ID: 1018174585

View in Genome Browser
Species Human (GRCh38)
Location 6:161167719-161167741
Sequence TGATGCCTTCTAGAGGGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 118}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018174585_1018174590 9 Left 1018174585 6:161167719-161167741 CCAGAGCCCTCTAGAAGGCATCA 0: 1
1: 0
2: 0
3: 8
4: 118
Right 1018174590 6:161167751-161167773 TTTTACGCAGTGAGCACTGCGGG 0: 1
1: 0
2: 0
3: 4
4: 60
1018174585_1018174589 8 Left 1018174585 6:161167719-161167741 CCAGAGCCCTCTAGAAGGCATCA 0: 1
1: 0
2: 0
3: 8
4: 118
Right 1018174589 6:161167750-161167772 TTTTTACGCAGTGAGCACTGCGG 0: 1
1: 0
2: 0
3: 8
4: 90
1018174585_1018174591 16 Left 1018174585 6:161167719-161167741 CCAGAGCCCTCTAGAAGGCATCA 0: 1
1: 0
2: 0
3: 8
4: 118
Right 1018174591 6:161167758-161167780 CAGTGAGCACTGCGGGACTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018174585 Original CRISPR TGATGCCTTCTAGAGGGCTC TGG (reversed) Intronic
902900802 1:19514503-19514525 GGATGCCTTCGAGAGGGCCCTGG + Intergenic
905412028 1:37777204-37777226 TGAAGCCTTCGAGAGTGATCTGG + Intergenic
905877979 1:41445565-41445587 TGGTGCCATCTAGAGGGGTCAGG - Intergenic
906097021 1:43230844-43230866 TTCTGCCTTCAAGAGGCCTCAGG - Intronic
907680776 1:56561146-56561168 TCTTGCCTTAAAGAGGGCTCTGG - Intronic
909137740 1:71822573-71822595 TGATGCCATAATGAGGGCTCAGG - Intronic
909900397 1:81127467-81127489 TGATGCCTGAAAGAGAGCTCTGG - Intergenic
912129774 1:106587077-106587099 TGGTGCCATATCGAGGGCTCAGG + Intergenic
915300072 1:154946692-154946714 CGAAGCCTTCCAGCGGGCTCTGG - Exonic
917643558 1:177007492-177007514 GGATGCCTTCTCGAGGCGTCTGG + Intronic
924619791 1:245650557-245650579 TGTTGCTTTGTAGAGGGCACAGG + Intronic
1063560448 10:7121393-7121415 TGCTGCCCTCTAGAGGTGTCGGG - Intergenic
1069797368 10:71062007-71062029 TGAGGCATTGCAGAGGGCTCTGG + Intergenic
1073212722 10:101818089-101818111 TGAAGCCCTCTCCAGGGCTCCGG - Exonic
1076348121 10:129794700-129794722 CGCTCCCTTCTAGAGGGCCCGGG - Intergenic
1076848491 10:133081676-133081698 TGACTCCTTGTAGAGGGCTCGGG + Intronic
1080794638 11:35552199-35552221 TGAGGCCTTATATAGGGCTGGGG - Intergenic
1081403471 11:42669091-42669113 AGATGCCTCCTAGAGAGCTTGGG + Intergenic
1081570627 11:44288642-44288664 TGAGGGCTTCCAGAGGGCTGGGG - Intronic
1084688501 11:70711241-70711263 TCCTGCCGTTTAGAGGGCTCAGG + Intronic
1085303709 11:75473451-75473473 TGATACCTTCTAGGTGTCTCTGG + Intronic
1085443894 11:76588320-76588342 GCAGGCCTTCTAGAGGCCTCAGG - Intergenic
1089640777 11:119845828-119845850 ACATGCCTTCTAGAGGTTTCTGG + Intergenic
1090258587 11:125302999-125303021 TCTGGCCTTCTAGAGGGCTGGGG - Intronic
1091225074 11:133952114-133952136 TGGGGCCTCCAAGAGGGCTCTGG - Intronic
1094782418 12:33806610-33806632 TGATGCCTTCTAAAGTTCTATGG + Intergenic
1095906903 12:47387965-47387987 TGGTTCCTTCTAGAGGCCTGAGG - Intergenic
1095949703 12:47775203-47775225 AGCTGCCTCCTAGAGGGCTGTGG + Intronic
1097101309 12:56591500-56591522 AGCAACCTTCTAGAGGGCTCTGG + Exonic
1100093812 12:91006766-91006788 TCTTGCTTTCTGGAGGGCTCTGG + Intergenic
1101023697 12:100579392-100579414 TCATGCCTTCTAAATGGGTCTGG - Intronic
1102570115 12:113822396-113822418 TGATGCATTTCACAGGGCTCTGG + Intronic
1107198337 13:37682602-37682624 TGATGCCTCCTAGTAGGCCCTGG - Intronic
1108709122 13:53015927-53015949 GGATACGTTCTGGAGGGCTCGGG - Intergenic
1109681095 13:65754330-65754352 GGATGGCTTTTAGTGGGCTCTGG + Intergenic
1116243951 14:42384112-42384134 TAAAGCCTTCTACAGGTCTCAGG - Intergenic
1118733010 14:68682599-68682621 TAATGACTTCCAGGGGGCTCTGG - Intronic
1121653982 14:95581551-95581573 TGATGCCTACTAAAGGACTTGGG + Intergenic
1127893547 15:63275894-63275916 TGAGGGCTTCTAGAGGGTTCGGG - Intergenic
1135725223 16:24849122-24849144 TAATGCCTTATAGATGACTCAGG + Intronic
1136003847 16:27315105-27315127 TCATGCCTCCCAGAGGGCTGGGG - Intronic
1136012769 16:27374930-27374952 TGATGGTGTCTAGAGGGGTCAGG - Intergenic
1136984049 16:35083477-35083499 TGATGCCTCCAACAGGGCTGAGG + Intergenic
1142005252 16:87686722-87686744 AGATGCTTCCTGGAGGGCTCAGG + Intronic
1143024993 17:3936306-3936328 TGAGGGCTTCTCGGGGGCTCCGG + Exonic
1145406577 17:22602750-22602772 TGAGGCCTTTAAGAGGGCTCTGG - Intergenic
1145833393 17:27935711-27935733 TGTTCCCTTCTCTAGGGCTCAGG - Intergenic
1149459452 17:56815110-56815132 TGCAGCATTCCAGAGGGCTCAGG + Intronic
1149562822 17:57620930-57620952 GGATGCTTTACAGAGGGCTCAGG - Intronic
1151931904 17:77237780-77237802 TGATGCCTTCCAGGGAACTCTGG - Intergenic
1152509868 17:80779313-80779335 TGGTGTCTTGTTGAGGGCTCTGG + Intronic
1156234668 18:35190581-35190603 AGATGCCTTGTAATGGGCTCTGG + Intergenic
1160064053 18:75558497-75558519 TGACACCTTCCACAGGGCTCTGG + Intergenic
1160730231 19:638772-638794 GGATGCCTTCTTGGTGGCTCAGG - Intergenic
1161733552 19:5977291-5977313 TGGTGCCTTCTCGGGGGATCTGG + Intronic
1161953745 19:7481722-7481744 TGATGCCTTCTGGAGGTCCCAGG - Intronic
1165237486 19:34434191-34434213 TGAAGCCTTCAAATGGGCTCAGG + Intronic
1166170911 19:41027171-41027193 TGATGCCGTCAAGGAGGCTCTGG - Intergenic
1166178138 19:41089000-41089022 TGATGCCGTCAAGGAGGCTCTGG + Exonic
1168343427 19:55639137-55639159 TGTTGCCTCCTAGAGGACACGGG + Intronic
929277134 2:40038146-40038168 TGATGCCATCTAGAAGCATCAGG - Intergenic
936242473 2:110799940-110799962 TGGTGCATTTTAGAGGGCGCTGG - Intronic
937987849 2:127646540-127646562 AGATGCCTGGGAGAGGGCTCGGG + Intronic
946155332 2:217803314-217803336 TGATGCCTTTTTGGGGGCTGGGG - Exonic
946290416 2:218740302-218740324 TAGTGCCTTCTAGAGGACTTGGG + Intronic
1169717760 20:8639560-8639582 AGATGCCTGCTGGAGGGTTCTGG - Intronic
1170624233 20:18019293-18019315 TACTGCCTCCTAGAGGGCCCAGG + Intronic
1171146410 20:22787582-22787604 TTTTGCCTTCTAGAGGACCCTGG - Intergenic
1175773965 20:61641455-61641477 TGATGATTCCTTGAGGGCTCTGG - Intronic
1178350969 21:31873127-31873149 TGCTGCCTTCCAGAGGGCGCCGG + Intergenic
1179564715 21:42240044-42240066 TGGTGCCTTCTGCAGGGCACTGG + Intronic
1180872349 22:19153539-19153561 GGAAGCCTTCCAGATGGCTCTGG + Intergenic
1182062452 22:27407703-27407725 AGATGCCTTCCTGGGGGCTCCGG - Intergenic
1182332429 22:29560821-29560843 TTGTGCCTTCTCCAGGGCTCGGG - Exonic
1184944561 22:47793978-47794000 GGATGCTTTCTCTAGGGCTCTGG + Intergenic
950189786 3:10968675-10968697 TGCTGCTTTCAAGAGGCCTCGGG + Intergenic
956609733 3:71110447-71110469 TGATGAATTCAAGAGGACTCGGG + Intronic
960089894 3:113628301-113628323 TGATGCCATCAGAAGGGCTCAGG + Exonic
962298361 3:134214481-134214503 TGTTGCCTTCTTTAGGGCTTGGG - Intronic
963083299 3:141414551-141414573 TGATGCCTTCCAGATGTCCCTGG - Intronic
966339374 3:178908235-178908257 GGTTGCCTTCTAAAGGGCTTAGG - Intergenic
969079455 4:4607209-4607231 TGAGACCTTCGAAAGGGCTCAGG + Intergenic
972166952 4:36298167-36298189 TGATTCCTCCTAGAGAGCTTAGG - Intronic
976514784 4:85953002-85953024 TGATACCATCTGGAGGGCTTTGG - Intronic
977564421 4:98566989-98567011 TGATGTCTTCAAGAGGGTGCAGG + Intronic
979636164 4:122956072-122956094 TTATGCACTCTAGAAGGCTCTGG + Intronic
987958023 5:24765184-24765206 TAGTCCCTTCTAGAGGACTCTGG - Intergenic
988228148 5:28441657-28441679 TGTCCCCATCTAGAGGGCTCAGG + Intergenic
989425508 5:41291141-41291163 TCTTGCCTTCTTGGGGGCTCAGG - Intergenic
991480021 5:67068098-67068120 AGATGCCTTCTAGAAGAATCAGG + Intronic
992744783 5:79808414-79808436 TGATTACTTCATGAGGGCTCTGG + Intergenic
993792228 5:92222589-92222611 TGATGTTTTCTAGAGGTTTCAGG - Intergenic
994195753 5:96921144-96921166 TTATGCCTTCGAGAGTGCTGGGG - Intronic
994511880 5:100714367-100714389 TGGTGCCTTTTAGAGGGCGGAGG - Intergenic
995181539 5:109234899-109234921 TGATGCCTTCTGGAGACCTATGG + Intergenic
996386575 5:122915296-122915318 TGATGGATTCTAGAGAGCTCAGG - Intronic
1001413216 5:171525241-171525263 TGAGGCCTTCTAGAGTACACAGG - Intergenic
1004074749 6:12334695-12334717 TGATGGCTCCTGGAGGGCTGAGG + Intergenic
1007727197 6:43923725-43923747 GGATGCCTTTGGGAGGGCTCCGG + Intergenic
1009519496 6:64663757-64663779 TGCTGCCATCTTGGGGGCTCTGG - Intronic
1010811846 6:80309859-80309881 TGAGGCCTACTTGAGGGCTGAGG - Intronic
1016247059 6:141995089-141995111 ACATGCCTTCTGGAGGGGTCTGG + Intergenic
1016729045 6:147407738-147407760 TGACGCCTCCTTGTGGGCTCTGG - Intergenic
1018174585 6:161167719-161167741 TGATGCCTTCTAGAGGGCTCTGG - Intronic
1023347795 7:39289150-39289172 TGATGCCTTCCAGAGGCAGCTGG - Intronic
1026671397 7:72393679-72393701 TGATTCCTTCAAAAGGGCTTTGG - Intronic
1028935147 7:96456017-96456039 TGGTGCCGTATCGAGGGCTCAGG - Intergenic
1032085494 7:128881375-128881397 TGATGCCTGTCAGGGGGCTCAGG - Intronic
1035336770 7:158134415-158134437 TCATTGCTTCTAGAGGGCTGGGG - Intronic
1040835331 8:51724698-51724720 AGATGGCTTCTACAGGGCTGGGG - Intronic
1043565067 8:81538650-81538672 TGGTAGCTTCTAGAAGGCTCTGG - Intergenic
1045890911 8:107156073-107156095 TGATGCCTTCTGGACTGCTTGGG - Intergenic
1047540909 8:125765442-125765464 TGATGCCTTCCAGAAGTGTCAGG - Intergenic
1049367960 8:142249805-142249827 TGATGTCTTCGAGAGAGCTGGGG + Intronic
1053052992 9:34976953-34976975 TGATGCCTCCAGAAGGGCTCTGG + Intronic
1057962621 9:99471081-99471103 TGATGCTTTATAGAGAGGTCAGG - Intergenic
1058132670 9:101270558-101270580 TGATTCATTCTTGATGGCTCTGG + Intronic
1059776739 9:117483634-117483656 AGATGCCTTCTAGAGAGCAGAGG - Intergenic
1060238499 9:121883777-121883799 TGATGCCTCCCTGATGGCTCTGG + Intronic
1060812336 9:126616807-126616829 CGATGCCCTCTCTAGGGCTCTGG - Intronic
1061800209 9:133109484-133109506 TGGTTCCTGCTAGAGGGCTGGGG - Intronic
1186692625 X:11994838-11994860 TGATGTCTTCTAGAAGTCTATGG - Intergenic
1187016150 X:15331260-15331282 TCATGCCTTCTAAATGGGTCTGG + Exonic
1189462527 X:41253866-41253888 TGCTGCCCTCTAGAGGCCGCGGG + Intergenic
1190289339 X:48981897-48981919 TGATACCTTCTGGGGGGCTGTGG - Intronic
1195395256 X:104403722-104403744 TGAAGCCTTTTGGAGGGCGCAGG - Intergenic
1200142990 X:153910916-153910938 TGATGCCTTCGAGAGAGGTGGGG - Exonic