Intronic
1128558764 15:68650821-68650843 TGTAGGGCCTCTGAAACTTCAGG - Intronic
1129948884 15:79568200-79568222 TAAAGGGCCCTGGGATTTTCAGG - Intergenic
1130163905 15:81433098-81433120 TGTATGACCCCTGAAGTTTCTGG + Intergenic
1132632085 16:922969-922991 TGAAGGTCGCCTGGGTTTTCGGG + Intronic
1132632096 16:923034-923056 TGAAGGTCGCCTGGGTTTTCGGG + Intronic
1132677784 16:1127752-1127774 TGTAGGGCCCCTCGATGCCCAGG + Intergenic
1138511749 16:57512740-57512762 TCTAGGCCACCTGGATTTGCAGG + Exonic
1144662775 17:17081962-17081984 GGCTGGGCCCCTGGTTTTTCAGG + Intronic
1152028195 17:77825280-77825302 TGGAGGGAGCCTGGAATTTCAGG - Intergenic
1152300398 17:79492156-79492178 TGAAGAGCCCCTGGAATGTCGGG + Intronic
1152746031 17:82039777-82039799 TGTAGGGCCTTTGGATCATCTGG + Intergenic
1153055032 18:937252-937274 TCTAGGACCCCAGGATTTCCAGG - Intergenic
1155233835 18:23799270-23799292 TCTAGGTCCCTTGGAGTTTCCGG - Intronic
1155847973 18:30732678-30732700 TGTAGGTCATCTGGCTTTTCTGG - Intergenic
1160712163 19:557190-557212 CGTGGGGCCCCAGGATTCTCAGG + Intergenic
1161079688 19:2304495-2304517 TGTTGGGCCTCTGGATGATCCGG - Intronic
1162534059 19:11252919-11252941 TGTCGAGCCCCTGGACTTTGAGG - Exonic
1167734776 19:51287099-51287121 TGTAGGTCTCCTGGACTTTTGGG + Intergenic
1168492418 19:56821908-56821930 TGTAGGGCCACTGGTTTTATGGG - Intronic
930652446 2:53975942-53975964 TGAAGGGCCACTGCATTTTCTGG - Intronic
931141809 2:59467776-59467798 TGAAGGGCCCTGGGATTTTTAGG + Intergenic
931418027 2:62099814-62099836 TGTAGGGCCGCTGCATGTTGCGG + Intronic
931499815 2:62854025-62854047 TTAAGGGCCCTAGGATTTTCTGG + Intronic
933465321 2:82643463-82643485 TGTAGGTCACCTGGCCTTTCTGG - Intergenic
933679534 2:85087627-85087649 TGTAGAGCCGCTGGAATTTAGGG - Intergenic
936265791 2:111005312-111005334 TTTACTGCCCCTGGATTTTGAGG - Intronic
936419667 2:112351073-112351095 TGTACGACCCCTAGAATTTCTGG - Intergenic
937692567 2:124772504-124772526 TGCCGAGGCCCTGGATTTTCTGG - Intronic
940130444 2:150375450-150375472 AGTAGGGCCTCTTGATTCTCTGG + Intergenic
940879144 2:158929119-158929141 TCATGGGCCCCTGGATTTCCAGG + Intergenic
1170047610 20:12102104-12102126 TAAAGGGCCCCTGGGTTATCTGG + Intergenic
1170736044 20:19015028-19015050 TGTAGGGGCCCTTGACTTTGAGG - Intergenic
1172768689 20:37364451-37364473 TGTGGGGCCCCTGGTTTATTTGG + Intronic
1174186130 20:48707516-48707538 CGTAGGCCCTTTGGATTTTCTGG - Intronic
1175483466 20:59327680-59327702 TGTAGGGCCCCTGGCTTAGAAGG + Intergenic
1176235349 20:64051161-64051183 GGTGCGGCCCCTGGCTTTTCTGG + Intronic
1179148378 21:38789067-38789089 TGAAGGGTCCTTGGACTTTCTGG + Intergenic
1179569961 21:42272938-42272960 TGTACAGCCCCTGGATTTGTGGG - Intronic
1180180097 21:46114721-46114743 TGAATGTCCCCTGCATTTTCTGG + Intronic
1181504637 22:23344118-23344140 GGTAGGGACCCAGGATCTTCTGG + Intergenic
1181709633 22:24674348-24674370 GGTAGGGACCCAGGATCTTCTGG + Intergenic
1181766572 22:25096456-25096478 TGTGGGGCCCCTGGCTTCTCAGG + Intronic
1182767185 22:32765939-32765961 TGGAGGGCCCCTGGGTTTACAGG - Intronic
1185421461 22:50736998-50737020 TGTAAGACCTCTTGATTTTCAGG + Intergenic
952881739 3:37990092-37990114 GGTTGTGCCCCTGGAGTTTCTGG + Intronic
955186393 3:56718973-56718995 TGTGGGCCCCCTGGAGTTCCGGG + Intergenic
956547461 3:70420084-70420106 TGAAAGGTCCCTGAATTTTCTGG + Intergenic
961372483 3:126440095-126440117 TGTGGGGCCCGAGGATTTGCTGG - Intronic
964225178 3:154390086-154390108 TGAGGGGCCCCTGGAATCTCTGG + Intronic
967194807 3:187017043-187017065 TCCAGGGCCCCAGGAATTTCAGG - Intronic
970523426 4:16908211-16908233 TGTTGGGTCCCTGGATTTAGGGG - Intergenic
970901991 4:21170389-21170411 TGTAAGGCCCCAGACTTTTCTGG + Intronic
976238527 4:82928032-82928054 TGCAGGGACACTTGATTTTCTGG - Exonic
978159326 4:105527085-105527107 GGTAGGACTCCTGGATTCTCTGG + Intergenic
979920953 4:126495449-126495471 TGGAGGTCACCTGCATTTTCTGG + Intergenic
986079221 5:4372345-4372367 GTTAGGCCTCCTGGATTTTCTGG + Intergenic
986983089 5:13471628-13471650 TTAAGGGGCCCAGGATTTTCTGG - Intergenic
987653633 5:20776726-20776748 TGTAGGTTGCCTGGTTTTTCTGG - Intergenic
988741944 5:34084767-34084789 TGTAGGTTGCCTGGTTTTTCTGG + Intronic
990550636 5:56874338-56874360 TGTAGGGACTCTGGCTTTTGGGG + Intronic
991994981 5:72377978-72378000 TGGAGGGCCCCTGTAATCTCAGG - Intergenic
992487345 5:77210088-77210110 TGTAGGGCCCCTGCCATTTCGGG + Intergenic
993418159 5:87662081-87662103 TGTAGGGCCTTCAGATTTTCTGG - Intergenic
997841125 5:137241202-137241224 TTTATGGCTTCTGGATTTTCAGG - Intronic
1003513510 6:6800846-6800868 GGCACGGCTCCTGGATTTTCCGG + Intergenic
1004524245 6:16391414-16391436 TCTAATGGCCCTGGATTTTCTGG + Intronic
1007228033 6:40328442-40328464 TGGAGGGCCTCTCGATTCTCAGG + Intergenic
1007914575 6:45549208-45549230 TGAAGGGACCCTGACTTTTCGGG - Exonic
1008512366 6:52288405-52288427 TGTCTGGCTCCTGGATTTTCCGG - Intergenic
1013311436 6:108898209-108898231 TATATGGCCCATGTATTTTCAGG - Intronic
1018171695 6:161148415-161148437 TGTAGGGCCCCTGGATTTTCAGG + Intronic
1019822092 7:3251984-3252006 TTAAGGACCCCAGGATTTTCAGG - Intergenic
1020002427 7:4763509-4763531 GGGAGGGGCCCTGGAGTTTCAGG - Exonic
1028217903 7:88157713-88157735 TGAAGGTCTCCTGGAGTTTCTGG - Intronic
1029405175 7:100370553-100370575 TGTTGGGGCCCTGGATTAGCTGG + Intronic
1031654798 7:124341421-124341443 TGAAGGGACCTGGGATTTTCAGG + Intergenic
1032322275 7:130896305-130896327 TCTAGGGCCCCTGGAGCTTAAGG + Intergenic
1038928825 8:32170540-32170562 TCTAGAGCCACTGGATGTTCAGG + Intronic
1045481241 8:102593852-102593874 TTTAGGGCTGCTGGATCTTCAGG - Intergenic
1047905429 8:129467980-129468002 TGTAGGGCCTCAGATTTTTCTGG - Intergenic
1049283309 8:141761530-141761552 TGTAGAGCCCCTGGAGGTTCTGG - Intergenic
1050513259 9:6415893-6415915 AGTATGGTCCCTGGATTCTCAGG + Intronic
1058265648 9:102896231-102896253 TGTATAGCCCCTGGGTTTTAAGG - Intergenic
1060910687 9:127347519-127347541 TGTAGGGCCCTTGAATCTTATGG + Intronic
1188197820 X:27260444-27260466 TGAAGAGTCCATGGATTTTCAGG + Intergenic
1188542067 X:31262012-31262034 TGTGAGGCCCCTGTACTTTCTGG - Intronic
1188607480 X:32049809-32049831 TGAAGGGCACTTGGTTTTTCAGG + Intronic
1190626284 X:52341378-52341400 TGTAAGGTTTCTGGATTTTCTGG + Intergenic
1195721081 X:107869023-107869045 TGTATGGCTTCTGGTTTTTCTGG + Intronic
1196368517 X:114949313-114949335 TGTGGGGACTTTGGATTTTCAGG + Intergenic
1197042736 X:121958935-121958957 TGTAGGGCCACTGCACTTTCTGG - Intergenic
1198323080 X:135539013-135539035 TTAAGGGCCCTTGGATTTTCAGG + Intronic