ID: 1018177368

View in Genome Browser
Species Human (GRCh38)
Location 6:161188950-161188972
Sequence GCATCAGGGTCAGCAGCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 737
Summary {0: 1, 1: 0, 2: 3, 3: 73, 4: 660}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018177368_1018177373 5 Left 1018177368 6:161188950-161188972 CCAGCTGCTGCTGACCCTGATGC 0: 1
1: 0
2: 3
3: 73
4: 660
Right 1018177373 6:161188978-161189000 GCTCAGTCCTCTTGCTTTGCTGG 0: 1
1: 0
2: 1
3: 15
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018177368 Original CRISPR GCATCAGGGTCAGCAGCAGC TGG (reversed) Intronic
900162884 1:1232632-1232654 GCAGCGCGGGCAGCAGCAGCAGG - Exonic
900296896 1:1956405-1956427 GCCTCAGGGGCAGCAGCAGCAGG - Intronic
900297211 1:1957784-1957806 GCACCAGGGCCAGGGGCAGCAGG - Intronic
900744630 1:4352737-4352759 GCAGCAGGGCTGGCAGCAGCAGG - Intergenic
901224686 1:7606301-7606323 GCATCATGGCCGGCAGCTGCTGG - Intronic
901380776 1:8872495-8872517 GCATCAGGCTCCCCAGCAACTGG + Intronic
901465283 1:9417340-9417362 GCAGCAGGGTCTGCAGCCACAGG - Intergenic
901525956 1:9823673-9823695 GCAGCCCGGCCAGCAGCAGCCGG + Exonic
901686069 1:10944238-10944260 CCCTCGGGGTCAGCAGCTGCCGG - Intergenic
901837677 1:11934788-11934810 CCAGCAGGGCCAGTAGCAGCAGG - Exonic
902187324 1:14735172-14735194 GCCTCAGCCTCAGGAGCAGCTGG + Intronic
902989812 1:20178962-20178984 GGGACAGCGTCAGCAGCAGCTGG - Intergenic
903339326 1:22644077-22644099 CCCTGAGGGGCAGCAGCAGCAGG - Exonic
903544686 1:24116629-24116651 TCATCAGCGTCAGCACCAGCAGG + Intergenic
903834071 1:26191355-26191377 GCAGCAGGGCCAGCAGCAGTTGG - Exonic
904028863 1:27521554-27521576 GCATCAGCAGCAGCAGCAGCAGG - Intergenic
904159542 1:28512907-28512929 GCCTCAGCGTCCCCAGCAGCTGG + Intronic
904330471 1:29755118-29755140 GCTTGAGGGCCAACAGCAGCTGG - Intergenic
905090066 1:35423566-35423588 GCATCAGCCTCTGAAGCAGCTGG - Intergenic
906159009 1:43633816-43633838 CCATCAGTGTCAGCATCACCTGG + Intergenic
906688083 1:47775353-47775375 GCTTCGGGGACAGCGGCAGCTGG + Exonic
907044047 1:51288891-51288913 GCAGCAGGGCCAGCTCCAGCAGG + Exonic
907238901 1:53069867-53069889 GCAGCAGGAGCAGCAGCACCCGG - Exonic
907599097 1:55748756-55748778 GCCTCAGTCTCAGAAGCAGCTGG + Intergenic
907700354 1:56780531-56780553 GCAACTGGATCAGCAGCACCAGG - Intronic
908304400 1:62796991-62797013 GCATCAGCCTCAGGAGTAGCTGG - Intronic
908497000 1:64704435-64704457 GCCTCAGGGTCTGGAGAAGCTGG - Intergenic
908607290 1:65812416-65812438 GGATCAGGGAGAGCAGCAGCAGG - Intronic
909091585 1:71232665-71232687 GCATCAGCCTCTGCAGTAGCTGG - Intergenic
909548022 1:76868607-76868629 GCAGCAGCAACAGCAGCAGCAGG + Exonic
910254627 1:85235548-85235570 GCCTCAGCCTCAGGAGCAGCTGG + Intergenic
910338133 1:86156262-86156284 CCATCAGGCTCAGCAGAACCAGG + Intronic
910550294 1:88467202-88467224 GCACCGGGGCCAGCAGCTGCGGG + Intergenic
910711407 1:90186163-90186185 GCTCCAGGGTAAGCAGTAGCAGG + Intergenic
910758166 1:90712404-90712426 GCACCAGGGGCCGCTGCAGCTGG + Exonic
912366572 1:109138573-109138595 GCAGCAGCAGCAGCAGCAGCAGG + Intronic
912574683 1:110657159-110657181 GCCTCAGCCTCAGCAGTAGCTGG + Intergenic
912624882 1:111198709-111198731 GCTTCGGGGTCAGCAGGAGGAGG - Exonic
912776571 1:112509400-112509422 CCGGCAGCGTCAGCAGCAGCAGG - Exonic
915043140 1:152985269-152985291 CCCTCAGCCTCAGCAGCAGCAGG + Exonic
915047684 1:153032384-153032406 CCCTCAGCTTCAGCAGCAGCAGG + Exonic
915128000 1:153679159-153679181 GCAGCAGCGGCGGCAGCAGCAGG - Exonic
915142360 1:153775506-153775528 GCAGCAGGGGCAGCAGCAGGAGG - Exonic
915163416 1:153934802-153934824 GCAGCAGCAGCAGCAGCAGCAGG - Exonic
915246316 1:154558517-154558539 GCCGCAGGGGCAGCAGCAGCCGG - Exonic
915300211 1:154947419-154947441 GCAGCTGGGCCTGCAGCAGCCGG + Exonic
915440448 1:155942381-155942403 GCAGGAAGGCCAGCAGCAGCAGG - Exonic
916946646 1:169735490-169735512 GCATCAGGCTCCCCAGTAGCTGG - Intronic
917345212 1:174022261-174022283 GGAGCAGCCTCAGCAGCAGCAGG - Exonic
917661465 1:177181384-177181406 ACATCAGGCCCAGCGGCAGCGGG + Intronic
917829888 1:178871045-178871067 CAATCTGGGTCAGCTGCAGCTGG - Exonic
919239176 1:194889523-194889545 GCACCATGGACAGCAGCAGGAGG + Intergenic
919739060 1:200971739-200971761 CCAGCAGGGCCAGCACCAGCAGG + Intronic
919821517 1:201475979-201476001 CCAGCAGAGTCAGCATCAGCTGG + Intergenic
919911769 1:202115504-202115526 TCATCAGGGTCAGAAACACCTGG - Intergenic
920335348 1:205241612-205241634 CCAGCAGCATCAGCAGCAGCAGG + Exonic
920335392 1:205241818-205241840 GCAGCAGCGGGAGCAGCAGCCGG + Exonic
920666748 1:207968542-207968564 GCAGATGGGACAGCAGCAGCAGG + Intergenic
923119711 1:230978798-230978820 GCAGCAGCAGCAGCAGCAGCCGG + Exonic
923637156 1:235710364-235710386 GCTTCAGGAGCGGCAGCAGCAGG + Intronic
924074579 1:240320064-240320086 GCATCCAGGTTAGCAGCAACTGG + Intronic
924580311 1:245317711-245317733 GCATCAGGGTGTGCAGGAGCTGG - Intronic
1062788182 10:282734-282756 GCACCAGCATCAGCAGCACCAGG + Intronic
1063109708 10:3024427-3024449 GGATCAGGGGCACCTGCAGCAGG - Intergenic
1063664044 10:8051334-8051356 GCGTGCGGGTCGGCAGCAGCCGG - Intergenic
1064380584 10:14838377-14838399 GCAGCAGGGACGGCAGCGGCAGG - Exonic
1064645340 10:17454195-17454217 GCAGCAGCAGCAGCAGCAGCAGG + Exonic
1065917725 10:30366693-30366715 GGCTCAGAGTCTGCAGCAGCAGG - Intronic
1067298423 10:44989339-44989361 GCAGCAGGGTGAGCACCTGCAGG - Exonic
1067560357 10:47300693-47300715 GCAGCAGCAGCAGCAGCAGCTGG - Exonic
1067701995 10:48580460-48580482 GCCTCAGGGTCATGAGCACCCGG + Intronic
1067713437 10:48668460-48668482 GAAGCAGGGTGAGAAGCAGCTGG - Intergenic
1068157572 10:53222021-53222043 GCAGCAGGGTGAGCAGCTCCAGG + Intergenic
1069035742 10:63644059-63644081 GCCTCAGCCTCAGGAGCAGCTGG - Intergenic
1069787104 10:70995895-70995917 GCATCACGGTGGGGAGCAGCAGG - Intergenic
1069909105 10:71749109-71749131 GCCTCAAGGTCAGCAGCTGAGGG + Exonic
1069957636 10:72061640-72061662 GCCTGAGGGCCAGGAGCAGCAGG - Exonic
1070169758 10:73924014-73924036 GCAGCAGGGTCATCACCAGCTGG - Intergenic
1070716779 10:78728260-78728282 GCCTCAGGGTCAGCTGCACCTGG + Intergenic
1071346831 10:84701368-84701390 TCATCAGCATCTGCAGCAGCAGG + Intergenic
1071567710 10:86680289-86680311 TCCCCAGGGTCAGCTGCAGCAGG - Intronic
1072505512 10:96062520-96062542 GCAGAAGGGTAAGCAGGAGCAGG + Intergenic
1072961544 10:99933849-99933871 GCCTCAGCCTCCGCAGCAGCTGG + Intronic
1073568233 10:104554040-104554062 CCAACAGGGTCAGCATCTGCTGG - Intergenic
1074148751 10:110739986-110740008 GTATCAGGGGCAGCTGGAGCAGG - Intronic
1074772333 10:116742269-116742291 GGGCCGGGGTCAGCAGCAGCGGG - Intronic
1075650238 10:124123268-124123290 GCTTCAGGGACAGCACCATCTGG + Intergenic
1076406339 10:130214611-130214633 GCAGCAGAGGCAGCGGCAGCAGG - Intergenic
1076801679 10:132833895-132833917 GCCTCAGGGGAAGGAGCAGCAGG + Intronic
1076859282 10:133132961-133132983 CCATCAGTGACAGCAGCTGCAGG + Intergenic
1076992005 11:280310-280332 GCACCACGGTCAGCGGCCGCCGG - Exonic
1077018688 11:407898-407920 GCAGCAGGGCCAGCAGGACCAGG + Exonic
1077182668 11:1223554-1223576 GCATCAGAGTGAGCAGGGGCAGG + Intronic
1077256178 11:1584461-1584483 GCAGCAGGGCTTGCAGCAGCTGG + Exonic
1077258001 11:1597765-1597787 GCAACAGGGCTTGCAGCAGCTGG + Exonic
1077258010 11:1597825-1597847 GCAGCAGGGCTTGCAGCAGCTGG + Exonic
1077259397 11:1607804-1607826 ACAGCAGGGTTTGCAGCAGCTGG + Exonic
1077262537 11:1630310-1630332 GCAGCAGGGCTTGCAGCAGCTGG - Exonic
1077605287 11:3606436-3606458 GCATCAGCCTCCCCAGCAGCTGG + Intergenic
1079269741 11:18972893-18972915 GCTTCAGAGTCAGCAGGAACTGG - Intergenic
1080493913 11:32796895-32796917 GCCTCAGCGTCCGGAGCAGCTGG - Intergenic
1081604382 11:44518269-44518291 GCATCAGGGGCTGCAGAAGGAGG + Intergenic
1081801082 11:45859770-45859792 GCAACAGCAGCAGCAGCAGCAGG - Intronic
1083326904 11:61877561-61877583 TCACCAGGGTGAGCAGCGGCGGG + Exonic
1083552264 11:63598812-63598834 GCATCAGGCTGAGCAGCCGGGGG - Intronic
1083655838 11:64229252-64229274 GGCTCAGGGTGAGCAGCGGCAGG - Exonic
1083671719 11:64303769-64303791 CCATCAGGGGCAGTGGCAGCTGG - Exonic
1084697039 11:70761916-70761938 GCAGCAGCAGCAGCAGCAGCCGG - Intronic
1084800162 11:71538375-71538397 ACAGCAGGGTTTGCAGCAGCTGG - Exonic
1084801824 11:71549040-71549062 GCAGCAGGGCTTGCAGCAGCTGG - Exonic
1084801833 11:71549097-71549119 GCAGCAGGGCTTGCAGCAGCTGG - Exonic
1084803977 11:71566066-71566088 GCAGCAGGGATTGCAGCAGCTGG - Exonic
1084804366 11:71568744-71568766 GCAGCAGGGCTTGCAGCAGCTGG - Intronic
1084804382 11:71568834-71568856 GCAGCAGGGCTTGCAGCAGCTGG - Intronic
1084804388 11:71568864-71568886 GCAGCAGGACCTGCAGCAGCTGG - Intronic
1084806066 11:71579762-71579784 GCAGCAGGGCTTGCAGCAGCTGG + Intronic
1084806438 11:71582460-71582482 GCAGCAGGGCTTGCAGCAGCTGG + Exonic
1084806445 11:71582505-71582527 GCAGCAGGGTTTGGAGCAGCTGG + Exonic
1084873155 11:72111162-72111184 GCAGCAGGAACAGCAGCATCAGG - Exonic
1085456034 11:76665918-76665940 TCAGCAGGGCCAGGAGCAGCAGG + Exonic
1085502373 11:77035619-77035641 GGATCAGGGCCAGCAGAGGCTGG + Intronic
1085963621 11:81494710-81494732 GCAGCAGCAGCAGCAGCAGCAGG + Intergenic
1086982904 11:93218163-93218185 GTGTCAGGGTCAGAATCAGCAGG + Intergenic
1087556998 11:99733683-99733705 CCATCAGAGTTAGCACCAGCAGG - Intronic
1087622526 11:100558785-100558807 GCATCAGAGACAGGACCAGCAGG + Intergenic
1088578935 11:111298563-111298585 ACATCGTGGTCAGCAGGAGCTGG - Intronic
1088606854 11:111540981-111541003 AGAAGAGGGTCAGCAGCAGCTGG - Intronic
1088883737 11:113991351-113991373 GCACCACGGCCAGCACCAGCTGG + Intergenic
1089291119 11:117438454-117438476 GCAGCAGGCTCAGAAGCACCTGG + Intronic
1089609456 11:119661354-119661376 GCAGCAGTGGCAGCAGCAGAGGG + Exonic
1089615820 11:119694208-119694230 GAATCAGGGGAAGCAGGAGCTGG + Intronic
1089645301 11:119874891-119874913 GCAGCACGGTCACCAGCAGAAGG - Intergenic
1090718401 11:129451243-129451265 GGCCCAGGGTCAGGAGCAGCTGG + Exonic
1090832338 11:130428226-130428248 GCAGCAGCAGCAGCAGCAGCAGG + Exonic
1092286260 12:7130654-7130676 GCAGAAGGGGCAGCAGCAGGAGG - Exonic
1093107458 12:15105905-15105927 GCCTCAGCCTCAGCAGTAGCTGG + Intergenic
1093751415 12:22804388-22804410 GCATCAGGGATAAAAGCAGCTGG - Intergenic
1094048703 12:26195828-26195850 GCAGCAGGGCGAGCAGCAGCGGG - Exonic
1095091478 12:38111496-38111518 GCCTCAGTGTCAGGAGTAGCTGG + Intergenic
1098433974 12:70449665-70449687 GCATCAGGGTCACCACTTGCAGG + Intergenic
1098473712 12:70874805-70874827 GCCTCAGGCTCTGGAGCAGCTGG - Intronic
1098898015 12:76084621-76084643 GCGGCAGCGGCAGCAGCAGCGGG + Exonic
1099139371 12:78952280-78952302 GCATCAGTGTCTGCTGTAGCAGG - Intronic
1099174009 12:79399806-79399828 CCAGCAAGGTCAGCATCAGCTGG - Intronic
1099478670 12:83140255-83140277 GCACCCGGGCCAGCAGCTGCGGG + Intergenic
1100280394 12:93112870-93112892 ACAGCAGGGGCAGCAGCAGAAGG - Intergenic
1101023143 12:100573659-100573681 GCCTCAGGGTCAGTAGCCGCTGG - Intergenic
1101253835 12:102958409-102958431 GCAGCAGCAGCAGCAGCAGCAGG + Exonic
1102051296 12:109864037-109864059 CCACCATGGTCAGCAGAAGCTGG + Intronic
1102358617 12:112262728-112262750 GCCTCAGCCTCACCAGCAGCTGG + Intronic
1103383491 12:120513385-120513407 GCCTCAGCCTCCGCAGCAGCTGG - Intronic
1103494627 12:121352136-121352158 GCAGCAGGGGCAGGAGCAGCTGG + Exonic
1104021249 12:124993835-124993857 GCAGCAGCAGCAGCAGCAGCAGG - Exonic
1104506433 12:129336731-129336753 GCATCAGGGCCACCAGAGGCAGG + Intronic
1104717199 12:131023967-131023989 ACACCAGGGTCAGGAGCAGAAGG - Intronic
1104800985 12:131555225-131555247 CCATCAGCGTCAGCATCACCTGG + Intergenic
1104866958 12:131961441-131961463 CCAGCTGGTTCAGCAGCAGCAGG + Exonic
1104885507 12:132104809-132104831 CCAGCTGGTTCAGCAGCAGCAGG + Exonic
1104949830 12:132434438-132434460 GCAACAGTGACAGCAGCAACAGG - Intergenic
1105306441 13:19172384-19172406 CCAGCAGTGGCAGCAGCAGCAGG - Intergenic
1106995558 13:35476296-35476318 GCAGCAGCAGCAGCAGCAGCAGG - Exonic
1107276713 13:38687428-38687450 GCAGCAGCAGCAGCAGCAGCCGG - Exonic
1108286772 13:48916549-48916571 GCATCAGCTTCACCAGTAGCTGG - Intergenic
1108662739 13:52601150-52601172 GCCTCAGCCTCCGCAGCAGCTGG + Intergenic
1109821135 13:67656849-67656871 GCAGCAGCAGCAGCAGCAGCAGG + Intergenic
1110230480 13:73162462-73162484 GCCTCAGCCTCAGGAGCAGCTGG - Intergenic
1112821668 13:103345262-103345284 GCATCAGTGGTAGCAGCAGTGGG + Intergenic
1113529013 13:111006272-111006294 GCTTCCGGGGCAGCAGCTGCAGG + Intergenic
1113941170 13:114019242-114019264 CCAGCAGTGTCAGCAGCAGGTGG + Intronic
1113970020 13:114181521-114181543 GCAGAAGGGTGAGGAGCAGCCGG + Intergenic
1114041018 14:18678422-18678444 GCATCAAGGTCACCTGCAGTGGG + Intergenic
1114046054 14:18876904-18876926 GCATCAAGGTCACCTGCAGTGGG + Intergenic
1114084415 14:19229082-19229104 GCAGCAGGCTCTTCAGCAGCAGG + Intergenic
1114118160 14:19642560-19642582 GCATCAAGGTCACCTGCAGTGGG - Intergenic
1114675481 14:24437357-24437379 GGATCAGAGTGAGCAGCAGAGGG - Exonic
1115103045 14:29726229-29726251 GCAGTAGGGGCAGCAGCAGAAGG - Intronic
1115204372 14:30886288-30886310 GCATCATGTGCAGCAGCTGCAGG - Exonic
1115308438 14:31956004-31956026 GCATCAGAGTCATCATCATCGGG + Intergenic
1115465260 14:33708080-33708102 GCAGCAGCAGCAGCAGCAGCTGG + Intronic
1117092980 14:52268603-52268625 TCATCAGCGCCAGCAGCAGGAGG - Exonic
1117107644 14:52414659-52414681 GCCTCAGCCTCACCAGCAGCTGG - Intergenic
1117658734 14:57982951-57982973 TGAACAGGGCCAGCAGCAGCTGG - Intergenic
1118149643 14:63176128-63176150 ACATCAGGGAAAGCAGCAGCTGG - Intergenic
1118849267 14:69572125-69572147 GCAGGAGGGCCAGCTGCAGCGGG - Exonic
1119322288 14:73739222-73739244 GCAGCAGCAGCAGCAGCAGCAGG - Exonic
1119433167 14:74581498-74581520 TCTTCAAGGCCAGCAGCAGCAGG - Intronic
1119788037 14:77327276-77327298 GCCTATGGCTCAGCAGCAGCTGG + Intronic
1119840712 14:77790778-77790800 GCAGGAAGGGCAGCAGCAGCTGG + Intergenic
1120185875 14:81393407-81393429 GCAGCAGCAGCAGCAGCAGCAGG + Intronic
1121195848 14:92071010-92071032 GCAGCAGCAGCAGCAGCAGCAGG - Exonic
1122152772 14:99733629-99733651 GCTTCAGGGTGAGCTGCAGGAGG + Intergenic
1122358252 14:101137279-101137301 GCATCAGGGCCAGATCCAGCAGG - Intergenic
1122636529 14:103132198-103132220 GGCTCAGGGTCATCGGCAGCTGG + Intronic
1122937688 14:104967532-104967554 GCACGAGGGCCAGCAGGAGCAGG - Intronic
1123014052 14:105365173-105365195 GTCTCAGGGTCAGCAGGGGCAGG + Intronic
1123042824 14:105497353-105497375 GCTCCAGAGTCCGCAGCAGCTGG - Exonic
1124579159 15:30937564-30937586 GCCTCAGGGTCCCCAGTAGCTGG + Intronic
1125639331 15:41216712-41216734 GCTTCAGGGGCAGGAGAAGCAGG + Exonic
1125724572 15:41861749-41861771 GCATCAGCTACAGCTGCAGCAGG - Exonic
1125933957 15:43618680-43618702 GCAGCAGCAGCAGCAGCAGCAGG + Exonic
1125947054 15:43718142-43718164 GCAGCAGCAGCAGCAGCAGCAGG + Intergenic
1126223176 15:46239024-46239046 GCATCAGCATCAGCATCACCAGG + Intergenic
1126348079 15:47717507-47717529 GCAGCAGCAGCAGCAGCAGCGGG - Intronic
1126663853 15:51057736-51057758 GCATCAGAATCAGCATCAGAGGG + Exonic
1127510885 15:59639863-59639885 GCCTCAGCCTCCGCAGCAGCTGG + Intronic
1127975118 15:63991296-63991318 GCAGCAAAGTCAGCAGCAGGTGG + Intronic
1128734718 15:70046755-70046777 GCATTAAGGACAGCAGCAGTGGG + Intergenic
1128959939 15:71991866-71991888 GCCTCAGCCTCACCAGCAGCTGG + Intronic
1129364554 15:75046364-75046386 GCTGGCGGGTCAGCAGCAGCTGG + Intronic
1129377631 15:75144173-75144195 GCAGCAGGGTGAGCAGCTCCAGG + Intergenic
1129883100 15:79019767-79019789 GGATCAGGGTCATCACCTGCCGG + Intronic
1129904663 15:79178017-79178039 GCATCAGTGACAGCAGCAAGTGG - Intergenic
1130139959 15:81216654-81216676 GCAGCAGCAGCAGCAGCAGCAGG + Intronic
1130570115 15:85035154-85035176 GCTTTGGGGTCAGCAGGAGCAGG + Intronic
1130647434 15:85741315-85741337 GCAGCAGGGGCAGCAGGACCTGG + Exonic
1130728753 15:86467772-86467794 GAAGCAGGGTGAGCAGAAGCAGG - Intronic
1130743670 15:86627762-86627784 GCAGCAGGGTCAGTAGTGGCAGG + Intronic
1130960695 15:88657010-88657032 GCCCCCGGGCCAGCAGCAGCGGG - Intergenic
1131174558 15:90201662-90201684 GCAGCAGGAGCAGCAGCAGCAGG - Exonic
1132073762 15:98801928-98801950 GCATCAGGGTCATTACCAGATGG - Intronic
1132298461 15:100761814-100761836 TCTTCCGGGTCACCAGCAGCTGG + Intergenic
1132366919 15:101264530-101264552 CCTGCAGGATCAGCAGCAGCTGG - Intergenic
1132548505 16:544488-544510 GCAGCCGGGACAGCAGCACCCGG - Intronic
1132571875 16:647787-647809 GCAGCAGGTGCAACAGCAGCTGG + Exonic
1132855988 16:2044767-2044789 GCATCAGTGACAGCAGCACCTGG + Exonic
1132892368 16:2210581-2210603 GCACCAGCAGCAGCAGCAGCAGG + Exonic
1133916078 16:10111316-10111338 GCAGCAGCGGCAGCAGCGGCAGG + Intronic
1134235600 16:12463075-12463097 TCAGCATGGGCAGCAGCAGCAGG - Intronic
1135335137 16:21595373-21595395 GCATCAGCCTCATGAGCAGCTGG + Intergenic
1136264570 16:29107385-29107407 GCAGCAGCAGCAGCAGCAGCAGG + Intergenic
1137387409 16:48054536-48054558 GAATCAGGGTCCACAGGAGCTGG - Intergenic
1137686101 16:50387799-50387821 GGATCAGTGTCAGCCACAGCAGG + Intergenic
1138029351 16:53547493-53547515 GCATAAGGGGAACCAGCAGCAGG - Intergenic
1138388289 16:56651658-56651680 CTTTCAGGATCAGCAGCAGCGGG - Intronic
1138446555 16:57067778-57067800 GCAGGAGGCTCTGCAGCAGCAGG - Exonic
1139347964 16:66316643-66316665 GCAGCAGCAGCAGCAGCAGCAGG - Intergenic
1139421472 16:66851840-66851862 GGAGGAGGGTCAGCATCAGCAGG + Intronic
1140042527 16:71418003-71418025 GCCTGAGGGGCAGCAGCTGCAGG - Intergenic
1140771705 16:78211555-78211577 GCAGCAGCAGCAGCAGCAGCAGG - Intronic
1140827816 16:78723989-78724011 GATTCAGGCTCAGCAGGAGCGGG + Intronic
1141043245 16:80690430-80690452 GGATCAAGTACAGCAGCAGCTGG - Intronic
1141418991 16:83899474-83899496 CCATCTGCGCCAGCAGCAGCGGG + Exonic
1141567573 16:84913517-84913539 CCATCAGAGTCAGCAGCTGCAGG - Intronic
1141714545 16:85719231-85719253 GCAGCAGTGTCTGCAGCACCTGG - Intronic
1141990083 16:87604287-87604309 GCAGCAGCAGCAGCAGCAGCAGG - Intronic
1142194695 16:88733984-88734006 GCATCAGCAGCAGCAGCAGGAGG - Exonic
1142214101 16:88822393-88822415 CCACCAGGGTGGGCAGCAGCAGG + Intronic
1203120304 16_KI270728v1_random:1530298-1530320 GCCTCAGGGCCAGCATCAGAAGG + Intergenic
1142875113 17:2847702-2847724 GCTTCAGGAGTAGCAGCAGCTGG + Intronic
1143480335 17:7224422-7224444 GCATCAGGGACTGCAGCCGATGG + Intronic
1143758805 17:9086251-9086273 GCCTCAGGCTCCCCAGCAGCTGG - Intronic
1143994585 17:10995712-10995734 GCAGCAGCAGCAGCAGCAGCAGG - Intergenic
1144394105 17:14826855-14826877 GCATCAGCATCAGCACCACCTGG + Intergenic
1144615255 17:16765276-16765298 GCCTCAGCCTCAGGAGCAGCTGG - Intronic
1144897446 17:18550380-18550402 GCCTCAGCCTCAGGAGCAGCTGG + Intergenic
1145077310 17:19867099-19867121 ACAGGAGGATCAGCAGCAGCCGG + Intronic
1145134926 17:20395337-20395359 GCCTCAGCCTCAGGAGCAGCTGG - Intergenic
1145212992 17:21028944-21028966 CCATCAGGATCAGGAGCAGGAGG - Intronic
1145846596 17:28043260-28043282 GCATCATCCACAGCAGCAGCTGG + Exonic
1146906472 17:36621459-36621481 ACACCAGGGTCAGCAGCTACAGG - Intergenic
1146922640 17:36723493-36723515 GCCTCAGAGTCTGCAGGAGCAGG + Intergenic
1147398469 17:40163842-40163864 GCATCAGGAGCAGCAGCTGGTGG - Exonic
1147512627 17:41084451-41084473 GCAGCTGGGGCGGCAGCAGCTGG - Exonic
1147512644 17:41084541-41084563 GCAGCAGGGGCGGCAGCAGCTGG - Exonic
1147513860 17:41097638-41097660 GCAGCAGGGGCGGCAGCAGCTGG + Exonic
1147513865 17:41097668-41097690 GCAAGAGGGGCGGCAGCAGCTGG + Exonic
1147513882 17:41097773-41097795 GCAGCTGGGGCGGCAGCAGCTGG + Exonic
1147513906 17:41097923-41097945 GCACTGGGGTCTGCAGCAGCAGG + Exonic
1147514364 17:41101856-41101878 GCAAGAGGGGCAGCAGCTGCTGG + Exonic
1147514378 17:41101931-41101953 GCACTGGGGTCTGCAGCAGCTGG + Exonic
1147514400 17:41102051-41102073 GCACTGGGGTCTGCAGCAGCTGG + Exonic
1147514833 17:41105858-41105880 GCAAGAGGGGCGGCAGCAGCTGG - Exonic
1147514838 17:41105888-41105910 GCAGCAGGGGCGGCAGCAGCTGG - Exonic
1147515955 17:41117839-41117861 GCAGCAGGGGCGGCAGCAGCTGG + Exonic
1147515960 17:41117869-41117891 GCAAGAGGGGCGGCAGCAGCTGG + Exonic
1147515973 17:41117944-41117966 GCACTGGGGTCTGCAGCAGCTGG + Exonic
1147515999 17:41118109-41118131 GCATCTGGGGCGGCAGCAGGTGG + Exonic
1147516579 17:41123628-41123650 GCAGCAGGGGCGGCAGCAGCTGG + Exonic
1147516583 17:41123658-41123680 GCAAGAGGGGCAGCAGCTGCTGG + Exonic
1147516596 17:41123733-41123755 GCACTGGGGTCTGCAGCAGCTGG + Exonic
1147516617 17:41123853-41123875 GCACTGGGGTCTGCAGCAGCTGG + Exonic
1147517946 17:41139996-41140018 GCAGCACGGGCGGCAGCAGCTGG + Exonic
1147517951 17:41140026-41140048 GCAAGAGGGGCGGCAGCAGCTGG + Exonic
1147517978 17:41140206-41140228 GCACTGGGGTCTGCAGCAGCTGG + Exonic
1147518000 17:41140338-41140360 GCACTGGGGTCTGCAGCAGCTGG + Exonic
1147518881 17:41149333-41149355 GCAGCAGGGGCGGCAGCAGCTGG + Exonic
1147518897 17:41149438-41149460 GCACTGGGGTCTGCAGCAGCTGG + Exonic
1147518902 17:41149468-41149490 GCAGCTGGGGCAGCAGCAGGTGG + Exonic
1147518914 17:41149528-41149550 GCAGCAGGGGCGGCAGCAGCTGG + Exonic
1147518919 17:41149558-41149580 GCAATAGGGGCGGCAGCAGCTGG + Exonic
1147519831 17:41160287-41160309 GCACTGGGGTCTGCAGCAGCTGG + Exonic
1147519857 17:41160422-41160444 GCATTGGGGTCTGCAGCAGGTGG + Exonic
1147519864 17:41160467-41160489 GCACTGGGGTCTGCAGCAGCTGG + Exonic
1147519878 17:41160542-41160564 GCACTGGGGTCTGCAGCAGCTGG + Exonic
1147520509 17:41167891-41167913 GCAGCTGGGTTTGCAGCAGCTGG + Exonic
1147520523 17:41167981-41168003 GCAGCTGGGTTTGCAGCAGCTGG + Exonic
1147522748 17:41190122-41190144 GCAGCAGGGTGTGCTGCAGCAGG - Exonic
1147524857 17:41212917-41212939 GCAGCAGGGCTGGCAGCAGCTGG - Intronic
1147524873 17:41213023-41213045 GCAGCAGGGTGTGCTGCAGCAGG - Intronic
1147524904 17:41213200-41213222 GCAGCAGGGCTAGCAGCAGCTGG - Intronic
1147526285 17:41226890-41226912 GCAGCAGGGTGTGCTGCAGCAGG - Exonic
1147528445 17:41249941-41249963 GCAGCAGGGTGTGCTGCAGCAGG - Exonic
1147528994 17:41255783-41255805 GCAGCAGGGCTGGCAGCAGCTGG - Exonic
1147530487 17:41271723-41271745 GCAGCAGGGCTGGCAGCAGCTGG - Intergenic
1147530869 17:41275918-41275940 GCAGCAGGGTGTGCTGCAGCAGG - Exonic
1147531312 17:41280752-41280774 GCAGCAGGGTGGGCTGCAGCAGG - Intergenic
1147956423 17:44137925-44137947 GGCTCAGGGTCAGTTGCAGCTGG - Intergenic
1147989059 17:44322404-44322426 GCACCATGGTGAGGAGCAGCTGG - Exonic
1148021693 17:44557712-44557734 GCAGCAGCGGCAGCAGCAGGCGG - Exonic
1148177794 17:45582852-45582874 GCCTCAGGCTCCCCAGCAGCTGG - Intergenic
1148704310 17:49615626-49615648 GCATCAGCCTCAGGAGTAGCTGG + Intronic
1150063408 17:62088422-62088444 GCAGCAGCAGCAGCAGCAGCTGG + Intergenic
1150206493 17:63412501-63412523 GCAGCTGGGACAGCGGCAGCAGG - Intronic
1150238269 17:63610864-63610886 GCTTCAGGTGAAGCAGCAGCTGG - Intergenic
1151732125 17:75917818-75917840 GCGGCTGGGCCAGCAGCAGCGGG - Exonic
1152000068 17:77639762-77639784 GCAGCAGCAGCAGCAGCAGCTGG - Intergenic
1152101753 17:78305529-78305551 GAAGCAGGGTCAGCAGCCCCTGG - Intergenic
1152105792 17:78328100-78328122 GTTTCAGGCTCAGCAGCAGCAGG + Intergenic
1152235144 17:79134783-79134805 ACATCAGGGACAGCAGCCACCGG + Intronic
1152571516 17:81123201-81123223 CCGACAGGGTCAGCTGCAGCTGG + Exonic
1152674190 17:81628991-81629013 GCCTCAGCCTCACCAGCAGCTGG + Intronic
1152990616 18:360516-360538 GCATCAGCATCAGCATCACCTGG - Intronic
1155351899 18:24915086-24915108 GCATCCGCTCCAGCAGCAGCTGG + Intergenic
1155564697 18:27121115-27121137 GCCTCAGGCTCTCCAGCAGCTGG + Intronic
1156381335 18:36564135-36564157 GCAGCAGGGTCAGCAGTGGCTGG - Intronic
1156450698 18:37264739-37264761 GCAGCAGGGTAGGCAGCTGCTGG + Exonic
1157506782 18:48231936-48231958 GCAGCAGGGTGGGCAGCACCAGG - Intronic
1157873458 18:51250896-51250918 GCATTAGGGATAGAAGCAGCAGG + Intergenic
1158293748 18:55971220-55971242 GCAGCAAGGACAGCAGCAGCAGG - Intergenic
1158437036 18:57441020-57441042 GCATCAGGGTGGGCGGGAGCGGG + Intronic
1158920593 18:62187323-62187345 GCATCAGGTGCAGCTGCATCCGG + Exonic
1159378667 18:67628455-67628477 GCTTCAGCCTCAGGAGCAGCTGG + Intergenic
1159608405 18:70499064-70499086 GGAACAAAGTCAGCAGCAGCAGG - Intergenic
1159634544 18:70789274-70789296 TCACCAAGGTCAGAAGCAGCAGG - Intergenic
1159972670 18:74673182-74673204 TCATCTGGTTCAGCAGCAGCAGG - Intronic
1160034850 18:75291119-75291141 GCAAGAGTGTTAGCAGCAGCAGG + Intergenic
1160810379 19:1010609-1010631 GCCTCAGTGGCAGCAGCTGCCGG - Exonic
1161009975 19:1955298-1955320 GCAGCAGCAGCAGCAGCAGCAGG - Intronic
1161224424 19:3136467-3136489 GCACCAGGGGCAGCAGCGCCAGG - Exonic
1161781923 19:6298562-6298584 GCAGCAGGGTGAGCAGCTCCAGG - Intergenic
1161793922 19:6375798-6375820 GCTGCAGGGACAGGAGCAGCAGG + Exonic
1161957149 19:7502552-7502574 GCATCAGTTTCAGCATCAGGAGG + Intronic
1162425148 19:10590607-10590629 GAATCTGGGTCTGCAGCAGCTGG - Intergenic
1162481106 19:10927683-10927705 GCAGCAGCAGCAGCAGCAGCCGG - Exonic
1162818034 19:13207858-13207880 GCAGCAGCAGCAGCAGCAGCAGG - Exonic
1162833016 19:13298798-13298820 GCAGCAGGGAGAGCCGCAGCGGG - Exonic
1163170126 19:15525447-15525469 GCCTCAGGAACCGCAGCAGCAGG - Exonic
1163510887 19:17734263-17734285 GGATCAGGGTCACCTGCAGGTGG - Exonic
1163524450 19:17812127-17812149 GCATCAGGGTCCCCAGCCTCTGG + Exonic
1163717155 19:18879258-18879280 TCATAAGGGTGAGCAGCAGCAGG + Exonic
1163799546 19:19356328-19356350 GCATCAGTCCCTGCAGCAGCTGG + Exonic
1165147564 19:33741147-33741169 GCATGATTGACAGCAGCAGCAGG - Intronic
1165271043 19:34707918-34707940 GCAGCAGAATCAACAGCAGCTGG - Intergenic
1165355291 19:35300235-35300257 GCATCCAGGTCAGCAGCGGCGGG - Exonic
1165847574 19:38828344-38828366 GCCTCAGGCTCTCCAGCAGCTGG + Intronic
1165907803 19:39204218-39204240 GGGCCAGGGCCAGCAGCAGCGGG + Exonic
1166551748 19:43670090-43670112 GCAGCAGCGGCAGCAGCGGCGGG + Exonic
1167096993 19:47379880-47379902 GCACCAGGCCCAGCAGCAGCTGG + Exonic
1167443682 19:49525049-49525071 GCAGCAGCAGCAGCAGCAGCAGG - Intronic
1167659897 19:50790456-50790478 GCACCAGCAGCAGCAGCAGCAGG - Exonic
1167754518 19:51403653-51403675 ACATCAGGATCAGTGGCAGCTGG + Intergenic
1167785215 19:51630305-51630327 ACAGCAGGGGCAGCAGCAGCAGG + Intronic
1167787314 19:51646729-51646751 ACAGCAGGGGCAGCAGCAGCAGG + Exonic
1168110053 19:54187160-54187182 CCTTCAGCGTCAGCAGCAGCTGG + Exonic
1168187717 19:54710264-54710286 GCACCAAGCTCAGCAGCACCAGG + Intergenic
1168269579 19:55242182-55242204 CCAGCAGGGTCAGCAGCACCTGG + Exonic
1168273948 19:55265935-55265957 GCACCAGGGCCACCAGCTGCTGG + Exonic
1168560995 19:57383072-57383094 GCTGCAGTGTCAGAAGCAGCTGG - Intronic
925156596 2:1652984-1653006 ACATCATTTTCAGCAGCAGCTGG - Intronic
925289425 2:2737242-2737264 GCATCAGGGGCAGGAGCAGCTGG + Intergenic
925747255 2:7054082-7054104 CCTTCAGGGTTAGCAGCAGCCGG - Intronic
926123579 2:10257727-10257749 GGAGCAGGGGCAGCTGCAGCAGG - Intergenic
926597282 2:14805104-14805126 GCCACAGGATCAGAAGCAGCTGG + Intergenic
926796664 2:16625268-16625290 GCAGCAGGGGCAGCAGCAAGAGG + Intronic
927003951 2:18828136-18828158 GCTGCAGGGTCACCTGCAGCTGG - Intergenic
927217734 2:20677967-20677989 GCAGCAGCAGCAGCAGCAGCTGG + Intergenic
928239034 2:29570564-29570586 GAAACAGGGTCTGCAGGAGCAGG + Intronic
928561682 2:32494793-32494815 GCATCAGGCTCCACAGTAGCTGG - Intronic
929974360 2:46617234-46617256 GCAACAGCAGCAGCAGCAGCAGG - Exonic
931219992 2:60280461-60280483 GCATCAGCGGCAGCAGCCCCAGG - Intergenic
931909894 2:66887819-66887841 GCAGCAGCAGCAGCAGCAGCAGG + Intergenic
932257108 2:70297384-70297406 GCTTCAGGTGAAGCAGCAGCTGG - Exonic
932278493 2:70469635-70469657 GCATCAGGATCACCTGCAGGGGG - Intronic
932319882 2:70814070-70814092 GCATAAAGGTCAGGAACAGCCGG + Intronic
932749354 2:74361534-74361556 GCTCCTGGGTCAGCACCAGCCGG + Exonic
933263095 2:80151810-80151832 GCAGCACTGGCAGCAGCAGCTGG - Intronic
933895747 2:86808449-86808471 GCAGCAGGGGCACTAGCAGCAGG + Intergenic
934555221 2:95283496-95283518 GCATCAGTGGCAGCAGCTTCAGG - Intronic
934640403 2:96024212-96024234 GCAGCAGGTGCATCAGCAGCAGG + Exonic
934793248 2:97081204-97081226 GCAGCAGGTGCATCAGCAGCAGG - Intergenic
935189021 2:100761032-100761054 CCATCAGCGTCAGCAGCACCTGG - Intergenic
936023165 2:109010849-109010871 GGAGGAGGCTCAGCAGCAGCTGG + Intergenic
937338730 2:121077487-121077509 GCGGCAGGGGCAGAAGCAGCTGG - Intergenic
937656167 2:124379354-124379376 GCAAAAAGGTCAGCAGCTGCTGG - Intronic
937863570 2:126731791-126731813 GCAGCAGCAGCAGCAGCAGCAGG + Intergenic
938269164 2:129954096-129954118 GCATCAAGGTCACCTGCAGTGGG - Intergenic
938297935 2:130190084-130190106 CCATCAGCGGCGGCAGCAGCAGG - Intronic
938365376 2:130729355-130729377 GCAGGATGGTCACCAGCAGCAGG - Exonic
938463376 2:131511876-131511898 GCCTCTGAGTCACCAGCAGCCGG - Intergenic
938563724 2:132497705-132497727 GCTTCAGGGTGAGTAGCAGCAGG - Intronic
938675601 2:133630636-133630658 GCAGAAGGGTCACCAACAGCAGG - Intergenic
938687150 2:133749729-133749751 GCATCAGCCTCAGCATCACCTGG - Intergenic
939146760 2:138425024-138425046 GAAGCAGGCTCAGAAGCAGCTGG + Intergenic
940509736 2:154598322-154598344 GCATCAGCGTCTGGAGTAGCTGG + Intergenic
941788294 2:169522835-169522857 GCCTCAGGCTCTGGAGCAGCTGG + Intronic
942122497 2:172792204-172792226 GCAGCAAGGACAGCAGCAGCTGG - Intronic
942446346 2:176081066-176081088 GCCTGAGGAGCAGCAGCAGCCGG - Intronic
943013050 2:182475264-182475286 CCATCTGGGACAGCAGCAACAGG + Intronic
943018221 2:182540395-182540417 GCAGCAGCAGCAGCAGCAGCAGG + Intergenic
943351950 2:186806301-186806323 GCAGCAGGGGCAGAAGCCGCAGG + Intergenic
943394639 2:187318745-187318767 GCATCAGCATCAGCATCACCTGG + Intergenic
943577789 2:189651838-189651860 GCCTTAGGGTCAGCGGCAGCTGG + Intergenic
943949084 2:194106235-194106257 GCCTTAGCGTCAGGAGCAGCTGG + Intergenic
944882363 2:204026466-204026488 GCAAGAGGAACAGCAGCAGCAGG - Intergenic
945181574 2:207097064-207097086 GCAGCAGCATCAGCATCAGCTGG - Intronic
945239030 2:207659769-207659791 GCAGCAGGGTCAGCCGGGGCAGG + Intergenic
945913059 2:215671345-215671367 GCATCAGCATCAGCATCACCTGG - Intergenic
945944574 2:215982515-215982537 GCATCAGGGCCAAAAGCAGGTGG + Intronic
946028055 2:216684087-216684109 GCCTCTGGGTCTGTAGCAGCTGG - Intronic
946363744 2:219235797-219235819 GCAGCAGAGGCAGCAGGAGCAGG + Exonic
946449655 2:219769018-219769040 GCAGCAGGAGGAGCAGCAGCAGG + Intergenic
946598701 2:221335327-221335349 TCAGCAGGGTCAGCAGCAACGGG + Intergenic
947470947 2:230400754-230400776 GCATCAGTGGTAGCAGCAGGAGG - Intronic
947588491 2:231371166-231371188 GCAACAGTGACACCAGCAGCTGG + Intronic
947990069 2:234479781-234479803 CCAGCAGGGTCAGCATCACCAGG + Intergenic
948731834 2:239969426-239969448 TCCTGAGGGTCAGGAGCAGCAGG - Intronic
1169926344 20:10788284-10788306 CCACCAGCTTCAGCAGCAGCTGG - Intergenic
1170599618 20:17831324-17831346 CCATCACGTGCAGCAGCAGCCGG + Intergenic
1170730632 20:18972025-18972047 ACATCAGAGTCAACAGGAGCTGG - Intergenic
1170858890 20:20084401-20084423 GCAGCAGCAGCAGCAGCAGCAGG - Intronic
1171180254 20:23086153-23086175 GCAGCAGCAGCAGCAGCAGCAGG + Exonic
1171198029 20:23216511-23216533 GCATCAGCATCAGCATCAGCAGG + Intergenic
1172100848 20:32483441-32483463 GCAGCAGCAGCAGCAGCAGCTGG - Exonic
1172310348 20:33913296-33913318 GAGCCAGGTTCAGCAGCAGCAGG - Intergenic
1172692900 20:36802897-36802919 GCTGCAGGGTGAGAAGCAGCAGG - Exonic
1173744194 20:45424146-45424168 GCAGCAGGGACAGGGGCAGCAGG + Intronic
1173800467 20:45891598-45891620 GCAGCAGCAGCAGCAGCAGCAGG - Exonic
1173812941 20:45967610-45967632 GCAGCAGCCGCAGCAGCAGCTGG - Exonic
1174193691 20:48758025-48758047 GCCTCAGGGTCTGCTGCATCTGG - Intronic
1174449239 20:50609526-50609548 GCAGCAGGGGCAGCAAGAGCTGG - Intronic
1174716129 20:52760956-52760978 GCACCAGAAACAGCAGCAGCTGG - Intergenic
1175225394 20:57441326-57441348 GCAGCTGGGCCAGCAGTAGCAGG + Intergenic
1175320593 20:58085032-58085054 GCACCAGGGTGGGCACCAGCAGG - Intergenic
1175894660 20:62330771-62330793 GCATCAGGGTCCACAGCGGTGGG + Exonic
1176186828 20:63784845-63784867 GCCTCAGGGTCACCAGGGGCCGG + Intronic
1176383093 21:6123115-6123137 GCAGCAGCAGCAGCAGCAGCAGG - Exonic
1176424217 21:6538095-6538117 GCCTCTGGGTGAGCTGCAGCAGG - Intergenic
1176615711 21:9026978-9027000 GCAGCAGGCTCTTCAGCAGCAGG + Intergenic
1176663720 21:9664293-9664315 GCACCTGGGCCAGCAGCTGCAGG - Intergenic
1177147612 21:17423341-17423363 GCATCCAGGTAAGCTGCAGCTGG + Intergenic
1177237570 21:18412723-18412745 GCAGCAGCAGCAGCAGCAGCAGG - Intronic
1178331385 21:31696599-31696621 GCAGCGGGTGCAGCAGCAGCAGG + Exonic
1179358139 21:40681336-40681358 GCAGCTGGGACAGCGGCAGCTGG + Intronic
1179699710 21:43146410-43146432 GCCTCTGGGTGAGCTGCAGCAGG - Intergenic
1179740376 21:43415124-43415146 GCAGCAGCAGCAGCAGCAGCAGG + Exonic
1179934163 21:44591861-44591883 GCATGAGGGTGTGCAGGAGCTGG + Exonic
1180293557 22:10864120-10864142 GCAGCAGGCTCTTCAGCAGCAGG - Intergenic
1180464587 22:15599527-15599549 GCATCAAGGTCACCTGCAGTGGG + Intergenic
1180496362 22:15893535-15893557 GCAGCAGGCTCTTCAGCAGCAGG - Intergenic
1181030965 22:20148784-20148806 GCCTCAGGGTCAGCAGCCTGCGG + Exonic
1181056929 22:20264759-20264781 GCCTCAGGGTCTGCGGGAGCTGG - Intronic
1181104613 22:20566541-20566563 GCAGCAGCAGCAGCAGCAGCAGG + Exonic
1181360013 22:22327225-22327247 TCATCAGGGTCAGCTGCACAAGG + Intergenic
1181580253 22:23824271-23824293 GGATCAGGGTGGGCAGCTGCAGG - Intronic
1181781073 22:25193734-25193756 GCACCAGGGACAGCAACTGCAGG + Exonic
1182060123 22:27391135-27391157 GCCTCAGGCTCACCAGTAGCTGG - Intergenic
1183357899 22:37369283-37369305 GCAGCTGGGGCAGCAGCAGTGGG - Exonic
1183784841 22:40023345-40023367 GCAGCAGCAGCAGCAGCAGCTGG - Intronic
1183978219 22:41525341-41525363 TCATCAAGGTCAGCAGCATGGGG + Exonic
1184067928 22:42130722-42130744 GCATCAGGTCCACCAGGAGCAGG + Exonic
1184070665 22:42144395-42144417 GCATCAGGTCCACCAGGAGCAGG + Intergenic
1184072548 22:42154932-42154954 GCATCAGGTCCACCAGGAGCAGG + Intergenic
1184159430 22:42689103-42689125 GCAGCAGCAGCAGCAGCAGCAGG + Intergenic
1184279367 22:43428287-43428309 GCCTCGGAGTCAGCAGAAGCCGG - Intronic
1184323788 22:43766148-43766170 GCCTCAGGTTCTGGAGCAGCTGG + Intronic
1184489996 22:44802985-44803007 GCAGCAGCAGCAGCAGCAGCAGG - Intronic
1184506786 22:44908491-44908513 GCAACAGGGGCTGCAGCAGAAGG - Intronic
1184508566 22:44918621-44918643 CCACCTGGGACAGCAGCAGCTGG + Intronic
1184648287 22:45907944-45907966 GCCTGAGGGTCCCCAGCAGCTGG - Intergenic
1184691093 22:46117617-46117639 CCCTCAGGCTCAGCAACAGCTGG - Intergenic
1184933729 22:47702256-47702278 GCAGCAGCAGCAGCAGCAGCGGG - Intergenic
1184976936 22:48068994-48069016 GCATCTGGGCCAGCAACAGCAGG - Intergenic
1185084778 22:48734799-48734821 GGGACAGGGTCACCAGCAGCAGG + Intronic
950495999 3:13334967-13334989 GCCTCAGGGGCATCAGCAGGTGG + Intronic
950794676 3:15501286-15501308 GCAGCAGGGACAGGAGCACCTGG - Intronic
951640311 3:24829143-24829165 GCAGCAGTGGCAGCAGTAGCAGG + Intergenic
952533449 3:34286137-34286159 GCAGCAGCAGCAGCAGCAGCAGG - Intergenic
952742356 3:36746914-36746936 GCATCAGCATCAGCATCATCTGG - Intergenic
952930923 3:38360558-38360580 GGATCAGGCTCAGCCTCAGCTGG + Intronic
952934915 3:38389689-38389711 GGATCAGGATCAGCAGGATCAGG + Intronic
953504879 3:43475711-43475733 GCATCAGCCTCCGGAGCAGCCGG + Intronic
953886601 3:46717731-46717753 GCAACAGAAGCAGCAGCAGCAGG + Exonic
953925854 3:46982112-46982134 GGATCAGGGTCAGGAGCAGGCGG - Intronic
954429779 3:50464371-50464393 GCATGATTTTCAGCAGCAGCTGG - Intronic
954853370 3:53622163-53622185 GCCTCAGCCTCAGCAGTAGCTGG + Intronic
955301461 3:57783941-57783963 GCAGCAGGTTCAGCAACACCTGG - Intronic
955541852 3:59984905-59984927 GCAGCAGGGTCAGCAGTATTGGG + Intronic
955601816 3:60653710-60653732 GCATCAGACTTAGCAGCAGCAGG + Intronic
956678257 3:71754607-71754629 CCACCACGGCCAGCAGCAGCAGG - Exonic
958456665 3:94340397-94340419 GACTCAGGGTCTGCAGAAGCAGG + Intergenic
959040285 3:101414516-101414538 GCTTCAGGTGAAGCAGCAGCTGG + Intronic
959928201 3:111949004-111949026 GCAACAGCATCAGCATCAGCAGG - Exonic
960277629 3:115745506-115745528 GCATAAGGGTTAGGTGCAGCTGG - Intergenic
960848203 3:122023794-122023816 GCAGCAGCAGCAGCAGCAGCAGG + Intergenic
960949572 3:122990437-122990459 GCAGCAGCAGCAGCAGCAGCAGG + Intronic
961442351 3:126960555-126960577 GCAGCAGCAGCAGCAGCAGCAGG + Intergenic
961584315 3:127909718-127909740 GCTTCAGGGTCAGCACCTGTGGG - Intergenic
962713057 3:138103584-138103606 GCAGCGTGGTCAGCAGGAGCTGG - Exonic
962774749 3:138649192-138649214 GCACCAGTGGCAGCAGCAGAAGG + Intergenic
962942673 3:140140126-140140148 GCATCAGCATCAGCATCACCTGG - Intronic
965672060 3:171157546-171157568 GCAGCTGGAGCAGCAGCAGCGGG - Exonic
966448177 3:180027115-180027137 GCAGCAGCAGCAGCAGCAGCAGG + Intronic
966516851 3:180829076-180829098 GCGTCAGGCTCAGCAGCTACAGG + Intronic
966790058 3:183659420-183659442 GCCTCAGTCTCTGCAGCAGCTGG - Intronic
966825871 3:183964547-183964569 GCATCAGCATCAGCATCATCTGG - Intronic
967273436 3:187750064-187750086 GCATGAAGGAAAGCAGCAGCTGG + Intergenic
967504466 3:190238549-190238571 GCCTCAGGGTTTGCACCAGCAGG - Intergenic
967758207 3:193194498-193194520 GCAGCAGCGGCTGCAGCAGCTGG + Intergenic
968035044 3:195541374-195541396 GCTTCAGGGTTTTCAGCAGCAGG - Intronic
968054566 3:195681567-195681589 GCATCAGGTTCTGCAGCTCCAGG - Intergenic
968101325 3:195967591-195967613 GCATCAGGTTCTGCAGCTCCAGG + Intergenic
968262119 3:197333967-197333989 GCAGCAGCAGCAGCAGCAGCAGG + Intergenic
968285406 3:197505675-197505697 GAAGCAGGGTCAACAGCAGCAGG - Intergenic
968488602 4:877389-877411 GGATCCTGGTCAGCAGCAGGAGG - Intronic
968488613 4:877448-877470 GGATCCTGGTCAGCAGCAGGAGG - Intronic
968633513 4:1665666-1665688 CCGGCAGGGTCAGCAGGAGCAGG + Intronic
969006134 4:4021332-4021354 GCAGCAGCAGCAGCAGCAGCTGG + Intergenic
969806814 4:9615958-9615980 GCAGCAGCAGCAGCAGCAGCTGG - Intergenic
969934131 4:10664707-10664729 GCAGCAGTGTCAGCATCACCAGG - Intronic
971756594 4:30716910-30716932 GCAGCAGCAGCAGCAGCAGCAGG + Intergenic
972388003 4:38586458-38586480 TCCTCAAAGTCAGCAGCAGCCGG + Intergenic
972913301 4:43846305-43846327 GCACCTGGGCCAGCAGCTGCGGG + Intergenic
973306688 4:48659985-48660007 GCAGCAGCAGCAGCAGCAGCAGG + Intronic
974160502 4:58132203-58132225 GCAACAGCGACAGCAGCAGGAGG + Intergenic
974553026 4:63405384-63405406 GCCTCAGCGTCAGGAGTAGCTGG - Intergenic
974698024 4:65399211-65399233 GCATCTGATTCAGCTGCAGCTGG + Intronic
975072459 4:70158709-70158731 GCAGCAGGCTCAGCTGCAACAGG - Exonic
975072466 4:70158769-70158791 GCAGCAGGCTCAGCTGCAACAGG - Exonic
975108944 4:70601603-70601625 GCCTCTGGTTCAGCAGCAGGTGG + Exonic
975373012 4:73609985-73610007 GCATCTGAGTCAGAAGCAGGTGG + Intronic
976178854 4:82380645-82380667 GCAGCAGGGTGAGCAGCTCCAGG + Intergenic
976441841 4:85084981-85085003 ACAGCAGGAACAGCAGCAGCTGG - Intergenic
976972782 4:91128049-91128071 GCATGTGGGGGAGCAGCAGCAGG - Intronic
977013523 4:91663331-91663353 GTGTCAGTGGCAGCAGCAGCAGG + Intergenic
978503004 4:109428971-109428993 GCATCAGCATCAGCATCACCTGG + Intergenic
978761375 4:112358496-112358518 CCCTCAGGGTCACCAGCTGCTGG + Intronic
980423669 4:132596594-132596616 TCATCAGGGTCAAAAGCAACTGG + Intergenic
981689224 4:147488142-147488164 GCTTCAGGGTGAACAGCAGCAGG - Intronic
982737513 4:159021441-159021463 GCTCCTGGGTGAGCAGCAGCTGG + Intronic
983074334 4:163307062-163307084 GCCTCAGCGTCAGGAGTAGCTGG + Intergenic
983141992 4:164161554-164161576 GCAGCAGCAGCAGCAGCAGCAGG + Intronic
984395937 4:179200092-179200114 GCCTCAGGCTCAGGAGTAGCTGG - Intergenic
984808837 4:183776187-183776209 GCCTCAGGGTGGGCAGTAGCGGG - Intergenic
985164621 4:187079337-187079359 GTACCAGGCACAGCAGCAGCAGG + Intergenic
985501626 5:251369-251391 GCATCAGGTTCTGCAGCTCCAGG - Exonic
985735253 5:1576256-1576278 GCATCAGGTTCTGCAGCTCCAGG + Intergenic
985810082 5:2076205-2076227 GAATGAGGGACAGCAGCACCTGG + Intergenic
986745127 5:10736990-10737012 GCACCTGGGTCAGCTGCTGCTGG + Intronic
987316637 5:16730576-16730598 TCAACAGGGGCAGCATCAGCTGG + Intronic
987969289 5:24921325-24921347 GCAGCAGGAGCAGCAGCAGCGGG + Intergenic
988585750 5:32506077-32506099 GGATCAGTTTCAGCTGCAGCTGG - Intergenic
991054486 5:62306446-62306468 TCATCTGGAGCAGCAGCAGCGGG - Exonic
991556632 5:67902226-67902248 GGATCAGGTTCAGCAGTGGCAGG - Intergenic
991688275 5:69201742-69201764 GCCTCAGCCTCAGAAGCAGCTGG - Intronic
991952322 5:71958446-71958468 GCAGCAGCAGCAGCAGCAGCAGG - Intergenic
992326905 5:75668824-75668846 GCAGCAGTGGCAGCAGCACCCGG + Intronic
994001843 5:94790473-94790495 TCATCATGGTCAGCAGCTGTGGG + Intronic
994487953 5:100402675-100402697 GCCTCAGCCTCCGCAGCAGCTGG - Intergenic
994744265 5:103659228-103659250 GCAGCAGGGAGAGCAGCAACAGG + Intergenic
995283363 5:110359184-110359206 GCATCAATTTCAGAAGCAGCAGG + Intronic
995283877 5:110364696-110364718 GCCTCAGGGTCATGAGTAGCTGG - Intronic
996434497 5:123419977-123419999 GTACCAGGGTGAGTAGCAGCAGG - Intronic
997194003 5:131965605-131965627 GCCTCAGGCTCCCCAGCAGCTGG - Intronic
997266170 5:132496503-132496525 GCAGCCGGGTCAGCAGCTACAGG + Intergenic
998188432 5:140001095-140001117 GTAGCAGGGCCTGCAGCAGCAGG - Intronic
998279204 5:140788417-140788439 GCAGCAGTGTGAGCACCAGCAGG - Exonic
998282398 5:140823899-140823921 GCAGCAGCGTGAGCACCAGCAGG - Exonic
998284323 5:140843448-140843470 GCAGCAGCGTGAGCACCAGCAGG - Exonic
998287559 5:140877599-140877621 GCAGCAGCGTGAGCACCAGCAGG - Exonic
998480568 5:142459385-142459407 GCACCATGGACAGCAGCAGGAGG - Intergenic
998692142 5:144598807-144598829 GCACCAGGGCCGGCAGCAGCGGG + Intergenic
998822400 5:146068407-146068429 GCATCAGTGGCGGCAGCTGCTGG - Intronic
998888453 5:146720090-146720112 GCATCTGAGTTAGCAGCTGCTGG + Intronic
999764524 5:154729046-154729068 GCACCATGGCCAGCAGCATCTGG - Intronic
1001005699 5:168047888-168047910 GCAGCAGCAGCAGCAGCAGCAGG + Intronic
1001293315 5:170481393-170481415 GCAGCAGCAGCAGCAGCAGCAGG - Intronic
1001466901 5:171975409-171975431 GCCTGAGGCTCAGGAGCAGCAGG - Intronic
1001593071 5:172879692-172879714 CCATCGGGGGCAGGAGCAGCTGG + Intronic
1001825202 5:174739285-174739307 GCAGCAGGATCAGGAACAGCAGG + Intergenic
1003083906 6:3045683-3045705 GCTTCAGGTGAAGCAGCAGCTGG + Intergenic
1003172589 6:3731916-3731938 ACAGCAGCCTCAGCAGCAGCAGG - Intronic
1003592838 6:7450053-7450075 AGATTAGGGTCAGCAGCAACTGG - Intergenic
1004486584 6:16072226-16072248 GCATCAGCATCAGCATCACCTGG - Intergenic
1005488025 6:26319823-26319845 GCCTCACGGTCGGAAGCAGCAGG + Intergenic
1006184264 6:32171430-32171452 GCAGCAGGAAGAGCAGCAGCAGG + Exonic
1006458646 6:34145530-34145552 GCAACAGCGGCAACAGCAGCAGG + Intronic
1006614966 6:35319951-35319973 GCAGCAGGCCCAGCAGCAGCTGG + Exonic
1006651057 6:35551945-35551967 GCCTCAGGGTCCGGAGCAGCTGG - Intergenic
1007902212 6:45422726-45422748 GCAACAGCAGCAGCAGCAGCAGG + Exonic
1008716395 6:54295096-54295118 GCAGCAGCAGCAGCAGCAGCGGG + Intergenic
1011282634 6:85691766-85691788 CCATCAGGAGCAGCAGCATCAGG - Intergenic
1011652357 6:89518285-89518307 GCCTCAGCCTCCGCAGCAGCTGG - Intronic
1012197619 6:96363474-96363496 GCCTCAGGTTCCCCAGCAGCTGG - Intergenic
1012247164 6:96938631-96938653 GCAGCAGCAGCAGCAGCAGCAGG + Intronic
1012570025 6:100712870-100712892 GCCTCAGGCTCTGCAGCAGCTGG + Intronic
1012752749 6:103184162-103184184 GCACCATGGACAGCAGCAGGAGG + Intergenic
1012815719 6:104019332-104019354 GCAGCAGCAGCAGCAGCAGCAGG - Intergenic
1013068334 6:106705029-106705051 GCATCAGCATCAGCATCACCTGG + Intergenic
1013803327 6:113970945-113970967 GCAGCAGCAGCAGCAGCAGCAGG - Exonic
1014224103 6:118828498-118828520 GCCTCAGCCTCTGCAGCAGCTGG + Intronic
1014418640 6:121214485-121214507 GCAGCAGGGTGGGCAGCTGCAGG + Intronic
1014561513 6:122896886-122896908 GTATCAGGATCATCAACAGCAGG - Intergenic
1015682623 6:135824961-135824983 GCATCAGGCTCTGGAGTAGCTGG - Intergenic
1016897369 6:149066576-149066598 ACATGAGGGTCAGTATCAGCTGG - Intronic
1017163934 6:151390824-151390846 GCAGCAGCGGCGGCAGCAGCAGG + Intronic
1018166080 6:161098318-161098340 GCAGCAGCAGCAGCAGCAGCAGG - Exonic
1018177368 6:161188950-161188972 GCATCAGGGTCAGCAGCAGCTGG - Intronic
1018321820 6:162618900-162618922 GCATCAGAGTAAGGAACAGCTGG + Intronic
1019051454 6:169186741-169186763 GTGGCCGGGTCAGCAGCAGCCGG - Intergenic
1019619163 7:1981311-1981333 GCATCAGGGGCAGCAGACGGTGG + Intronic
1019729509 7:2622534-2622556 GCAGCTGGGGCAGGAGCAGCTGG - Intergenic
1019729513 7:2622549-2622571 GCAGCTGGGGCAGGAGCAGCTGG - Intergenic
1019787479 7:2986496-2986518 GTATCACGGTCAGCACCAACAGG + Intronic
1019979157 7:4608426-4608448 GCCTCAGCCTCACCAGCAGCTGG + Intergenic
1020275414 7:6621666-6621688 GCAACAGTTTCAACAGCAGCAGG + Exonic
1021510846 7:21430258-21430280 GCTTCAGACTCAGTAGCAGCAGG - Exonic
1022567668 7:31419568-31419590 GCATCAAGGCCACCAGAAGCTGG - Intergenic
1022897141 7:34761922-34761944 GCATCAGGTTCAGCAATAACAGG - Intronic
1024232160 7:47370905-47370927 CCACCATGGTCAGCAGCTGCTGG + Intronic
1024325219 7:48104101-48104123 GCCTCAGCCTCACCAGCAGCTGG - Intronic
1025974077 7:66355788-66355810 GCCTCAGCCTCAGGAGCAGCTGG - Intronic
1029287938 7:99478967-99478989 GCATCCTGTTCAGCCGCAGCTGG + Intronic
1029317788 7:99730081-99730103 TCCACAGGGCCAGCAGCAGCAGG - Intronic
1029458319 7:100682071-100682093 CCAGCAGCGGCAGCAGCAGCAGG - Exonic
1029547320 7:101217223-101217245 GCAGCAGCGGCAGCAGCAGCAGG + Exonic
1030133349 7:106221682-106221704 GCCTCAGGCTCAGGAGTAGCTGG - Intergenic
1031174585 7:118334304-118334326 ACATCAGAGACAGCAGCAGCTGG - Intergenic
1031785477 7:126026041-126026063 GCCTCAGGCTCCGGAGCAGCTGG - Intergenic
1032794568 7:135267467-135267489 GCATCATCCTCAGCTGCAGCAGG + Intergenic
1033169016 7:139066981-139067003 GCATCAGCCTCAGCATCACCCGG - Intronic
1033801434 7:144906917-144906939 GCCTCAGCCTCCGCAGCAGCTGG - Intergenic
1033831930 7:145265394-145265416 GAATGTTGGTCAGCAGCAGCTGG - Intergenic
1034104516 7:148478761-148478783 GCCTCAGTGTCATCAACAGCAGG + Intergenic
1034224347 7:149471303-149471325 GCAGCAGCAGCAGCAGCAGCAGG + Intergenic
1034331151 7:150283229-150283251 TCATCAGTGAAAGCAGCAGCAGG - Intronic
1034666893 7:152826624-152826646 TCATCAGTGAAAGCAGCAGCAGG + Intronic
1034864713 7:154631227-154631249 CCATTCGGGTCTGCAGCAGCAGG + Intronic
1035256170 7:157629218-157629240 GCAGCAGGGTCTGCAGGAACAGG - Intronic
1036283562 8:7422628-7422650 GCAGCAGCAGCAGCAGCAGCAGG + Intergenic
1036337908 8:7888893-7888915 GCAGCAGCAGCAGCAGCAGCAGG - Intergenic
1037829480 8:22179317-22179339 GCATGAGGGGCTGCAGAAGCAGG + Intronic
1037914827 8:22766664-22766686 GTATCAGGGGCAGCAGCACCCGG + Intronic
1038617650 8:29109988-29110010 GCCTCCGAGTCAGCAGAAGCTGG + Exonic
1038667041 8:29546929-29546951 GCCTCAGGATCAGCAGCAGCAGG + Intergenic
1039587615 8:38719977-38719999 GCACCTGGGCCAGCAGCTGCTGG + Intergenic
1039898041 8:41730199-41730221 GAAGCGGGGTCAGCAGCGGCTGG - Intronic
1041277319 8:56176162-56176184 GCCTCAGCCTCCGCAGCAGCTGG + Intronic
1041715293 8:60926707-60926729 GCAGCAGCAGCAGCAGCAGCCGG + Intergenic
1042316801 8:67434712-67434734 GCAGCAGTGGCAGCAGCAGGCGG + Intronic
1043414394 8:80033046-80033068 GCAGCAGGGTGAGCAGCTACAGG + Intronic
1044339814 8:91033892-91033914 GCATCAGGCTCATGAGTAGCTGG + Intronic
1045202820 8:100002943-100002965 GCCTCAGCCTCTGCAGCAGCTGG - Intronic
1045718322 8:105074912-105074934 GCAGCAGCAGCAGCAGCAGCGGG - Intronic
1045806133 8:106164292-106164314 GAATCAGGTTCAGAAGAAGCAGG - Intergenic
1046407773 8:113797022-113797044 TCATCATCATCAGCAGCAGCAGG - Intergenic
1048078967 8:131103791-131103813 GAAACAGGGTCAGCAACAGTTGG + Intergenic
1048274467 8:133055851-133055873 GCAGCAGCAGCAGCAGCAGCAGG + Intronic
1048418109 8:134249652-134249674 TCAGCAGGGGCAGCAGCAACAGG - Intergenic
1048752628 8:137697378-137697400 GCAGCAGCAGCAGCAGCAGCAGG + Intergenic
1048952598 8:139508693-139508715 GACTTAGGGTCCGCAGCAGCAGG + Intergenic
1048980905 8:139703131-139703153 GCAGCAGCAGCAGCAGCAGCGGG + Intergenic
1049179824 8:141216509-141216531 GCCTCTTGGTCAGCAGCAGCCGG - Intronic
1049253563 8:141602289-141602311 GCATAAGTGCCAGCATCAGCTGG - Intergenic
1049362210 8:142217444-142217466 GCACCATGGACAGCAGCAGAGGG - Intronic
1049598719 8:143497388-143497410 GCAGCTGGGTGGGCAGCAGCAGG + Intronic
1050475411 9:6035231-6035253 ACATCCTGGTCAGCTGCAGCAGG - Intergenic
1051242622 9:15075778-15075800 CCATCATGGTCAGAAGCAGAAGG + Intergenic
1052764996 9:32632098-32632120 GTAGCAGGCTCAGCAGCATCAGG - Exonic
1052973096 9:34390732-34390754 GCTTCAGCCTCCGCAGCAGCTGG + Intronic
1053646431 9:40122361-40122383 GCAGCAGGGCCTTCAGCAGCAGG - Intergenic
1053759282 9:41341190-41341212 GCAGCAGGGCCTTCAGCAGCAGG + Intergenic
1054327443 9:63720263-63720285 GCAGCAGGGCCTTCAGCAGCAGG - Intergenic
1054538138 9:66253612-66253634 GCAGCAGGGCCTTCAGCAGCAGG + Intergenic
1056947111 9:91007315-91007337 GCAGCTGGGGCAGAAGCAGCTGG - Intergenic
1057111823 9:92479233-92479255 GCATCAGGAGAAGCATCAGCCGG + Intronic
1057699983 9:97356669-97356691 GAATCAGTGCCAGCACCAGCTGG - Intronic
1057801911 9:98195947-98195969 GCCCCAGGGGCAGCAACAGCAGG + Intergenic
1059382229 9:113935280-113935302 ACATCATGGCCAGCTGCAGCGGG + Intronic
1060138025 9:121176380-121176402 GCAGCAGGGCCATTAGCAGCAGG + Intronic
1060341306 9:122779420-122779442 GCTTAAGAGGCAGCAGCAGCCGG + Intergenic
1060857729 9:126928238-126928260 GCAACAGGGTCAGTGGCAACTGG - Intronic
1060995716 9:127874043-127874065 GCAGCAGCAGCAGCAGCAGCAGG + Intronic
1061028623 9:128066717-128066739 GCATGGGGGTCAGCAGCACTGGG + Exonic
1061138631 9:128751121-128751143 CCTTCAGGGCCCGCAGCAGCTGG + Exonic
1062035848 9:134382210-134382232 GCCACAGGGGCAGCAGCAGGCGG - Intronic
1062148889 9:135007342-135007364 GCTTCAGGGTGAGCCGGAGCGGG + Intergenic
1062475163 9:136723096-136723118 CCTGCAGGGACAGCAGCAGCAGG - Exonic
1062684133 9:137801265-137801287 GCACCAGGGTCAGTAGCCTCAGG - Intronic
1203662379 Un_KI270753v1:57469-57491 GCACCTGGGCCAGCAGCTGCAGG + Intergenic
1185915795 X:4034006-4034028 GCCTCAGCCTCCGCAGCAGCTGG + Intergenic
1186249198 X:7647777-7647799 ACCTCAGAGACAGCAGCAGCAGG - Intergenic
1186470344 X:9816580-9816602 GCAGCAGCAGCAGCAGCAGCAGG - Intronic
1186574207 X:10748244-10748266 GACACAGAGTCAGCAGCAGCAGG + Intronic
1187614905 X:20982121-20982143 GCATGTGCATCAGCAGCAGCAGG - Intergenic
1187647707 X:21367245-21367267 GCAGCAGCAGCAGCAGCAGCAGG - Intergenic
1187746818 X:22418240-22418262 GCCTCAGGCTCTGGAGCAGCTGG - Intergenic
1189211930 X:39290981-39291003 CCAGCAGCATCAGCAGCAGCTGG - Intergenic
1190237925 X:48631672-48631694 GCAGCAGCAGCAGCAGCAGCAGG - Intergenic
1190913264 X:54790954-54790976 GCCTCAGGCTCACCACCAGCTGG + Exonic
1190913269 X:54790969-54790991 GCACCAGGGCCAGTACCAGCTGG - Exonic
1192470830 X:71397252-71397274 GCAGCAGGCTCAGCAGCATCCGG + Exonic
1195577236 X:106464935-106464957 GCATCAGCATCAGCATCAGCTGG - Intergenic
1196047371 X:111270389-111270411 GCAGCAGCAGCAGCAGCAGCAGG - Exonic
1196950908 X:120875148-120875170 GCCTCTGGGACAGCAGCAGCAGG + Exonic
1196951747 X:120931523-120931545 GCCTCTGGGGCAGCAGCAGCGGG + Exonic
1196952431 X:120936384-120936406 GCCTCTGGGGCAGCAGCAGCGGG + Exonic
1196953116 X:120941245-120941267 GCCTCTGGGGCAGCAGCAGCGGG + Exonic
1196953801 X:120946105-120946127 GCCTCTGGGGCAGCAGCAGCGGG + Exonic
1196954486 X:120950966-120950988 GCCTCTGGGGCAGCAGCAGCGGG + Exonic
1196955169 X:120955826-120955848 GCCTCTGGGGCAGCAGCAGCGGG + Exonic
1196955856 X:120960709-120960731 GCCTCTGGGGCAGCAGCAGCGGG + Exonic
1196956538 X:120965570-120965592 GCCTCTGGGGCAGCAGCAGCGGG + Exonic
1196957220 X:120970430-120970452 GCCTCTGGGGCAGCAGCAGCGGG + Exonic
1196957902 X:120975290-120975312 GCCTCTGGGGCAGCAGCAGCGGG + Exonic
1196958584 X:120980150-120980172 GCCTCTGGGGCAGCAGCAGCGGG + Exonic
1196959265 X:120985010-120985032 GCCTCTGGGGCAGCAGCAGCGGG + Exonic
1197873877 X:131084259-131084281 GCTGCAGGGTCTGCAGCAGCAGG - Exonic
1197941597 X:131795793-131795815 GCAGCAGGTGCGGCAGCAGCTGG - Intergenic
1198022663 X:132674523-132674545 GCATCAGGGACTGCAGCAATGGG + Intronic
1198286196 X:135194432-135194454 GCAGCAGGGCCCACAGCAGCAGG - Intergenic
1198286229 X:135194568-135194590 GCAGCAGGGCCCACAGCAGCAGG - Intergenic
1198286233 X:135194583-135194605 GCAGCAGGGCCCACAGCAGCAGG - Intergenic
1198310421 X:135423234-135423256 ACATAAGGGACAGCAGGAGCAGG - Intergenic
1199840974 X:151648667-151648689 GCAGCAGCAGCAGCAGCAGCGGG - Exonic
1200857537 Y:7955324-7955346 GCATCAGTGTCATCAGGAGGAGG + Intergenic
1201149096 Y:11085633-11085655 GCAGCAGGCTCTTCAGCAGCAGG + Intergenic
1201963799 Y:19709656-19709678 CCATCAGCTTCAGCAGCAGGTGG - Exonic