ID: 1018181713

View in Genome Browser
Species Human (GRCh38)
Location 6:161228813-161228835
Sequence CTTGGCATGCTGAAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 846
Summary {0: 1, 1: 0, 2: 2, 3: 96, 4: 747}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018181713_1018181716 -9 Left 1018181713 6:161228813-161228835 CCTTCCTCCTTCAGCATGCCAAG 0: 1
1: 0
2: 2
3: 96
4: 747
Right 1018181716 6:161228827-161228849 CATGCCAAGCCAGCCTGACTTGG 0: 1
1: 0
2: 1
3: 10
4: 110
1018181713_1018181721 14 Left 1018181713 6:161228813-161228835 CCTTCCTCCTTCAGCATGCCAAG 0: 1
1: 0
2: 2
3: 96
4: 747
Right 1018181721 6:161228850-161228872 CCTTTCCTGCCTACAAATCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018181713 Original CRISPR CTTGGCATGCTGAAGGAGGA AGG (reversed) Intronic
900382343 1:2391233-2391255 CTTGGCCTGCTGCGGGAGGAGGG + Intronic
900461145 1:2802618-2802640 CTTGGCATCCTGAATTGGGAGGG - Intergenic
900749696 1:4387591-4387613 GTTCTCATGCTGAATGAGGATGG + Intergenic
900806411 1:4770801-4770823 CTTGACAGGCTGCAGGAGGGTGG + Intronic
901122382 1:6906205-6906227 CCTGGCAAGATGAGGGAGGAGGG + Intronic
901547411 1:9968829-9968851 CTTGGGAGGCTGAAGCAGGGAGG + Intronic
902928036 1:19710212-19710234 CTTGGGACGCTGAGGCAGGAGGG - Intronic
903054997 1:20629722-20629744 TTTGGGAAGCTGAGGGAGGAAGG + Intergenic
903105958 1:21080205-21080227 CTTGGAAAGCTAAGGGAGGAGGG + Intronic
903209162 1:21806584-21806606 CTTGGGAGGCTGCAGCAGGAAGG - Intergenic
903428629 1:23274155-23274177 TTTGGGAGGCTGAAGCAGGAGGG - Intergenic
903602521 1:24553252-24553274 CTTGGGAGGCTGAGGTAGGAGGG - Intergenic
904377061 1:30088316-30088338 CCTGGCCTGCAGAAGGAGCAGGG - Intergenic
904707748 1:32404296-32404318 CTTGGGAGGCTGAAGTGGGAGGG - Intergenic
904716152 1:32469086-32469108 CTTGGGAGGCTGAAGCAGGAGGG + Intronic
905436288 1:37957572-37957594 CTTGGGAGGCTGAGGCAGGAGGG - Exonic
905699079 1:39998505-39998527 CTTGGGAGGCTGAGGCAGGAAGG - Intergenic
906331790 1:44891367-44891389 TTTGGGAGGCTGAAGCAGGAAGG - Intronic
906375759 1:45295379-45295401 CTTGGGAGGCTGATGCAGGAGGG - Intronic
906394126 1:45445685-45445707 CTTGGGAGGCTGAGGCAGGAAGG + Intronic
906618592 1:47254636-47254658 CTTGGGAGGCTGAGGTAGGAGGG - Intronic
906751252 1:48263933-48263955 CTTGGGAGGCTGAGGTAGGAGGG - Intergenic
907087828 1:51693262-51693284 CTTAGGAGGCTGAAGCAGGAGGG + Intronic
907666235 1:56435978-56436000 CTTGCCAGGCTGGAGGAGGAGGG - Intergenic
907940684 1:59084306-59084328 CCTGGCATCCTGTTGGAGGAAGG + Intergenic
908598478 1:65712757-65712779 CTTGGTAGGCTGAGGCAGGAAGG + Intergenic
908876012 1:68676670-68676692 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
909636662 1:77824316-77824338 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
909838267 1:80285432-80285454 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
910260365 1:85288284-85288306 CTTGGGAGGCTGAAGCAGGAAGG + Intergenic
910891857 1:92027085-92027107 CTTGGGAGGCTGAGGAAGGATGG + Intergenic
911607487 1:99925007-99925029 CTTGGGATGCTGAGGTGGGAGGG - Intergenic
911607510 1:99925150-99925172 CTTGGGATGCTGAGGTGGGAGGG - Intergenic
911615302 1:100004407-100004429 CTTGGGAGGCTGAGGGAAGATGG - Intronic
911702134 1:100966118-100966140 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
912218086 1:107639699-107639721 CTTGGCAGGCTGAAGTGGGAGGG + Intronic
912236494 1:107856929-107856951 CTTGGCAGGCTGAGGCAGGAGGG + Intronic
912803282 1:112735242-112735264 CTTGGGAGGCTGAGTGAGGAAGG + Intergenic
912860416 1:113209208-113209230 GATGGCATGCAGAAGGAAGAGGG + Intergenic
913142676 1:115956803-115956825 CTTGGCATGTTGATGTAGCAGGG - Intergenic
914705859 1:150169305-150169327 CTTGGCTGGGTGAAGGGGGACGG - Intergenic
915199519 1:154216620-154216642 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
915298694 1:154939870-154939892 CTCAGCAGGCTGAAGGTGGAAGG - Intergenic
915305828 1:154977486-154977508 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
915536224 1:156537442-156537464 CTCAGCATGCTAAAGGAGAAAGG + Intronic
916011896 1:160713852-160713874 CTTTTCTTGCTGAAGGAGCAGGG - Intergenic
916014230 1:160734348-160734370 CTTGGCAAACAGAATGAGGATGG - Intergenic
917098435 1:171422921-171422943 CTTGGGAATCTAAAGGAGGAAGG + Intergenic
917159332 1:172040061-172040083 CTTGTCATGTGGAAGGAGGAGGG + Intronic
917207307 1:172590775-172590797 CTTGGGATGCAGATGGAGGTAGG - Intronic
917801510 1:178575078-178575100 CTTGGCATACTGAAAAAGTATGG - Intergenic
917945849 1:179969708-179969730 CTTGGGAGGCTGAAGTGGGAGGG + Intronic
918099072 1:181357848-181357870 CTTAGCATCATGAATGAGGATGG + Intergenic
918431453 1:184465011-184465033 TTTGGGAGGCTGAAGCAGGAGGG - Intronic
919172233 1:193969309-193969331 CTTGGGAGGCTCAGGGAGGATGG + Intergenic
919890729 1:201972268-201972290 TTTGGGAGGCTGAAGCAGGAAGG + Intergenic
920012846 1:202882135-202882157 TTTGGGAGGCTGAAGCAGGAGGG + Intronic
920105993 1:203554010-203554032 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
920143589 1:203839282-203839304 CTTGGGAGGCTGAAGAAGGATGG - Intronic
921086093 1:211794407-211794429 CTTGGGAGGCTGAGGTAGGAGGG - Intronic
922170469 1:223150339-223150361 CTTGGGAAGCTGAGTGAGGAGGG - Intergenic
922223220 1:223624604-223624626 CTTGGGAGGCTGAAGCAGGAGGG + Intronic
922281064 1:224124833-224124855 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
922666263 1:227471991-227472013 CTTAACATGGTGAAGCAGGAGGG - Intergenic
922944042 1:229495144-229495166 TTTGGGATGCTGAGGCAGGAGGG + Intronic
923026916 1:230211663-230211685 CTTGGGAGGCTGAAAGGGGAGGG + Intronic
923122915 1:231010132-231010154 CTTGGGAGGCTGAAGTGGGAGGG + Intergenic
923601693 1:235409241-235409263 ATTGGTAGGCAGAAGGAGGAAGG + Intronic
923669587 1:236029067-236029089 CTTGGGAAGCTGAGGCAGGAGGG + Intronic
923848154 1:237761001-237761023 CTTGGGATGGTGACAGAGGAAGG + Exonic
923853228 1:237819574-237819596 TTTGGGAGGCTGAAGGGGGATGG + Intronic
924045824 1:240029543-240029565 CTTGGAAGGCTGAGGTAGGAGGG - Intronic
924245317 1:242078337-242078359 CTTGGGAGGCTGGAGCAGGAGGG - Intergenic
924255724 1:242180873-242180895 CTTGGGAAGCTGAGGCAGGAGGG + Intronic
924373747 1:243384698-243384720 CTTGGGAGGCTGAGGTAGGAGGG + Intronic
924492845 1:244556088-244556110 CTTGGAATGCTGAAGTGGGAAGG + Intronic
1063425045 10:5944138-5944160 TTTGGGAGGCTGAGGGAGGAGGG + Intronic
1063481906 10:6383671-6383693 CTTGGGAGGCTGATGGGGGAGGG + Intergenic
1064302318 10:14133610-14133632 CTTTGCTGGCTGGAGGAGGAAGG + Intronic
1064714020 10:18156784-18156806 TTTGGGAGGCTGAAGCAGGAGGG + Intronic
1065042497 10:21711636-21711658 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1065096718 10:22287810-22287832 CTTGGAAGGCTGAAGGCAGAAGG + Intergenic
1065126784 10:22581486-22581508 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1065353479 10:24816465-24816487 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1065471298 10:26084609-26084631 CTTGGAAGGCTGAAGCAGAAGGG - Intronic
1065705752 10:28470118-28470140 CTTGGGAGGCTGAAGTAGGGAGG + Intergenic
1065857105 10:29839557-29839579 CTTAGCATGCTGAAGCTGGGAGG + Intergenic
1065949440 10:30638611-30638633 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1067065880 10:43103923-43103945 GGGGGCATGCTGAAGGCGGAAGG - Intronic
1067217604 10:44316029-44316051 GTGGCCATGCTGAAGCAGGAAGG + Intergenic
1068547001 10:58358866-58358888 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1069223645 10:65914043-65914065 CTTGGCATTTTCAAGAAGGATGG - Exonic
1069626384 10:69870418-69870440 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1069744414 10:70706105-70706127 CCTGTCATCCTGAAGGATGAGGG + Intronic
1070361308 10:75692092-75692114 CTTGGGAGGCTGAAGTGGGAGGG + Intronic
1070377875 10:75851827-75851849 CTTAGAAAGCTGAAGGAGTACGG + Intronic
1070613759 10:77952977-77952999 CATGGGAGGCTGAAGCAGGAGGG + Intergenic
1070898953 10:80011002-80011024 TTTGGGATGCTGAAGCAGGAGGG - Intergenic
1071237427 10:83665415-83665437 CTTGGGAGGCTGAGGCAGGAAGG + Intergenic
1071808987 10:89157475-89157497 CTTGGGAGGCTGAAGTGGGAAGG - Intergenic
1072597225 10:96885487-96885509 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1072720453 10:97777751-97777773 CTTGGGATGATGATGGAGGTGGG + Intergenic
1073104474 10:101024349-101024371 CTTGGAAGGCTGAGGCAGGAGGG - Intronic
1073393392 10:103197921-103197943 CTTGGGAGGCTGAAGCAGGAGGG + Intergenic
1073458238 10:103650584-103650606 CTGGCAAAGCTGAAGGAGGAAGG - Intronic
1073643911 10:105279915-105279937 TTTGGGAGGCTGAAGTAGGAGGG + Intergenic
1074124934 10:110521355-110521377 CTTGGGATGCGAAGGGAGGACGG - Intergenic
1074196594 10:111192525-111192547 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
1074509765 10:114101457-114101479 CTTGGCTTGGCGAAGAAGGAGGG - Intergenic
1074748346 10:116558300-116558322 CTTGGGAGGCTGAGGCAGGATGG - Intronic
1074969993 10:118528286-118528308 CTTGGGAAGCTGAGGCAGGAGGG - Intergenic
1075024520 10:118974775-118974797 CTTGGGAGGCTGAAGCAGAATGG + Intergenic
1075133414 10:119760329-119760351 CTTGGGAGGCTGAAGGAAGAAGG + Intronic
1075403406 10:122177459-122177481 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1075471373 10:122692676-122692698 GATGGCATGTGGAAGGAGGAAGG + Intergenic
1075888447 10:125923633-125923655 CTTGGGAGGCTGAAGCAAGAGGG - Intronic
1076180293 10:128401827-128401849 CTGGGCATGGAGCAGGAGGAGGG + Intergenic
1076565894 10:131398852-131398874 CTTGGGAGGCTGAAGCAGGAGGG + Intergenic
1077003980 11:342189-342211 TTTGGGAGGCTGAGGGAGGAGGG - Intergenic
1077127942 11:952110-952132 CTTGGGAGGCTGAAGTGGGAGGG - Intronic
1077159988 11:1108307-1108329 AAGGGCAGGCTGAAGGAGGAGGG - Intergenic
1077169670 11:1160595-1160617 CATGGCCTGCAGAAAGAGGAGGG - Exonic
1077282654 11:1752691-1752713 CTTGGGATGGGGAAGGAGGGTGG - Intronic
1077920993 11:6641597-6641619 CTTGTCATGCAGAAGGAGCTGGG - Exonic
1078045252 11:7908158-7908180 CTTCTCAAACTGAAGGAGGAAGG + Intergenic
1078200105 11:9173595-9173617 TTTGGTAAGCTGAAGGGGGAGGG - Intronic
1078383588 11:10866632-10866654 CTTGGGAGGCTGAGGGGGGAGGG + Intergenic
1078601365 11:12734025-12734047 CTTGGGAGGCTGAAGCAGGAGGG - Intronic
1078760744 11:14249340-14249362 CTCGGGATGCTAAAGGAAGATGG + Intronic
1079398322 11:20085084-20085106 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1079497887 11:21066844-21066866 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1079680492 11:23290610-23290632 CTTGGCATTCTGAAGTATCATGG + Intergenic
1080014503 11:27490432-27490454 CTTGGCATGTTAATGGAGCAAGG + Intergenic
1080295078 11:30717324-30717346 CTTGGCATGGTAAAAAAGGAGGG + Intergenic
1080326935 11:31085973-31085995 TTTGGGAGGCTGAGGGAGGAGGG - Intronic
1080709628 11:34734389-34734411 CTGAGCATGCAGAAAGAGGATGG - Intergenic
1080944516 11:36956533-36956555 CATGGGATGCTGAAGGTGGGAGG + Intergenic
1081551333 11:44115295-44115317 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1081828839 11:46087998-46088020 TTTGGGAGGCTGAAGGTGGATGG - Intronic
1082060733 11:47857923-47857945 CTTGGCAGGCAAAATGAGGAAGG - Intergenic
1082677604 11:56126775-56126797 CTAGGGCTGCTGATGGAGGATGG + Intergenic
1082858520 11:57831109-57831131 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
1083186566 11:61021237-61021259 CTTGGGAGGCTGAAGCAGGGAGG + Intergenic
1083964015 11:66031752-66031774 CTTGGGAGGCTAAAGGGGGAGGG - Intergenic
1084531034 11:69727886-69727908 CTTGGCAGGCTGTGGGAAGATGG + Intergenic
1085071193 11:73547552-73547574 CTTGGGATGCAGAGGCAGGAGGG + Intronic
1085263410 11:75222124-75222146 CTTGGGAGGCTGAGGTAGGAGGG - Intergenic
1085298984 11:75447651-75447673 AGTGGTATGCTGAAGCAGGAAGG - Intronic
1085356027 11:75837906-75837928 CTTTGGAGGCTGAAGCAGGAGGG + Intronic
1085488256 11:76887150-76887172 CTTGGGAGGCTGAGGTAGGAAGG + Intronic
1085587675 11:77726406-77726428 CTTGGGAGGCTGAGGTAGGAGGG - Intronic
1086084120 11:82937718-82937740 CATGGCCTGCAGAAGGGGGAAGG + Intronic
1086373943 11:86181578-86181600 CCTGGCATGTTGAAGGAAGATGG + Intergenic
1086383375 11:86283024-86283046 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
1086388011 11:86329415-86329437 CTTTGTATCCTGAAGGATGAAGG + Intronic
1086445634 11:86867767-86867789 CTTGGGAGGTTGAAGAAGGAGGG + Intronic
1087011742 11:93520834-93520856 CGTGACATGCTGAAGGTGAAAGG - Intronic
1087869475 11:103274249-103274271 CTTTGCATGGTCAAGGTGGAAGG + Intronic
1088214846 11:107496602-107496624 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1088453887 11:110013506-110013528 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
1088538862 11:110891903-110891925 CTGGACCTGCTGAAGAAGGAAGG - Intergenic
1088615127 11:111618553-111618575 CTGGGGAGGCTGAAGCAGGAGGG + Intronic
1088644312 11:111904543-111904565 CTTGGGAAGCTGAGGCAGGAAGG + Intergenic
1088781275 11:113136429-113136451 CTTCGCATGGTGCAGGAGCAAGG + Intronic
1089558868 11:119333414-119333436 CAGGGCAGACTGAAGGAGGACGG + Intergenic
1090078870 11:123597332-123597354 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1090179116 11:124678652-124678674 CTTGGGAGGCTGAAGTGGGAAGG - Intronic
1091129196 11:133129798-133129820 CTTGGGAGGCTGAAGCAGGAAGG + Intronic
1091212373 11:133873127-133873149 CCTGGCAAGTTGAATGAGGATGG - Intergenic
1091269138 11:134293362-134293384 TTTGGGATGGGGAAGGAGGAGGG + Intronic
1091449676 12:564733-564755 CTGGGCATGCTGAAGGTTGAGGG - Intronic
1091583511 12:1802746-1802768 CTTGGCATGAGGACAGAGGAAGG - Intronic
1091682289 12:2535596-2535618 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1091757247 12:3062085-3062107 CTAAGCATGATAAAGGAGGAAGG - Intergenic
1092611493 12:10178001-10178023 CTTGGGAGGCTGAAGCAGGAGGG - Intronic
1092624315 12:10310225-10310247 CTTGGGAGGCTGAGGCAGGAAGG - Intergenic
1092682834 12:11006488-11006510 CTTGGCAAGCTGAGGCAGGAAGG - Intronic
1093916259 12:24805554-24805576 CCAGGCAAGCTGAAGGAGGTAGG + Intergenic
1094186296 12:27646484-27646506 CTTGGGAGGCTGAGGTAGGAGGG - Intronic
1094294968 12:28895375-28895397 CGTGGCAAGCTGAAGGTGAAAGG + Intergenic
1094741906 12:33299298-33299320 CTTGGGAGGCTGAAGTAGGAGGG + Intergenic
1095250748 12:39976638-39976660 CTTGGGAGGCTGAAGCAGGAAGG - Intronic
1095262457 12:40112276-40112298 TTTGGGATGCTAAAGCAGGAGGG - Intergenic
1095394162 12:41743453-41743475 CTTGGGAAGCTGAAGCAGGAGGG - Intergenic
1095506887 12:42907751-42907773 CTTGGGAGGCTGAGGTAGGAGGG - Intergenic
1095616389 12:44194721-44194743 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1096332544 12:50726741-50726763 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1097892606 12:64793095-64793117 TTTGGGAGGCTGAAGCAGGAGGG + Intronic
1098459514 12:70716737-70716759 CTTGGAAGGCTGAGGCAGGAAGG + Intronic
1098900223 12:76104737-76104759 CTTGGGAGGCTGAGGTAGGAGGG - Intergenic
1100504533 12:95206580-95206602 CTTGGGAGGCTGAAGGTGGGTGG + Intronic
1100635382 12:96430553-96430575 CTTGGGAGGCTGAGGGAGGAGGG + Intergenic
1101347618 12:103901042-103901064 CTTTGCTGGCTCAAGGAGGATGG + Intergenic
1101946625 12:109142139-109142161 CTTGAGAGGCTGAAGCAGGAGGG + Intronic
1102288827 12:111682388-111682410 CTTGGGAGGCTGAGAGAGGAAGG + Intronic
1102879387 12:116472612-116472634 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1102978221 12:117221751-117221773 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1103221654 12:119251371-119251393 TTTGGCAAGCTGAAGGAAGCAGG + Intergenic
1103460609 12:121101800-121101822 CTTGGGAGGCTGAGGCAGGAAGG - Intergenic
1103533206 12:121616905-121616927 CTTGGCAGGCTGAGGTGGGAGGG + Intergenic
1103734732 12:123052986-123053008 CTTGGGAGGCTGAAGGGGGAGGG - Intronic
1103848520 12:123916114-123916136 CCTGGCAGGCTGAGGGAAGAGGG - Intronic
1104007306 12:124902676-124902698 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1104248414 12:127065093-127065115 CTTGCCATGGAGATGGAGGAAGG - Intergenic
1104285736 12:127423039-127423061 CTATGCATGCTGAAGTTGGATGG + Intergenic
1105208553 13:18243279-18243301 CTTGGCAGGCTGAGGCAGGAGGG + Intergenic
1105220098 13:18317738-18317760 CTTGGGAGGCTGAAGCAAGAGGG + Intergenic
1105392814 13:19996776-19996798 CTTGGGAGGCTGAAGCTGGAAGG + Intronic
1105510140 13:21044835-21044857 CATGGGATGCTGAGGCAGGAGGG - Intronic
1105796346 13:23857460-23857482 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1105874247 13:24539564-24539586 CTGGGGCTGCTGCAGGAGGAGGG - Intergenic
1106234187 13:27847864-27847886 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
1106526787 13:30547807-30547829 CTTGGGAGGCTGAAGCAGGGAGG + Intronic
1106531568 13:30597886-30597908 CTTGGAATGCTGAAAGAAAAAGG - Intronic
1106638518 13:31557958-31557980 CTTGGGAGGCTGAAGTGGGAGGG + Intergenic
1106783829 13:33087426-33087448 CTTTGCATGCTTAAGTATGAGGG + Intergenic
1107757597 13:43641638-43641660 CTCGGGAGGCTGAAGGAGAATGG - Intronic
1107966298 13:45601306-45601328 CTTGGGAGGCTGAAGCGGGAAGG + Intronic
1108025125 13:46169690-46169712 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1108128968 13:47276557-47276579 CAAGGCATGGAGAAGGAGGAAGG + Intergenic
1108584657 13:51859998-51860020 CTTGGAAGGCTGAGGAAGGAAGG - Intergenic
1109843201 13:67948485-67948507 CTTGGCCTGATGAGGGAGGCAGG - Intergenic
1110267831 13:73558487-73558509 CTTGGGAGGCTGAGGGAGGGAGG + Intergenic
1110284629 13:73735187-73735209 CTTGGGAGGCTGAAGCAGGAAGG + Intronic
1110848174 13:80213381-80213403 CTTGGAAGGCTGAGGCAGGAGGG + Intergenic
1111571915 13:90100060-90100082 CTTGGAAGGCTGAGGTAGGAGGG + Intergenic
1112036500 13:95501419-95501441 CTTGGGAGGCTGAGGCAGGAAGG - Intronic
1112478656 13:99754307-99754329 CTTGGGAGGCTGAAGTGGGAGGG + Intronic
1112531670 13:100210083-100210105 CTTGGGAGGCTAAAGAAGGAGGG - Intronic
1112596371 13:100811537-100811559 CTCGGCATGCTGAAGGCTGGGGG + Intergenic
1112668498 13:101606731-101606753 CTTGGCTCTCTGAATGAGGATGG + Intronic
1113440581 13:110325036-110325058 CTTCACATGCACAAGGAGGATGG + Intronic
1113980876 13:114274341-114274363 CTTGGGAGGCTGAAGTGGGAGGG - Intergenic
1114178175 14:20342818-20342840 CTTGGGAGGCTGAAGCAGAATGG - Intergenic
1114298944 14:21356630-21356652 CTTGGGATGCTGATGCAGGAAGG + Intronic
1114491434 14:23104669-23104691 CTTGGGATCCTGAGGGAGAAGGG - Intergenic
1114799506 14:25757497-25757519 GTTAGCATGATAAAGGAGGAAGG - Intergenic
1115403546 14:32991076-32991098 CTTGGAAGGCTGAAGCAGGAGGG - Intronic
1115482863 14:33879179-33879201 CTTGGAAGGCTGAAGTGGGAGGG + Intergenic
1115972297 14:38959307-38959329 TTTGGGATGCTGAAGCAGGAGGG + Intergenic
1116285058 14:42960121-42960143 CTTGGGAGGCTGAAGTGGGAGGG + Intergenic
1116947797 14:50852458-50852480 CTTGGCAGGATGAAGGTGTAGGG - Intergenic
1117381203 14:55165413-55165435 CTTGGGAGGCTGAAGCAGGAGGG + Intronic
1117696649 14:58371171-58371193 CTTGGAAGGCTGAGGCAGGAGGG + Intronic
1117919669 14:60716187-60716209 CTTGGGAGGCTGAAGTGGGAGGG - Intronic
1118040559 14:61911457-61911479 ATTGCCTTGCTGAATGAGGATGG - Intergenic
1118567763 14:67161047-67161069 TTTGGGATGCTGAAGCAGGCAGG + Intronic
1118633008 14:67723339-67723361 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1118715828 14:68559486-68559508 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1118765506 14:68906878-68906900 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1118779460 14:68997419-68997441 CTTGGGAGGCTGAGGTAGGAGGG - Intergenic
1118800391 14:69184352-69184374 CTGGGCCTGCTGGAGGTGGAGGG - Intergenic
1118830519 14:69427108-69427130 CTTGGGAGGCTGAGGTAGGAGGG - Intronic
1119232185 14:72989033-72989055 CTTGGGATGCTGAGGCAGAATGG - Intronic
1119303050 14:73585895-73585917 CTTGGGAGGCTGAGGCAGGAAGG + Intergenic
1119468282 14:74876681-74876703 CTTCTCAAGCTGAAGGAGGAGGG - Intergenic
1119663946 14:76470933-76470955 TTTGGGAGGCTGAAGCAGGAGGG - Intronic
1120002842 14:79323139-79323161 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1120509586 14:85397264-85397286 CTTGGCAATGTGAGGGAGGAGGG - Intergenic
1120531229 14:85633690-85633712 CTTGGGAGGTTGAAGCAGGAGGG + Exonic
1120815618 14:88854788-88854810 CTTGGGAGACTGAAGCAGGATGG - Intronic
1120931583 14:89854403-89854425 CTTAGTATCCTGAATGAGGAGGG - Intronic
1121088725 14:91166725-91166747 CTTGGCAGGCTGAAGCCGGAGGG + Intronic
1121409268 14:93737969-93737991 CAGGGGATGCTGAGGGAGGAAGG + Intronic
1122218191 14:100218216-100218238 CTTGGCAAGCAGAAGGGGCACGG - Intergenic
1122491602 14:102120119-102120141 TTTGGGAGGCTGAAGCAGGAGGG + Intronic
1123756417 15:23400752-23400774 CTTGGGAGGCTGAGTGAGGAGGG + Intergenic
1125376744 15:39038266-39038288 CATGGCATACTGAATGAGCAGGG - Intergenic
1125431467 15:39599031-39599053 CTTGGGAGGCTGAGGCAGGAGGG - Exonic
1125987871 15:44073024-44073046 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1126045460 15:44635496-44635518 CTGGGGATGCTGAGGCAGGAGGG + Intronic
1126396510 15:48224038-48224060 CTGGCCATGCTCAAGGAGAAGGG - Intronic
1126752976 15:51895998-51896020 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1126876378 15:53045945-53045967 CTTGGGAGGCTGAGGGAGGCAGG - Intergenic
1127503507 15:59576632-59576654 TTTGGGAGGCTGAAGCAGGAGGG + Intergenic
1127869902 15:63063107-63063129 CTTTATATCCTGAAGGAGGAGGG + Intronic
1128003053 15:64212008-64212030 CTTGTCATTGTGAAGGAAGAAGG + Intronic
1128071032 15:64797360-64797382 CTTGGGAGGCTGAGGCAGGAAGG - Intergenic
1128109310 15:65066910-65066932 CCTGGCTGGCTGAAGGAGGGAGG - Intronic
1128115881 15:65105069-65105091 CTTGGGATGCTGAGGTGGGAGGG + Intronic
1128299983 15:66560577-66560599 CTGGGAATTTTGAAGGAGGAAGG - Intronic
1128950214 15:71871572-71871594 CTTGGGATGCTGAGGTGGGAGGG + Intronic
1129006607 15:72378909-72378931 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
1129084011 15:73069059-73069081 CTTGGGAGGCTGAAGGGGGGAGG - Intronic
1130978184 15:88793105-88793127 CTTGGCATGCAGAGGGGGCAGGG + Intergenic
1131416184 15:92260646-92260668 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1132085554 15:98905554-98905576 CTTGGGAGGCTGAGGTAGGAGGG + Intronic
1133213648 16:4277245-4277267 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
1133342835 16:5048134-5048156 CTTGGTAGGCTGAGGCAGGAAGG - Intronic
1133485907 16:6218200-6218222 CCTGGCATACTCAAGGAGAATGG - Intronic
1134002957 16:10796945-10796967 CTTGGGAGGCTGAGGCAGGAAGG + Intronic
1134063832 16:11214108-11214130 CTTGGGAGGGTGAAGCAGGAGGG + Intergenic
1134237940 16:12482407-12482429 CTTGGGAGGCTGAAGCAAGAGGG - Intronic
1134255742 16:12609980-12610002 CTTGGGAGGCTGAGGGAGGATGG - Intergenic
1134776610 16:16859006-16859028 CTCGGGAGGCTGAAGCAGGAGGG - Intergenic
1135107386 16:19662093-19662115 CTTGGCAGGCTGAAGTGGGAGGG + Intronic
1136251865 16:29010652-29010674 CTTGGAAAGCTGAGGCAGGAGGG + Intergenic
1136463368 16:30425699-30425721 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1136527752 16:30843451-30843473 CTTGGGAGGCTGAGGTAGGAGGG + Intronic
1137376836 16:47958990-47959012 CTTGAGAGGCTGAAGTAGGAGGG - Intergenic
1137759306 16:50927681-50927703 CTTGGGAGGCTGAGGGAGGCAGG - Intergenic
1138273323 16:55711904-55711926 CTTGTCATGCTGGAGGAGCATGG + Intergenic
1138438712 16:57021465-57021487 CTTGGGAGGCTGAAGTGGGAAGG - Intronic
1138447513 16:57073699-57073721 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1138671387 16:58617899-58617921 CTTGGGCTGCTGTGGGAGGATGG + Intronic
1139268427 16:65660625-65660647 CTTGGCAGGCTCAGGGAAGAGGG - Intergenic
1139354956 16:66362012-66362034 TTTGGGTTGCAGAAGGAGGAAGG + Intergenic
1139407853 16:66733595-66733617 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1139557427 16:67721212-67721234 CTGGGCATCCTCATGGAGGAAGG + Intergenic
1139613674 16:68076211-68076233 CTTGGCAGGCGGAATCAGGATGG + Intronic
1139787018 16:69401587-69401609 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1140733826 16:77880262-77880284 CTTGGGAGGCTGAAGCAGGAGGG - Intronic
1141571804 16:84938638-84938660 TTTGGGAGGCTGAAGCAGGAGGG + Intergenic
1203143820 16_KI270728v1_random:1786438-1786460 TTTGGGAGGCTGAAGCAGGAGGG - Intergenic
1142503141 17:345169-345191 CTTGGGAGGCTGAGGTAGGAGGG + Intronic
1142537031 17:625352-625374 CTTGGGTGGCTGAAGCAGGAGGG + Intronic
1143088215 17:4432913-4432935 CTTGGGAGGCTGAGGTAGGAAGG - Intergenic
1145833946 17:27939647-27939669 CTGAGCATGCTGAATGAGGGTGG + Intergenic
1145918048 17:28588267-28588289 CATGGCATGCTGATGGAGAATGG + Intronic
1145985120 17:29040769-29040791 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1146067701 17:29649492-29649514 CTTGGAAAGCTGAGGGAGGTGGG - Intronic
1146099112 17:29961694-29961716 CTTGGGAAGCTGAGGTAGGAGGG - Intronic
1146421105 17:32686755-32686777 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1146657620 17:34644273-34644295 CTGGGCATTGTGAAGGAGAAAGG + Intergenic
1146832222 17:36080014-36080036 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
1147918540 17:43902468-43902490 CTAGGCAGGCTGAAAGAGGCAGG + Intronic
1148031817 17:44627323-44627345 CTTCACTTGCTGAGGGAGGAAGG + Intergenic
1148136578 17:45296415-45296437 CTTGGGAGCCTGAAGCAGGAGGG + Intronic
1148249141 17:46059509-46059531 CTTGGAAGGCTGAGGCAGGAAGG + Intronic
1148525362 17:48327731-48327753 CTTGGGAGGCTGAGGGAGGACGG - Intronic
1148622322 17:49043875-49043897 CCTTGCATCCTCAAGGAGGAAGG - Intronic
1149464988 17:56871036-56871058 CTCGGGAGGCTGATGGAGGAGGG + Intergenic
1150433005 17:65133576-65133598 CTTGGGAGGCTGAATGAGGCAGG - Intergenic
1151446867 17:74172070-74172092 CTTGGGAGGCTGAAGTAGGAGGG + Intergenic
1151530291 17:74699896-74699918 CTTGGGAGGCTGAAGTAGGCAGG + Intronic
1151678887 17:75613831-75613853 CTGGGCTTGGAGAAGGAGGAGGG - Intergenic
1151989836 17:77567260-77567282 CTTTGCATGCAGGAGGAGGCTGG - Intergenic
1152123111 17:78430986-78431008 CTTGGGAGGCTGAAGTGGGAGGG - Intronic
1152228106 17:79102006-79102028 CTTGGCAGCCTCAGGGAGGAGGG - Intronic
1152615476 17:81335981-81336003 CTGGGCATGCTCAAGGAGGGCGG - Intergenic
1153038300 18:785827-785849 CTTGGGAGGCTGAAGTAGGGAGG + Intronic
1153283402 18:3435302-3435324 CTTGGGAGGCTGAGGCAGGAAGG - Intronic
1153460564 18:5328276-5328298 CTCGGGAGGCTGAAGCAGGAGGG + Intergenic
1153955095 18:10089343-10089365 CTGGGCTTGATGAAGGAGTAAGG + Intergenic
1153970125 18:10218554-10218576 CCTGACAGGCTGAAAGAGGAGGG + Intergenic
1155308094 18:24498668-24498690 CTTGGCCTGCCGAGGGTGGAGGG + Intergenic
1155309591 18:24510617-24510639 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1155416268 18:25602923-25602945 CTTGACATAATAAAGGAGGAAGG + Intergenic
1155503887 18:26514308-26514330 CTTGGGAGGCTGAAGTAGGAGGG + Intronic
1155641696 18:28025273-28025295 TTTGGCAGGCTGAGGCAGGAGGG + Intronic
1156668110 18:39433118-39433140 TTTGGCATACTGAAGCAGTATGG - Intergenic
1157078540 18:44495707-44495729 CCAGCCATTCTGAAGGAGGAAGG - Intergenic
1157398386 18:47364101-47364123 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1157487717 18:48100441-48100463 ATTAGCAAGCTGGAGGAGGAAGG - Intronic
1158411807 18:57212197-57212219 CCTGGCATGATGAAGGAGCATGG - Intergenic
1158513196 18:58109676-58109698 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1158561311 18:58516109-58516131 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1158744545 18:60184295-60184317 ATTGGAATCCTGAAAGAGGAGGG - Intergenic
1159279349 18:66265321-66265343 TTTGGCCTACTGAAGTAGGAAGG - Intergenic
1159362821 18:67427352-67427374 GTAGGAATGCAGAAGGAGGAAGG - Intergenic
1160303439 18:77707048-77707070 CTTACTATGCTGAAGGATGAAGG - Intergenic
1160400314 18:78605964-78605986 CTTAGGATGCAGAGGGAGGATGG - Intergenic
1161386306 19:3995397-3995419 CTTGGGATGCTGAGGCAGGAGGG + Intergenic
1161692090 19:5741769-5741791 TTTGGGATGCTGAAGGCGGGGGG + Intronic
1161717937 19:5887246-5887268 TTTGGGAGGCTGAAGCAGGAGGG + Intronic
1162224651 19:9210362-9210384 TTTGGGAGGCTGAAGCAGGAGGG + Intergenic
1162226211 19:9225010-9225032 CTTGGAATGCTTAGGGATGAAGG + Intergenic
1162295109 19:9807970-9807992 CTTGGGAGGCTGAAGTAGGATGG + Intergenic
1162355367 19:10180202-10180224 CTTGGGAGGCTGAGGCAGGAGGG + Exonic
1162359577 19:10210460-10210482 CCTGGCAGGCAGAAGGAGGCTGG - Intronic
1162419175 19:10556178-10556200 CTTGGGAGGCTGAGGTAGGAGGG - Intronic
1162749693 19:12821307-12821329 CTTGGGAGGCTGAAGGTGGGAGG - Intronic
1162832697 19:13296865-13296887 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1162973199 19:14193477-14193499 CTGGGAAGGCTGAAGGGGGAGGG + Intronic
1164514099 19:28919523-28919545 CTTGGCAGGCTGAGGTGGGAGGG + Intergenic
1164960465 19:32424210-32424232 CTTGGGAAGCTGAGGCAGGAGGG + Intronic
1165280768 19:34795380-34795402 CTTGGAAGGCTGAGGCAGGAGGG - Intergenic
1165571239 19:36776495-36776517 CTCGGGAGGCTGAAGCAGGAGGG - Exonic
1165798930 19:38536043-38536065 CTGGGCATGGTGAATGAGGATGG + Exonic
1165885930 19:39078312-39078334 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1166687182 19:44802385-44802407 TTTGCCATGATGAAGCAGGAGGG - Intergenic
1167176543 19:47868383-47868405 CTTGGAAGGCTGAGGCAGGAGGG + Intergenic
1167653658 19:50748822-50748844 CTTGGGAGGCTGAGGTAGGAGGG - Intergenic
1168644951 19:58053822-58053844 CTTGCCATGCTCAGTGAGGACGG - Exonic
925170420 2:1746794-1746816 GTTGGGATGCTGCAGGTGGATGG - Intergenic
925450749 2:3967468-3967490 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
926200074 2:10788546-10788568 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
926289728 2:11518990-11519012 CTTGGGAGGCTGAGGCAGGATGG + Intergenic
926290824 2:11528607-11528629 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
926650476 2:15338765-15338787 TTTGGGAGGCTGAAGCAGGAGGG + Intronic
926895148 2:17678666-17678688 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
927929297 2:27033914-27033936 CTTGGACTGCTTAAGGAGCAGGG - Intronic
928017827 2:27674945-27674967 TTTGGGAGGCTGAAGGGGGATGG - Intronic
929160616 2:38828613-38828635 CTCGGCAGGCTGAGGTAGGAGGG + Intronic
929167685 2:38900082-38900104 CTTGGGAGGCTGAGGTAGGAAGG + Intronic
929477658 2:42268542-42268564 CTTGGAAGGCTGAGGCAGGAGGG - Intronic
929575961 2:43051902-43051924 CTTGGGAGGCTGAAGTGGGAGGG + Intergenic
929682225 2:44003324-44003346 CTTGGGAGGCTGAGGTAGGAGGG - Intergenic
929754186 2:44750262-44750284 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
930479281 2:51926451-51926473 CTTGCCATGTTGAAGCTGGAGGG - Intergenic
930819885 2:55634995-55635017 CTTGGAAGGCTGAAGTGGGAAGG - Exonic
930967178 2:57343574-57343596 CTTGGGAGGCTGAGGGTGGATGG + Intergenic
931215459 2:60238426-60238448 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
931250690 2:60528471-60528493 CTGGGCATATTGAAGGAGCACGG - Intronic
931285766 2:60830338-60830360 CATGCCAGGCAGAAGGAGGAAGG + Intergenic
931420252 2:62120828-62120850 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
932630280 2:73336023-73336045 CTTGGAAGGCTGAGGCAGGAAGG + Intergenic
932769121 2:74490642-74490664 ATTGGCTTCCTGAAGGACGAAGG - Exonic
933087765 2:78077202-78077224 TTTGGGAGGCTGAAGTAGGAGGG - Intergenic
933481393 2:82861382-82861404 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
933665511 2:84961362-84961384 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
933792670 2:85895562-85895584 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
934183947 2:89654751-89654773 CTTGGGAGGCTGAAGCAAGAGGG - Intergenic
934294237 2:91728916-91728938 CTTGGGAGGCTGAAGCAAGAGGG - Intergenic
934876232 2:97923512-97923534 CTTGAGAGGCTGAGGGAGGAGGG + Intronic
935729044 2:106049753-106049775 TTTGGGAGGCTGAAGGAGGGGGG + Intergenic
937157122 2:119728919-119728941 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
937305407 2:120867595-120867617 CTGGGTAAGTTGAAGGAGGACGG + Intronic
937332305 2:121039091-121039113 CTTCCCAGGCTGTAGGAGGAAGG - Intergenic
938014509 2:127856480-127856502 CTTGGGAGGCTGAGGCAGGATGG + Intronic
938097968 2:128475614-128475636 CTTGGCAGGGAGCAGGAGGAGGG + Intergenic
939524568 2:143276688-143276710 CTTGGGAGGCTGAGGCAGGAAGG + Intronic
939983347 2:148806596-148806618 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
940368343 2:152873735-152873757 ATTGGGAAGCTGAAGCAGGAGGG + Intergenic
940746957 2:157578008-157578030 CTTGGGAAGCTGAGGCAGGAGGG - Intronic
940916034 2:159257107-159257129 CTTGGGATGCTGAGGTGGGAAGG - Intronic
941071648 2:160961343-160961365 TTTGGGATGATGAAGCAGGAGGG + Intergenic
941101233 2:161297836-161297858 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
941495467 2:166195938-166195960 CTTGGGAGGCTGAGGCAGGAGGG + Exonic
941732819 2:168936994-168937016 CTTAGCATGCTGGGGCAGGAGGG - Intronic
941986821 2:171518629-171518651 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
942339515 2:174929171-174929193 TTTGGCATGCTGAAGGTTAATGG - Intronic
942887693 2:180947691-180947713 CTTGGCAAACTGAAGCAGGCAGG + Intergenic
943656877 2:190519327-190519349 CTTGGGAGGCTGAAGTGGGAGGG - Intronic
944237047 2:197450415-197450437 TTTGGAATGCTGAGGCAGGAGGG - Intergenic
944794013 2:203163573-203163595 TTTGGGAGGATGAAGGAGGAAGG - Intronic
944815223 2:203369456-203369478 GTTAGCAAGCTCAAGGAGGAAGG + Intronic
944875018 2:203954479-203954501 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
944937234 2:204582014-204582036 TTTGGCATGCAGAAGGAGCTTGG + Intronic
945489183 2:210434775-210434797 CATAGGATGCCGAAGGAGGAGGG - Intronic
945725384 2:213467540-213467562 ATAGGCATGCTAAGGGAGGAGGG + Intronic
946133853 2:217629264-217629286 CTAGGCATGATGATAGAGGATGG - Intronic
947017377 2:225636397-225636419 CTTGGCATCCTGAAGGAGATGGG - Intronic
947211445 2:227712159-227712181 TTTGGGAAGCTGAAGCAGGAGGG + Intronic
947355996 2:229296186-229296208 CTTGGGAGGCTGAAGTGGGAAGG - Intergenic
947746124 2:232508210-232508232 CTGGGTAGGCTGAGGGAGGAGGG + Intergenic
948147956 2:235722625-235722647 GATGTCATGCTGGAGGAGGATGG - Intronic
948318762 2:237052309-237052331 TTTGACAGGCTGAAGGAAGAAGG + Intergenic
1169068700 20:2708610-2708632 CTTGGAAGGCTGAGGCAGGAAGG + Intronic
1169116152 20:3067314-3067336 CCTGGCATGTTCAAGGAGCAAGG - Intergenic
1169477745 20:5947941-5947963 CTTGGGAGGCTGAAGCAGGAGGG + Intronic
1170522661 20:17204073-17204095 CTTAGCATGCTGAAGGACTTTGG + Intergenic
1170531328 20:17295655-17295677 CTTGGAAGGCTGAGGCAGGAGGG - Intronic
1170632377 20:18076570-18076592 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1170837605 20:19897954-19897976 TTTGGGAGGCTGAAGCAGGAGGG - Intronic
1171292948 20:23993097-23993119 CTTGGCAGGCTGAGGCAGGAAGG + Intergenic
1171573348 20:26274729-26274751 CTTGGGAGGCTGAGGTAGGAGGG + Intergenic
1172301461 20:33853264-33853286 CTGGGCCTGCTGGAGGCGGAGGG + Intronic
1172737617 20:37139739-37139761 CTTGGGAAGCTGAGGCAGGAGGG - Intronic
1172785781 20:37467691-37467713 CTTGGGAGGCTGAAGTGGGAGGG + Intergenic
1173492839 20:43497281-43497303 CTTGGGAGGCTGGAGCAGGAGGG + Intergenic
1174022594 20:47542852-47542874 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1174488787 20:50877614-50877636 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1174589751 20:51635627-51635649 CTTGGGAGGCTGAGGCAGGAAGG + Intronic
1174749511 20:53097740-53097762 CATGGAGTGGTGAAGGAGGAAGG - Intronic
1174828214 20:53788447-53788469 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
1174885118 20:54325450-54325472 ATTGGCTTTCTTAAGGAGGAAGG + Intergenic
1177013348 21:15754588-15754610 CTTTGCATTATGAAGGAGAATGG + Intronic
1177143974 21:17387902-17387924 CTTGGGAGGCTGAAGTGGGAGGG - Intergenic
1177383055 21:20370738-20370760 TTTGGGATTCTAAAGGAGGAAGG - Intergenic
1177823470 21:26057566-26057588 CTTGGCAAGGTGAACAAGGATGG + Intronic
1178136519 21:29633801-29633823 CTAGGGATGCTGAAGAATGAGGG + Intronic
1178478330 21:32956963-32956985 CTTGGGAGGCTGAAGTGGGAGGG + Intergenic
1178831217 21:36058391-36058413 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1178950808 21:36983941-36983963 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1179323448 21:40315889-40315911 ATTGGCAAGCAAAAGGAGGAGGG + Intronic
1180185462 21:46137035-46137057 CTTGGCTTCCTGCAGGAGGCTGG + Exonic
1180616235 22:17129939-17129961 CTTGGAAGGCTGAGGCAGGAGGG - Intronic
1180767709 22:18356062-18356084 CTTGGCAGGCTGAGGCAGGAGGG - Intergenic
1180778599 22:18506328-18506350 CTTGGCAGGCTGAGGCAGGAGGG + Intergenic
1180811324 22:18763636-18763658 CTTGGCAGGCTGAGGCAGGAGGG + Intergenic
1180824007 22:18850811-18850833 CTTGGCAGGCTGAGGCAGGAAGG + Intronic
1180929368 22:19578544-19578566 CTGGGAATGCTGAAGCAGGAGGG + Intergenic
1180971394 22:19817940-19817962 CTTGGCATGCGGGAGGCTGAGGG + Intronic
1181124434 22:20693964-20693986 CTTGGCAGGCTGAGGCAGGAGGG + Intergenic
1181188730 22:21123737-21123759 CTTGGCAGGCTGAGGCAGGAAGG - Intergenic
1181197476 22:21197891-21197913 CTTGGCAGGCTGAGGCAGGAGGG + Intergenic
1181210468 22:21286756-21286778 CTTGGCAGGCTGAGGCAGGAAGG + Intergenic
1181399041 22:22640135-22640157 CTTGGCAGGCTGAGGCAGGAAGG - Intergenic
1181471526 22:23143181-23143203 TTTGGGAGGCTGAAGGGGGAGGG + Intronic
1181501771 22:23319481-23319503 CTTGGCAGGCTGAGGCAGGAAGG - Intergenic
1181650380 22:24255924-24255946 CTTGGCAGGCTGAGGCAGGAAGG + Intergenic
1181707000 22:24654814-24654836 CTTGGCAGGCTGAGGCAGGAAGG - Intergenic
1181993608 22:26857406-26857428 CTTGGCTTGGTTAAGGATGAAGG + Intergenic
1182098263 22:27640195-27640217 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1182207444 22:28643212-28643234 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1182228710 22:28820160-28820182 CTTGGGAGGCTGAAGTGGGATGG + Intergenic
1182521752 22:30888618-30888640 CTTGGGAGGCTGAAGTGGGAGGG + Intronic
1182655761 22:31888655-31888677 CTTGGGAGGCTGAGGCAGGAAGG - Intronic
1182805377 22:33065452-33065474 CCTTACGTGCTGAAGGAGGAGGG + Intergenic
1182919541 22:34066650-34066672 CTTGGGATGCTGAGACAGGAGGG + Intergenic
1183407417 22:37637212-37637234 CTTGGCAAGCTGAATAATGATGG + Intronic
1183478135 22:38047328-38047350 CTTGGAAGGCTGAGGTAGGAGGG + Intergenic
1183579494 22:38715424-38715446 CTGGGCCTGCAGAAGGAGGAAGG - Intronic
1183725994 22:39590018-39590040 CTGGGCCTGCAGAAGGAGGGTGG + Intronic
1183759569 22:39803917-39803939 TTTGGGAGGCTGAAGCAGGAGGG + Intronic
1184125873 22:42486651-42486673 CTTGGGAGGCTGAAGCAGGATGG + Intergenic
1184509327 22:44923901-44923923 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1185265160 22:49898106-49898128 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1203216478 22_KI270731v1_random:8674-8696 CTTGGCAGGCTGAGGCAGGAAGG - Intergenic
1203229324 22_KI270731v1_random:96945-96967 CTTGGCAGGCTGAGGCAGGAGGG - Intergenic
1203274148 22_KI270734v1_random:76714-76736 CTTGGCAGGCTGAGGCAGGAAGG + Intergenic
949477773 3:4465365-4465387 CTTGGGAGGCTGAGGCAGGAAGG + Intronic
949573155 3:5312598-5312620 CTTTCCATGCAGAAGGAGGAAGG - Intergenic
949586100 3:5439319-5439341 CGTGACATCCTGAAGGAGGATGG + Intergenic
949706726 3:6826934-6826956 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
950150573 3:10683902-10683924 CTTGGGAGGCTGAGGCAGGAAGG - Intronic
950280703 3:11705363-11705385 CTTGGCAGGCAGAGAGAGGAGGG + Intronic
950538716 3:13597172-13597194 TTTGGGAGGCTGAAGCAGGAGGG - Intronic
950821857 3:15768545-15768567 CTCGGCAGGCTGAGGTAGGATGG + Intronic
951224998 3:20110563-20110585 TTTGGCAGGCTGAGGTAGGAGGG + Intronic
951512600 3:23520748-23520770 CTTGGGAGGCTGAGGTAGGAGGG - Intronic
951514196 3:23540169-23540191 CTCGGGAGGCTGAAGCAGGAGGG - Intronic
951553263 3:23896227-23896249 CTTGTCCGGGTGAAGGAGGATGG - Intronic
951601841 3:24385448-24385470 TTGTGCATGCTGAAGGAGCAAGG + Intronic
951850795 3:27138040-27138062 GGAGGGATGCTGAAGGAGGATGG + Intronic
952011922 3:28909459-28909481 CTTGGCATACTTGAGAAGGAGGG - Intergenic
952421499 3:33135519-33135541 CTTGGAAGGCTGAAGGAGTCTGG + Intronic
952723246 3:36555361-36555383 CTTGGAAGGCTGAGGCAGGAGGG + Intergenic
952777641 3:37061496-37061518 CTTGGGAAGCTGAGGCAGGAGGG - Intronic
952832484 3:37576709-37576731 CTCGGGAGGCTGAGGGAGGATGG - Intronic
952907671 3:38153194-38153216 CTTGGCAAGATGAAGGGAGAAGG - Intergenic
953063745 3:39450386-39450408 CTTGGAAGGCTGAAGTGGGAGGG - Intergenic
953163276 3:40441916-40441938 CTTGGAAGGCTGAGGCAGGAGGG + Intergenic
953861772 3:46550497-46550519 CTTGGGAGGCTGAGGCAGGAAGG - Intronic
954023632 3:47764276-47764298 CTTGGGAGACTGAAGTAGGAGGG - Intronic
954274392 3:49532939-49532961 AGTGGCATGCTGGAGGAGGGTGG - Exonic
954545138 3:51427738-51427760 CTTGGGATGCTGAGACAGGAGGG - Intronic
954976405 3:54699277-54699299 CATGGGATGCTGGAGGAGCAAGG + Intronic
956089373 3:65649272-65649294 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
956162709 3:66371852-66371874 TTTGGGAGGCTGAAGCAGGAGGG + Intronic
956356987 3:68404687-68404709 CTTGGGAGGCTGAGGAAGGAGGG + Intronic
956458945 3:69452331-69452353 ATTGGCATGCTTAAGTAGAAAGG + Intronic
956665058 3:71634179-71634201 CTTGGGAGGCTGAGGCAGGACGG - Intergenic
956800905 3:72757495-72757517 CTTGGGAAGCTGAGGCAGGAGGG - Intronic
956946792 3:74232463-74232485 CTTTGCATGGTGGAGGAAGAGGG + Intergenic
957025186 3:75173632-75173654 GGAGGCAAGCTGAAGGAGGAAGG + Intergenic
957333233 3:78793012-78793034 CTTGGCAGGCTGAGGCAGGAGGG + Intronic
957846591 3:85744701-85744723 CTTGCCATGCTTAAGGAGCAAGG + Intronic
958104780 3:89057864-89057886 CTTGGAAGGCTAAAGCAGGAGGG - Intergenic
959234188 3:103696964-103696986 CTTGGGATGCTGTATGAGGAAGG + Intergenic
960722943 3:120642409-120642431 CTGGGCATGTGGAATGAGGAGGG + Intronic
961079480 3:124013789-124013811 CTTGGCATGGTGAGGGAGTGAGG + Intergenic
961170561 3:124794965-124794987 CTTGTCATGCTGGATGATGAGGG - Intronic
961266772 3:125649318-125649340 CTTAGGAGGCTGAAGAAGGAGGG + Intergenic
961521035 3:127467473-127467495 CCAGGCAAGCTGCAGGAGGAAGG - Intergenic
961902936 3:130231990-130232012 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
962035608 3:131648262-131648284 CTTGGGAGGCTGAAGGTGGGAGG + Intronic
962799126 3:138874871-138874893 CTTGGGAGGCTGAGGTAGGAGGG + Intergenic
963149647 3:142032209-142032231 CTTGGGAGGCTGAAGTGGGAGGG - Intronic
964019361 3:151989629-151989651 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
964049672 3:152375080-152375102 CTTGGGAGGCTGAAGAAGGAAGG - Intronic
965602096 3:170465479-170465501 CTTGGCATGCTTTAGGATTATGG - Exonic
965785476 3:172330471-172330493 CTTGGCATTTTAAAAGAGGAAGG - Intronic
966162426 3:176982794-176982816 CTTGGGAGGCTGAAGTGGGAGGG - Intergenic
966740790 3:183231560-183231582 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
966774428 3:183531552-183531574 CTTGGGAGGCTGGAGGAGAATGG - Intronic
966974797 3:185074302-185074324 ATGGGCATGCTGGAGGAGGATGG - Intergenic
967266031 3:187693019-187693041 CTTGGGATGCTGAGGAGGGAGGG + Intergenic
967981501 3:195068686-195068708 CTTGGGAGGCTGAAGTGGGAGGG - Exonic
968244126 3:197124682-197124704 TTTGGCAGGCTGAGGCAGGAGGG - Intronic
969272593 4:6112989-6113011 CTTGGGATCCTGAAGGAAGGAGG + Exonic
969568816 4:7996026-7996048 CTGGGCATGAAGGAGGAGGAAGG - Intronic
969723939 4:8908193-8908215 CCTGGCATGATGAAGGAACATGG - Intergenic
971114904 4:23633663-23633685 CTTGGGAAGCTGAGGCAGGAGGG + Intergenic
971326484 4:25648491-25648513 CTTGGAATGATGAAGGAAGTTGG + Intergenic
971425094 4:26508087-26508109 CTTGGGATGCTGAGGAAGGAGGG - Intergenic
971594363 4:28509851-28509873 CTTGGGAGGCTGAGGCAGGAAGG - Intergenic
972258897 4:37388289-37388311 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
972389207 4:38597282-38597304 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
972792254 4:42384280-42384302 CTTGGGAGGCTGAGGGAGTAAGG - Intergenic
972840058 4:42920201-42920223 ATTGGCAAGGTGAAGGATGAAGG + Intronic
973236162 4:47908314-47908336 CTTGGGAGGCTAAAGCAGGAGGG + Intronic
974040392 4:56852392-56852414 CTTGGCAGGCTGAAGCAGAGAGG - Intergenic
974083372 4:57235057-57235079 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
974310092 4:60194682-60194704 CTTGGGAAGCTGAGGCAGGAGGG - Intergenic
974323058 4:60377119-60377141 CTTGGGAGGCTGAGGTAGGAGGG - Intergenic
974444722 4:61965103-61965125 CTTGGGAGGCTGAAGAGGGAGGG - Intronic
975382384 4:73716597-73716619 ATTGGTTTGCTGAAGGAAGAGGG - Intergenic
975572262 4:75829960-75829982 TTTGGGAGGCTGAAGCAGGAGGG - Intergenic
975713247 4:77181262-77181284 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
976101724 4:81571276-81571298 CTTGGGATGCTGAGTCAGGAGGG + Intronic
976244091 4:82990150-82990172 CATGGCATTCTGAAGGAGGAAGG - Intronic
978834154 4:113127653-113127675 CTTGGCATGATCAAAGTGGAAGG + Intronic
979000113 4:115206833-115206855 CTTGGGAGGCTGAAGTGGGAAGG - Intergenic
979027153 4:115592159-115592181 CTTTGCATCCACAAGGAGGAGGG + Intergenic
980721376 4:136700025-136700047 TTTGGGAGGCTGAAGCAGGAGGG + Intergenic
980802110 4:137765363-137765385 CATGGGATGCTGAAAGTGGATGG + Intergenic
981302499 4:143204495-143204517 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
981583224 4:146271776-146271798 CTTGGCATGTTGGAGGAAGGAGG - Intronic
981971999 4:150674765-150674787 CTTGGGAGGCTGAAGGAGGAGGG + Intronic
982235008 4:153243924-153243946 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
982660852 4:158205036-158205058 TTTGGGAGGCTGAAGGAGGAAGG + Intronic
982710466 4:158753561-158753583 CTTGGGAAGCTGAGGCAGGAGGG + Intergenic
982943569 4:161589558-161589580 CTTGGGTGGCTGAAGCAGGAGGG - Intronic
983568275 4:169177017-169177039 CTTGGCATTCTTTAGGAGGCTGG + Intronic
984216983 4:176926006-176926028 TCTGGCATCCTAAAGGAGGAAGG - Intergenic
984251951 4:177346272-177346294 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
984314005 4:178102823-178102845 CTTGGCAGGCTGAGGCAGAATGG - Intergenic
984402893 4:179289705-179289727 CTTGGCAGGGTGATGGATGATGG + Intergenic
984553886 4:181191663-181191685 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
985626213 5:989909-989931 CCTGGCCTGGTGAAGAAGGAAGG - Intergenic
986310404 5:6546935-6546957 CTTGGGAAGCTGAAGCAGGGAGG - Intergenic
986841987 5:11708152-11708174 CTTGGGAGGCTGAAGTGGGAGGG - Intronic
986907651 5:12514941-12514963 CTTGTCACACTGAAGAAGGAGGG - Intergenic
987071294 5:14339127-14339149 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
987574512 5:19707909-19707931 CATGGCATGCAGATGGAGAAGGG - Intronic
988351053 5:30107462-30107484 CTTGGGAGACTGAAGTAGGATGG + Intergenic
988530538 5:32023336-32023358 CGTGGCTTGGAGAAGGAGGAAGG - Intronic
990387424 5:55279812-55279834 TTTGGCAGGCTGAAGGGGGGAGG - Intronic
990466314 5:56074866-56074888 CTTAGGAGGCTGAGGGAGGAGGG + Intergenic
991250266 5:64552817-64552839 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
991396839 5:66213050-66213072 CTTGGCAGGCTGAGGCAGGAGGG - Intergenic
991527919 5:67583343-67583365 CTGGGGAGGCTGAAGCAGGAAGG - Intergenic
991649989 5:68842804-68842826 GGTGGCATTCAGAAGGAGGATGG - Intergenic
992524678 5:77597012-77597034 CTTGGGAGGCTAAAGGCGGAAGG + Intronic
992732278 5:79683810-79683832 CTTGGGAGGCTGAGGGAGGCAGG + Intronic
993620534 5:90162685-90162707 CTGGGCATGCAGAACCAGGAGGG - Intergenic
994066228 5:95545682-95545704 GTGGGGTTGCTGAAGGAGGAAGG - Intronic
995506548 5:112866452-112866474 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
996144158 5:119953141-119953163 GTTGGCAAGATGAAGGAGGCAGG - Intergenic
996411777 5:123166230-123166252 TGTGCCATGCTGAAGTAGGAAGG - Intronic
997251415 5:132391592-132391614 CCTGGCATGTTTGAGGAGGAGGG + Intronic
997704429 5:135933749-135933771 CTTGGGAGGCTGAGGCAGGAAGG - Intronic
997823192 5:137084275-137084297 CTTAGCAAGCAGAAGGAGGCAGG - Intronic
999161990 5:149509166-149509188 CTTGGTAGGCTGAAGGAGGGTGG - Intronic
999231862 5:150066449-150066471 CTTGGCATGTCAGAGGAGGAGGG + Intronic
999324432 5:150634711-150634733 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
999721133 5:154400028-154400050 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1000443939 5:161297145-161297167 CTTGACAGGCTGAAGTGGGAGGG + Intronic
1001391759 5:171385313-171385335 TTTGGGAGGCTGAAGCAGGAGGG - Intergenic
1002134660 5:177100239-177100261 CTTGGCAGGCTGAGGTGGGAGGG - Intergenic
1002169391 5:177366877-177366899 CTGAGCTAGCTGAAGGAGGAGGG - Exonic
1002639862 5:180625641-180625663 CTTGGCCAGCTGATGGAGGATGG + Intronic
1002864686 6:1110543-1110565 CTTGGGAGGCTGAAGTGGGAGGG + Intergenic
1003531566 6:6941402-6941424 CTTGGCAGGCTGAGGGAGGCTGG + Intergenic
1003598813 6:7499977-7499999 CTTGGGAGGCTGAGGTAGGAGGG - Intergenic
1003744830 6:8988826-8988848 CTTGGGAGGCTGAAGTAGGAAGG - Intergenic
1004196037 6:13506321-13506343 CTTGGGAGGCTGAAGTGGGAGGG - Intergenic
1004226675 6:13791145-13791167 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1004690882 6:17991038-17991060 CTTGGGAGGCTGAAGCAGGGGGG + Intergenic
1004707524 6:18138372-18138394 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1004957701 6:20748400-20748422 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1005414231 6:25584281-25584303 TTTGGCAGGCTCAAGCAGGAGGG - Intronic
1006076167 6:31534115-31534137 CTTGGGAAGCTGAGGCAGGAGGG - Intronic
1006310818 6:33257905-33257927 CTTGGGAGGCTGAGGGAGGAGGG + Intronic
1006485269 6:34334696-34334718 TTTGGGAAGCTGAGGGAGGAGGG + Intronic
1006690691 6:35882422-35882444 CTTGGGAGGCTGAAGCAGCAGGG - Intronic
1006713899 6:36101328-36101350 CTTGGGAAGCTGAGGCAGGAGGG + Intronic
1007694843 6:43725511-43725533 CGTGGCAAACAGAAGGAGGAAGG - Intergenic
1007746107 6:44043854-44043876 CCTGGCAAGCTGAGGGAGGCAGG - Intergenic
1007798503 6:44371189-44371211 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1009515384 6:64609639-64609661 TTTGGGAGGCTGAAGCAGGACGG + Intronic
1009989721 6:70826820-70826842 CTTGGGAGGCTGAGGTAGGAGGG + Intronic
1010879067 6:81145548-81145570 CGGGGCTTGTTGAAGGAGGATGG - Intergenic
1011041721 6:83036839-83036861 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1011937541 6:92799731-92799753 GTTGGCATGAAGAAGGAGGTTGG - Intergenic
1012289691 6:97437480-97437502 GTGTGCATGATGAAGGAGGAAGG - Intergenic
1013085482 6:106853393-106853415 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1013136007 6:107283216-107283238 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1014048370 6:116921713-116921735 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1014102243 6:117524307-117524329 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1014235332 6:118948041-118948063 CTTGGGAGGCTGAAACAGGAGGG - Intergenic
1014889340 6:126823660-126823682 CTTGGGACGCTGAGGCAGGAAGG - Intergenic
1015494860 6:133869962-133869984 TTTGGGATGCTGAGGCAGGAGGG + Intergenic
1015912173 6:138179915-138179937 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1016007485 6:139104628-139104650 CTTGGCATACCCAAGGAGGGTGG - Intergenic
1016318764 6:142819124-142819146 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1017006615 6:150032128-150032150 CCTGGCCTGCTAGAGGAGGAAGG - Intergenic
1017441697 6:154470307-154470329 CTTGGGAGGCTGAAGGTGGGAGG - Intronic
1017495514 6:154979725-154979747 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1018131900 6:160739651-160739673 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1018181713 6:161228813-161228835 CTTGGCATGCTGAAGGAGGAAGG - Intronic
1018517133 6:164595685-164595707 CTTGGTTCGCTGTAGGAGGAAGG + Intergenic
1019407709 7:892425-892447 CTTGGGATCCTGCAGGGGGAGGG + Intronic
1019494609 7:1331978-1332000 CAGGACATTCTGAAGGAGGAGGG + Intergenic
1019522739 7:1468027-1468049 CCAGGCATGGGGAAGGAGGATGG - Intergenic
1020107925 7:5430768-5430790 CCTGGCATGAGGAAGGAGGGGGG + Intergenic
1020416782 7:7955445-7955467 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1020607309 7:10355821-10355843 CTTGCCACCCTGAAGGGGGAAGG - Intergenic
1020681189 7:11238827-11238849 TTTGGGAGGCTGAAGCAGGAGGG - Intergenic
1021486698 7:21175717-21175739 CTTGGGAAGCTGATGGAGAAGGG + Intergenic
1022241406 7:28516104-28516126 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1023507126 7:40911458-40911480 CTGGGGAGGCTGAAGTAGGAGGG + Intergenic
1023764945 7:43501721-43501743 CTAGGGAGGCTGAAGCAGGAGGG + Intronic
1023824711 7:44001243-44001265 CTTGTGGTGCTCAAGGAGGATGG - Exonic
1024117473 7:46207531-46207553 CATCGCATGCTGAGGGTGGAAGG - Intergenic
1024263497 7:47589106-47589128 CTTGGGAGGCTGAAGCAGGTGGG + Intergenic
1025202109 7:56968803-56968825 CTTGGGAGGCTGAGGGGGGAGGG + Intergenic
1025669838 7:63608125-63608147 CTTGGGAGGCTGAGGGGGGAGGG - Intergenic
1025825548 7:65007726-65007748 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
1025898554 7:65725538-65725560 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
1025977508 7:66380442-66380464 CTCGGGAAGCTGAAGTAGGAGGG + Intronic
1026109201 7:67445424-67445446 TTTGGGAGGCTGAGGGAGGAGGG + Intergenic
1026399819 7:69998287-69998309 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1026424490 7:70276619-70276641 CTTGGCAGGCTGAGGCAGGCAGG - Intronic
1026538550 7:71260700-71260722 CTTGGGAGGCTGACGCAGGAGGG - Intronic
1026780056 7:73260257-73260279 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1026966696 7:74444693-74444715 CTTGGGGGGCTGAGGGAGGATGG - Intergenic
1027020911 7:74813675-74813697 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1027067114 7:75132249-75132271 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1027203192 7:76075590-76075612 CTTGGGAAGCTGAAGTGGGAGGG + Intergenic
1027239227 7:76316506-76316528 CTTGGGAGGCTGAGGTAGGAGGG - Intergenic
1028159743 7:87472316-87472338 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1028406125 7:90475849-90475871 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1028542514 7:91958990-91959012 CTTGGCAGGCTGAGGTGGGAGGG - Intronic
1028718399 7:94000892-94000914 CTTGGGAAGCTGAGGGAGGCAGG + Intronic
1029626781 7:101724788-101724810 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
1030236620 7:107270367-107270389 CTTGGGAAGCTGAGGCAGGAAGG - Intronic
1030287141 7:107838291-107838313 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1031054026 7:116974397-116974419 CTTGGGAGGCTGAGGCAGGAAGG - Intronic
1031881015 7:127198780-127198802 CTTGGGAAGCTGAGGCAGGAGGG - Intronic
1032360781 7:131252798-131252820 CTTGGCATGCACAAGGGGGATGG + Intronic
1032485065 7:132279525-132279547 CTTGGCAGGCTGAGGTGGGAGGG + Intronic
1032610140 7:133403821-133403843 CTTGGGAGGCTGAGGTAGGAAGG + Intronic
1032811715 7:135426104-135426126 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1033052061 7:138014611-138014633 CTTGGGAAGCTGAAGCAGGAGGG - Intronic
1033059424 7:138091352-138091374 CTTTCCCTGATGAAGGAGGAGGG + Intronic
1033261504 7:139848061-139848083 CTTGGGAGGCTGAGGTAGGAGGG - Intronic
1033737413 7:144236520-144236542 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
1033745643 7:144314427-144314449 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1033993620 7:147318332-147318354 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1034163497 7:149009036-149009058 CTTGGGAGGCTGAGGCAGGAAGG - Intronic
1034951807 7:155303167-155303189 CTTCCGATGGTGAAGGAGGAGGG - Intronic
1035293896 7:157857117-157857139 CTGGGGATGCTGGAGGGGGAGGG + Intronic
1035334946 7:158121801-158121823 CTTGCCAGGCTGAGGAAGGAAGG - Intronic
1036799802 8:11781954-11781976 CTTGGGAGGCTGAAGTGGGAGGG + Intronic
1037190556 8:16119467-16119489 TTTGGGATGCTGAAGGTGGGTGG - Intronic
1038150271 8:24937219-24937241 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1038545276 8:28421434-28421456 CTTGGAAGGCTGAAGCAGTAGGG - Intronic
1039047934 8:33466995-33467017 CTTGGGAGGCTGAGGCAGGAAGG + Intronic
1039371052 8:36984243-36984265 CCTGACAGGCTGGAGGAGGAGGG + Intergenic
1039563461 8:38531515-38531537 CTTGGGAAGAGGAAGGAGGAAGG + Intergenic
1039567049 8:38559310-38559332 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1040449581 8:47531016-47531038 CTTGGAATGCTTAAGTGGGAGGG - Intronic
1040486583 8:47878487-47878509 CCTGGCATGGTGAAGGAGGGGGG - Intronic
1040618169 8:49061109-49061131 TTTGGCAAGCTCAAGCAGGATGG + Intronic
1041095078 8:54342027-54342049 ATTGGCATGTGGAAGGAAGAAGG + Intergenic
1041148819 8:54910575-54910597 TTTGGGAGGCTGAAGCAGGAGGG - Intergenic
1041705303 8:60840576-60840598 ATTGGGAAGCTGAAGGTGGAAGG - Intronic
1041770291 8:61465767-61465789 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1041899993 8:62971523-62971545 CTTGGGAGGTTGAAGTAGGAGGG + Intronic
1042125425 8:65533493-65533515 CATGGCCTGCAAAAGGAGGAAGG + Intergenic
1042256827 8:66813144-66813166 CTTGGCAGGCTGAGGCAGGAGGG + Intronic
1042659408 8:71137115-71137137 CTTGGGAGGCTGAGGCAGGAAGG - Intergenic
1044266645 8:90189746-90189768 CTTGGTAAGCTGACTGAGGAGGG + Intergenic
1044784319 8:95778492-95778514 ATTGGCATACTGTGGGAGGATGG + Intergenic
1045039868 8:98213201-98213223 CTGGGGAGGTTGAAGGAGGAGGG - Intronic
1045108979 8:98921440-98921462 CATGGAGTGCTGAGGGAGGAAGG + Intronic
1045133253 8:99182317-99182339 TTTGGGAGGATGAAGGAGGAAGG + Intronic
1045210459 8:100092614-100092636 CATGGCATGATGTGGGAGGAAGG + Intronic
1045268132 8:100638060-100638082 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1045291400 8:100835634-100835656 GGAGGGATGCTGAAGGAGGAAGG - Intergenic
1045564711 8:103301647-103301669 TTTGGGATGCTGAGGCAGGACGG - Intronic
1047020635 8:120771975-120771997 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1047344254 8:124011585-124011607 CTTGGGATGCTGAGGTGGGAGGG - Intronic
1047464679 8:125100801-125100823 TTTGGGAGGCTGAAGCAGGAGGG - Intronic
1049879115 8:145050075-145050097 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
1050827983 9:9973362-9973384 CTTGGAAGGCTGAAGCCGGAGGG + Intronic
1051553506 9:18356418-18356440 CTTGGGATGCTAAGGCAGGAAGG + Intergenic
1052361930 9:27571561-27571583 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1053113697 9:35483602-35483624 ATTAGCAAGCTGAAGGAGGGAGG + Intergenic
1054771869 9:69090680-69090702 CTTGGCCTGAGAAAGGAGGAAGG + Intronic
1055022757 9:71687756-71687778 CTTGGAAGGCTGAAGTAGGAGGG + Intronic
1055331027 9:75183948-75183970 CTTGGCATGAGTAAAGAGGAGGG - Intergenic
1055398018 9:75893378-75893400 CATGCCATGATGAAGGAGGAAGG + Intronic
1055791660 9:79929067-79929089 CTGGGCATGAAGAAGGAGGTGGG - Intergenic
1056396870 9:86189204-86189226 CTCGGGAGGCTGAAGCAGGAGGG + Intergenic
1056450745 9:86714433-86714455 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1056629353 9:88280397-88280419 CTTGGGAGGCTGAAGCAGGAGGG + Intergenic
1056707730 9:88966311-88966333 CTTGGGAAGCTGAGGCAGGAGGG - Intergenic
1057199341 9:93132005-93132027 CGTGGCAGGCAGAAGGATGAGGG + Intronic
1057761772 9:97880523-97880545 CTTGGCAGGCAGAAGTGGGAAGG - Intergenic
1057783397 9:98068703-98068725 CTTGGGAGGCTGAGGCAGGAAGG + Intronic
1058672416 9:107371153-107371175 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
1058680769 9:107438503-107438525 ATTGGCATGCAGATGGAGAAGGG - Intergenic
1058810369 9:108633270-108633292 CTTGAGAGGCTGAAGCAGGAAGG + Intergenic
1059476427 9:114551500-114551522 CTTGGGAGGCTGAAGGGGGAGGG - Intergenic
1059763621 9:117362600-117362622 CTTGCCATCCTGAAGGAGCCAGG - Intronic
1059845264 9:118268535-118268557 CTTGACATACTGGAGGAAGAAGG + Intergenic
1060266319 9:122113514-122113536 CTGTCCATGCTGAAGGAGTAGGG + Intergenic
1060395888 9:123316233-123316255 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
1060400039 9:123343197-123343219 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
1060539985 9:124422869-124422891 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1060578416 9:124720157-124720179 CTTGGGAGGCTGATGGAGGCAGG - Intronic
1060580324 9:124739560-124739582 CTTGGGAGGCTGAAGTAGGAGGG - Intronic
1060680109 9:125554686-125554708 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1060924467 9:127446431-127446453 CTTAGGATGCTGAGGTAGGAGGG - Intergenic
1061344768 9:130014357-130014379 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1061373468 9:130210944-130210966 TTTGGGAGGCTGAAGGAGGAGGG - Intronic
1061382577 9:130267051-130267073 CTTGGGAGGCTGAAGCAGGAGGG - Intergenic
1061494158 9:130962209-130962231 CTTGGCCTGGTGAAGGATGGCGG - Intergenic
1061595005 9:131623219-131623241 TTTGGGAGGCTGAGGGAGGAGGG + Intronic
1061611794 9:131751566-131751588 CTTGGGAAGCTGAGGCAGGAGGG + Intergenic
1061691840 9:132339330-132339352 CTGGGCATGGTGACCGAGGAAGG + Intronic
1061745817 9:132739649-132739671 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1061901703 9:133675983-133676005 CTTGGAAGGCTGAAGGGGGGAGG + Intronic
1062050334 9:134443759-134443781 CTTGGCCTGCAGCAGGAGCAGGG + Intergenic
1062291941 9:135799409-135799431 CTTTGCAGGCTGGTGGAGGAAGG - Intergenic
1062604647 9:137341071-137341093 TTTGGGAGGCTGAAGCAGGAGGG + Intronic
1185553369 X:1001657-1001679 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1185617976 X:1434931-1434953 CTTGGCTTGAGGGAGGAGGACGG - Intronic
1185666319 X:1768199-1768221 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1185884976 X:3774403-3774425 CTGAGCATGATGAAGGAGAAAGG - Intergenic
1185967175 X:4619795-4619817 CTTGGGAAGCTGATGCAGGAGGG + Intergenic
1187012527 X:15294611-15294633 TTTGGCAGGCTGAGGCAGGAGGG - Intronic
1187318198 X:18217996-18218018 CTTGGGAGGCTGAGGTAGGATGG + Intronic
1187572718 X:20521255-20521277 CTTGGAGGGCTGAAGCAGGAGGG - Intergenic
1187579247 X:20591287-20591309 CTTGCCACCCTGAAGGGGGAAGG - Intergenic
1187794012 X:22981305-22981327 CTTGGGAGGCTGAAGCAGGAGGG + Intergenic
1189470963 X:41313827-41313849 CTTGGGAAGCTGAGGCAGGAGGG + Intergenic
1189611475 X:42740939-42740961 ATTGGGATCCTGAAGTAGGATGG + Intergenic
1190717069 X:53114004-53114026 CTTGGAAGGCTGAGGCAGGAGGG - Intergenic
1191600830 X:63003903-63003925 CTTGGGAGGCTGAAGTGGGAAGG - Intergenic
1191741828 X:64444418-64444440 CTTGGGAGGCTGAGGCAGGAAGG - Intergenic
1192420693 X:71027480-71027502 TTTGGGAGGCTGAAGCAGGAGGG + Intergenic
1192587626 X:72331930-72331952 TTAGGGATGGTGAAGGAGGAGGG - Intronic
1192605754 X:72515478-72515500 ATTTGCATGTTGAGGGAGGAAGG - Intronic
1193123656 X:77849182-77849204 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1193197832 X:78655304-78655326 GTTGGCATGCTGTAGGGGAAAGG + Intergenic
1194499479 X:94662618-94662640 CTTGTCATGCTGAATGAACAAGG + Intergenic
1195164898 X:102209702-102209724 CTTGGGAGGCTGAGGAAGGAGGG + Intergenic
1195193960 X:102477389-102477411 CTTGGGAGGCTGAGGAAGGAGGG - Intergenic
1195612712 X:106887068-106887090 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1195664433 X:107416042-107416064 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
1196681014 X:118469618-118469640 TTTGGGAGGCTGAAGCAGGAGGG - Intergenic
1197638458 X:128942290-128942312 ATTGGGATGCTGATGGAGAATGG + Intergenic
1197695643 X:129547119-129547141 CTTGGGAGGCTGAAGCAGGAGGG + Intronic
1198491565 X:137146667-137146689 CTTGTCAGGCTGAATGACGAGGG - Intergenic
1198803597 X:140472104-140472126 CTTGAGAGGCTGAAGCAGGAGGG - Intergenic
1199742493 X:150748719-150748741 CTTGGCAGGCTGAAGTGGGAGGG + Intronic
1200419563 Y:2950157-2950179 CTTGGGAAGCTGAGGTAGGAAGG - Intronic
1200427733 Y:3040015-3040037 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1200762871 Y:7056044-7056066 TTTGGCATGCTGCACAAGGAAGG + Intronic
1200806641 Y:7440362-7440384 CTTGGGAGGCTGAAGTGGGAGGG + Intergenic
1201269310 Y:12239108-12239130 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic