ID: 1018174773

View in Genome Browser
Species Human (GRCh38)
Location 6:161168975-161168997
Sequence GCTATGCCCCATGTCATGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 82}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018174773_1018174775 -6 Left 1018174773 6:161168975-161168997 CCTAGCATGACATGGGGCATAGC 0: 1
1: 0
2: 0
3: 9
4: 82
Right 1018174775 6:161168992-161169014 CATAGCAGGCAATCAATAAATGG 0: 1
1: 2
2: 27
3: 142
4: 706

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018174773 Original CRISPR GCTATGCCCCATGTCATGCT AGG (reversed) Intronic
900526460 1:3131470-3131492 GCTGTGACCCATTTCTTGCTGGG + Intronic
902332652 1:15738165-15738187 GCTGTGCCCCGAGTCATGGTGGG + Exonic
902580853 1:17406569-17406591 ACTCTGCCCCATGAAATGCTAGG - Intergenic
904562912 1:31410734-31410756 ACCATGCCCCATGCCATCCTTGG - Intronic
904779681 1:32936270-32936292 GCTTTGCTTCCTGTCATGCTAGG + Intergenic
911020944 1:93387075-93387097 AATTTGTCCCATGTCATGCTGGG + Intergenic
911483278 1:98472695-98472717 GCGATGCCTCATGTAATGATGGG - Intergenic
920534177 1:206726794-206726816 GCTATGGCCCATGATATGTTGGG - Intronic
920927681 1:210358060-210358082 GCTCTGCCCCATGTCATTGTGGG - Intronic
921348609 1:214212537-214212559 GCTAGGGGCCATGTTATGCTGGG - Intergenic
924937297 1:248782942-248782964 ACTATGCCAGATGTTATGCTTGG - Intergenic
1067694985 10:48528159-48528181 GATATGCCCCAGGTCATTCAAGG + Intronic
1070558884 10:77550848-77550870 GCTAGGGCCCATGTACTGCTTGG - Intronic
1072571136 10:96658414-96658436 CCTAGACCCCAGGTCATGCTAGG + Intronic
1077663779 11:4091261-4091283 TCTCTGCCCCATGTCTTGCAGGG + Exonic
1078686668 11:13538473-13538495 GCTCTGCCCCATGGCTTGGTAGG - Intergenic
1080257212 11:30304134-30304156 CCTATGCCACATTTCATGTTTGG - Intergenic
1080443315 11:32314768-32314790 GCCATGCCCCATGACATGGCTGG + Intergenic
1086970933 11:93080073-93080095 ACTATGCCAAATGTCACGCTTGG + Intergenic
1089863851 11:121614916-121614938 GCTATCCCCCAAGTCAGTCTTGG - Exonic
1092761509 12:11815279-11815301 GCTTTGCCCCCTGCCTTGCTTGG - Intronic
1112221464 13:97495431-97495453 ACTATGCCAAATGTCATGCCCGG + Intergenic
1122660267 14:103290430-103290452 GCAACACCTCATGTCATGCTGGG + Intergenic
1122773133 14:104105971-104105993 GCCAGGCCCCATGTCAGGCCTGG - Intronic
1126467331 15:48972992-48973014 GCCATGTGCCATGTCCTGCTTGG - Intergenic
1132201962 15:99961129-99961151 GCGAGCCCCCATGTCATGCTGGG + Intergenic
1135432819 16:22401080-22401102 GCTCTTCCCCATTTCTTGCTTGG + Intronic
1137714004 16:50586567-50586589 GCTATGGCCTATGACATACTAGG - Intronic
1138448286 16:57078112-57078134 GCCCTGCCCCAAGTCAAGCTTGG + Intronic
1138659278 16:58508154-58508176 GCTATGCCAGATGTGAGGCTTGG - Intronic
1142211125 16:88809045-88809067 GCTACGCCCCATGTCATCACAGG + Exonic
1142777250 17:2150460-2150482 GCTATGCCCCATGTCATCAGGGG + Intronic
1142777268 17:2150551-2150573 GCTATGCCCCATGTCATCAGGGG + Intronic
1144088496 17:11832163-11832185 GTTATGCCCCTTGTGAAGCTTGG + Intronic
1146472014 17:33132093-33132115 GCTGTGGCCCAGGTCAGGCTAGG - Intronic
1146521686 17:33530415-33530437 GTTATGCCCCATGGCAAGCAAGG + Intronic
1148195158 17:45707924-45707946 GCTCTGCCCCATCTCCTGCCGGG + Intergenic
1148910845 17:50941834-50941856 GCTATGCCCCAGGTCCTTCCAGG + Intergenic
1156209922 18:34928460-34928482 CCAAGGCCCCATGTCCTGCTTGG - Intergenic
935079319 2:99776935-99776957 TCTGTGCCCCTTGACATGCTCGG - Intronic
944320007 2:198329488-198329510 GTTTTGCTCCATGTCATGCTAGG - Intronic
945857266 2:215083790-215083812 GCTAAGTGGCATGTCATGCTGGG + Intronic
948408664 2:237742358-237742380 GCTGTCCCCCATCTCATCCTGGG + Intronic
1171401239 20:24874055-24874077 GCTCTTCCCCATGGCATCCTGGG - Intergenic
1174288590 20:49490357-49490379 GCTAAACCCCATGCAATGCTCGG + Intergenic
1178927107 21:36785314-36785336 GCTTTGCTCCATGACACGCTGGG + Intronic
1181326204 22:22049083-22049105 ATTATGTCCCATGTCCTGCTGGG + Intergenic
950109312 3:10408386-10408408 CCTGTGCCCCAAGTCAGGCTGGG - Intronic
950841540 3:15973150-15973172 ACTATGCCCAATGTCATACTTGG + Intergenic
953515269 3:43584659-43584681 ACTATGCCAAATGTTATGCTTGG - Intronic
953914549 3:46909967-46909989 CCGAGGACCCATGTCATGCTGGG - Intergenic
955051786 3:55418166-55418188 GTTATGTCCCTTGGCATGCTTGG - Intergenic
959456216 3:106565729-106565751 GCTCTGCCCCAAGCCCTGCTGGG + Intergenic
974195070 4:58563538-58563560 GCTATGCCCCAAGTCATATGTGG - Intergenic
979109126 4:116728396-116728418 TCTCTGCCCCATCTCAAGCTTGG - Intergenic
981734919 4:147938516-147938538 CCTATACCCTATGTTATGCTGGG - Intronic
992266222 5:75020650-75020672 ACTATGCCAAATGTCCTGCTTGG - Intergenic
997346190 5:133194118-133194140 CCTATGGCAGATGTCATGCTGGG + Intergenic
1001244738 5:170097737-170097759 GCGCTGCCCCATGTCCAGCTGGG - Intergenic
1005909140 6:30292843-30292865 GCAATGCCCAAAGTCATCCTTGG + Intergenic
1006803800 6:36776095-36776117 CCCATGCCCCACGCCATGCTTGG + Intronic
1013370945 6:109470519-109470541 GTCATGCCCCATGTTATTCTGGG - Intronic
1013646377 6:112145687-112145709 ACTATGCCAAATGTCATGCTCGG - Intronic
1018174773 6:161168975-161168997 GCTATGCCCCATGTCATGCTAGG - Intronic
1021616252 7:22505943-22505965 GCTTTGCCCCATGTCCTTCCTGG + Intronic
1022926041 7:35057158-35057180 GCTTTGCCCCATGTCCTTCCTGG + Intergenic
1026365611 7:69645608-69645630 GAGATGCCACATGTCCTGCTAGG - Intronic
1027595988 7:80174816-80174838 GCTTTACCCCATGTCATTCAGGG + Intronic
1028376216 7:90148395-90148417 GCTTTGCCCCATGTCCTTCCTGG - Intergenic
1035610139 8:956498-956520 GCTGTGGCCCCTGTCATGCCAGG - Intergenic
1038218216 8:25582394-25582416 GCTATGCTCCAAGACATGTTTGG - Intergenic
1039344963 8:36693461-36693483 GCTTTGTCCTATGGCATGCTTGG - Intergenic
1039398399 8:37247122-37247144 GCCATGCCCCATGTCCTAATGGG + Intergenic
1042189762 8:66174039-66174061 GCTATGCCACATGACATTGTGGG - Intronic
1044199047 8:89412958-89412980 GCTGTGTGCCATGTCCTGCTTGG + Intergenic
1047223410 8:122937180-122937202 GCTCTGCCCCAGGTCCTCCTCGG - Intronic
1049228941 8:141472275-141472297 GCTGTGAGCCATGTCATGATAGG + Intergenic
1050652805 9:7791309-7791331 ACTATGCCAAATGTCCTGCTTGG + Intergenic
1054190960 9:61985495-61985517 GCTTTGCACCAGGGCATGCTGGG + Intergenic
1056700108 9:88896809-88896831 TCTATGCCCCATGTCCTGGCTGG + Intergenic
1057188565 9:93072931-93072953 GCTATGTCTCATCTCAGGCTCGG + Intronic
1057290508 9:93803128-93803150 GCCCTGCCCCATGTGATGCTGGG + Intergenic
1060661292 9:125406758-125406780 GCCACGCCCCATGTCAGGGTGGG + Intergenic
1185894758 X:3847902-3847924 AGTATGCCCCATGTCACACTGGG + Intergenic
1185899876 X:3886327-3886349 AGTATGCCCCATGTCACACTGGG + Intergenic
1185904992 X:3924755-3924777 AGTATGCCCCATGTCACACTGGG + Intergenic
1186886878 X:13922625-13922647 GCTATGTCACTTGTCATGTTGGG + Intronic
1187764784 X:22629204-22629226 GCTATGCACAATGTCATCATCGG + Intergenic
1190031621 X:46978565-46978587 ACTATGCCCCATGTGATTCCGGG - Intronic
1191955374 X:66638300-66638322 GCGTTGGCCAATGTCATGCTGGG - Intronic
1197306330 X:124846084-124846106 GATATGCCCCACATCATGCTAGG + Intronic
1199095457 X:143733438-143733460 GCTATGGCTACTGTCATGCTGGG - Intergenic