ID: 1018183534

View in Genome Browser
Species Human (GRCh38)
Location 6:161245045-161245067
Sequence ATAAGTTGCCAGTTGGTGCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 108}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018183534_1018183541 18 Left 1018183534 6:161245045-161245067 CCGTGCACCAACTGGCAACTTAT 0: 1
1: 0
2: 0
3: 5
4: 108
Right 1018183541 6:161245086-161245108 AACCAGGGTAGAAACCTCCTTGG 0: 1
1: 0
2: 1
3: 11
4: 101
1018183534_1018183538 3 Left 1018183534 6:161245045-161245067 CCGTGCACCAACTGGCAACTTAT 0: 1
1: 0
2: 0
3: 5
4: 108
Right 1018183538 6:161245071-161245093 GCAGTGGCCTATGCCAACCAGGG No data
1018183534_1018183542 19 Left 1018183534 6:161245045-161245067 CCGTGCACCAACTGGCAACTTAT 0: 1
1: 0
2: 0
3: 5
4: 108
Right 1018183542 6:161245087-161245109 ACCAGGGTAGAAACCTCCTTGGG No data
1018183534_1018183537 2 Left 1018183534 6:161245045-161245067 CCGTGCACCAACTGGCAACTTAT 0: 1
1: 0
2: 0
3: 5
4: 108
Right 1018183537 6:161245070-161245092 TGCAGTGGCCTATGCCAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018183534 Original CRISPR ATAAGTTGCCAGTTGGTGCA CGG (reversed) Intronic
905282183 1:36856291-36856313 ATAAAATGCCAGCAGGTGCACGG + Intronic
906692866 1:47804247-47804269 ATATGTAGCCATCTGGTGCAGGG + Intronic
911749555 1:101480881-101480903 ATAAGTTGACAGTCAGTGCCAGG + Intergenic
912237281 1:107865803-107865825 ATAACTTGGCAGCTGATGCAAGG + Intronic
915017297 1:152745949-152745971 AGAAGGGGCCAGTTGGTGCCTGG - Intronic
921278388 1:213541881-213541903 AAAATTTGCCAGGTGGAGCAGGG + Intergenic
923906606 1:238391976-238391998 ATAAGTAGACAGTTGGTGGCAGG + Intergenic
1070526264 10:77298530-77298552 ATAAGCTGCAAGTTTGGGCACGG - Intronic
1071307795 10:84314397-84314419 CTGAGTTGCCTCTTGGTGCAGGG - Intergenic
1078608145 11:12795651-12795673 TGATGTTGCCAGTTGGTCCATGG - Intronic
1078687972 11:13550392-13550414 ATAAGTTTCCAGAGAGTGCAGGG - Intergenic
1080682088 11:34486653-34486675 ATAACTTGCAAGTAAGTGCAGGG - Intronic
1081217164 11:40415688-40415710 ATAAGTGGCTAGCTGGTACAGGG - Intronic
1083553612 11:63609008-63609030 AAAAGCTGCCAGTTAGTGAATGG - Intronic
1088076199 11:105851593-105851615 AGAAGTTGCCAGTGAGTGTAGGG + Intronic
1088477968 11:110263533-110263555 TTAAGTTGCCAGCTGGATCATGG - Intronic
1090088672 11:123674137-123674159 TAAAGTAGCCAGATGGTGCATGG - Intergenic
1092006863 12:5077400-5077422 AAATGTTGGCAGTAGGTGCAGGG + Intergenic
1092857894 12:12692261-12692283 ATAAGTGGCCAGCTGGTCAAAGG - Intronic
1097502858 12:60427702-60427724 AGAAATTGCCAGTTGGAGAATGG - Intergenic
1098584677 12:72141911-72141933 ATAAATTGGCAGCTGGTGCCAGG + Intronic
1098600506 12:72325934-72325956 ATAACTTGCCAGTTTGTTGAAGG + Intronic
1098658119 12:73058495-73058517 ATAATTTTAGAGTTGGTGCAGGG + Intergenic
1100194895 12:92234309-92234331 ATAAGTTCCCAGATGGTGCTAGG + Intergenic
1102855233 12:116287852-116287874 ATGTGTTTCCAGTTGTTGCATGG - Intergenic
1106549512 13:30759182-30759204 GTCAGTTGCCAGTTGGTGCCAGG - Intronic
1109331928 13:60941344-60941366 ATAAGTTGCCAGCCGGTGCCAGG + Intergenic
1110563446 13:76934435-76934457 ATAAGTTTCCAGGTGATGCCTGG - Intergenic
1112936921 13:104811988-104812010 ATAAATTGATAGTTGGTGAATGG - Intergenic
1114934213 14:27513537-27513559 AAAAGTTGCCAGTGGGTTGAGGG + Intergenic
1118393489 14:65316141-65316163 ATAAGCTGCCATGTGGTGAAAGG + Intergenic
1120011124 14:79415831-79415853 ATAAGTTCCTAGATGGTTCAGGG - Intronic
1120122869 14:80702783-80702805 ATAAGCAGGCAGTTGCTGCAAGG - Intronic
1126566924 15:50110992-50111014 AGAAGATGCCAGTTTGTACAGGG + Intronic
1131947716 15:97645257-97645279 ATATGTTGCCAGTTGATTCTTGG + Intergenic
1132435031 15:101793185-101793207 ATAAGTTCTCAGATGATGCAAGG + Intergenic
1137617984 16:49858126-49858148 ATAAGTTGCCACTTGGAGAGGGG + Intergenic
1137695083 16:50456163-50456185 CTAAGTTGTCACTTGGTGGATGG + Intergenic
1138374326 16:56552281-56552303 ATAATTGGCCAGTTTTTGCAGGG - Intergenic
1139844756 16:69912338-69912360 ATGAGTTGGAAGTTTGTGCAGGG + Intronic
1146051764 17:29559802-29559824 ATAACTTGCCATTTTGTTCAAGG + Intergenic
1148643484 17:49205549-49205571 TTAAGTTGTCAGTGGGTGGATGG - Intronic
1150611766 17:66739179-66739201 AGAAGTTCCCAGTTGGGGCTGGG - Intronic
1153573270 18:6494980-6495002 ATAAATTGGCAGTGGGTGCCAGG - Intergenic
1154542619 18:15559268-15559290 AGAATTTGCAAGTTGGTACATGG + Intergenic
1156682217 18:39604735-39604757 TTAATTTGCCATTTGGTTCAAGG + Intergenic
1165016293 19:32882653-32882675 TTAGGTTACCAGTTGATGCAGGG - Intronic
928239728 2:29576066-29576088 ATAATTAGCCAGTGGGTGCACGG + Intronic
929737890 2:44569918-44569940 TTAAGTTGCCATTTGGATCAAGG + Intronic
931378490 2:61730252-61730274 ATTATTTGCCAGTTGTTTCAGGG - Intergenic
931593500 2:63913276-63913298 AGAAGTTGCCAGTTAGTTCTTGG - Exonic
934665606 2:96167865-96167887 ATAAATTGGCAGCTGGTGCCAGG + Intergenic
937262825 2:120597337-120597359 ATAAGTCACCAGTTGCTGGATGG + Intergenic
942062838 2:172243706-172243728 AGAAGTTACCAGTTGGAGCAGGG + Intergenic
942282805 2:174383822-174383844 ATAGCTAGCCAGTAGGTGCAAGG - Intronic
942619111 2:177828769-177828791 ATAGGGTGCCAGATGGTGTATGG + Intronic
944872937 2:203932653-203932675 ATAAATTGGCAGCTGGTGCCAGG + Intergenic
945192915 2:207208570-207208592 ATAAGGTGCCAGTGTGTGAATGG + Intergenic
945320804 2:208420944-208420966 AGTAGTTGCCAGGTGTTGCAGGG - Intronic
946440943 2:219695133-219695155 AGAAGTTGCCAATAGGTTCAGGG - Intergenic
1170004611 20:11652206-11652228 ATAAGTTCCCAGATGATGCGAGG + Intergenic
1170509427 20:17061135-17061157 CAAAGTTGCCAGTTGGATCATGG + Intergenic
950259880 3:11536061-11536083 ATAACTGGCTAGTTGGGGCAAGG + Intronic
951076568 3:18400853-18400875 TTAAGTTACAAGTTGGTACAAGG + Intronic
951423538 3:22516101-22516123 ATAAGTTCACTGTAGGTGCATGG - Intergenic
953123236 3:40066209-40066231 AAAAGTTGCAAGTTGGTGTGGGG - Intronic
955076451 3:55618116-55618138 TTAATTTGCAAGTTGGTTCAGGG - Intronic
957688824 3:83540307-83540329 ATAAGTTTCCATTTGGCACATGG + Intergenic
958831057 3:99089803-99089825 ATAAGTTGGCAGTAAGTACATGG - Intergenic
963599312 3:147364155-147364177 ATAAGTTCCCAGGTGATGCTGGG - Intergenic
971924249 4:32986264-32986286 AAAAGTGTCCAGATGGTGCATGG + Intergenic
974449674 4:62037366-62037388 TAAAGTAGCCTGTTGGTGCAAGG - Intronic
976122163 4:81795273-81795295 ATAAGGTGAAGGTTGGTGCATGG + Intronic
978325255 4:107546584-107546606 AAAAGTTTCCAGTTTCTGCAAGG + Intergenic
981709410 4:147694116-147694138 ATGAGTTGCCAGTAGGACCAGGG + Intergenic
989987563 5:50719623-50719645 ATAAGTTGACTGTTAATGCATGG + Intronic
990868441 5:60405103-60405125 ATAAGTTTTCAGGTGTTGCAAGG + Intronic
992159035 5:73982890-73982912 CCAAGTTGACAGTTGGTGAATGG - Intergenic
995789893 5:115875321-115875343 ATAATTTGCCAGGTGATGCTGGG - Intronic
1000493621 5:161948906-161948928 AAAACTTGCCAGTTGTTGGAGGG + Intergenic
1000647063 5:163771816-163771838 ATATTTTCCCATTTGGTGCATGG - Intergenic
1003453178 6:6256330-6256352 AAGAGTTGTCAGTTGGTCCAAGG - Intronic
1009860150 6:69318650-69318672 AGAATTTGCCTGTTGGTGTATGG + Intronic
1012000124 6:93644456-93644478 ATAAATTGGCAGCTGGTGCCAGG + Intergenic
1014472734 6:121836170-121836192 ATAGGTTGCCAGGTGCTGAATGG + Intergenic
1017661135 6:156674820-156674842 ATAAGTTGGCTGTAAGTGCATGG - Intergenic
1018183534 6:161245045-161245067 ATAAGTTGCCAGTTGGTGCACGG - Intronic
1021412954 7:20348801-20348823 ATAAGTAGCCAGTGGGAACAAGG + Intronic
1024887590 7:54161947-54161969 ATAAATTGGCAGCTGGTGCCAGG - Intergenic
1029914904 7:104199084-104199106 AGAAGTTGGCTGTAGGTGCAGGG + Intronic
1032836718 7:135681801-135681823 ATTAGTTCCCAGTTGCTGCCTGG + Intronic
1040324606 8:46335390-46335412 AGAAGTGGCGAGTCGGTGCAGGG + Intergenic
1040786304 8:51168370-51168392 ATCAGTTGCAAGCTGATGCAGGG - Intergenic
1041007200 8:53507163-53507185 ATCAGTTTCCAGTTGCTGCTGGG + Intergenic
1041918711 8:63160777-63160799 ATAAATTGGCAGGTGGTGCCAGG - Intergenic
1043884910 8:85587987-85588009 ATAAATTGGCAGCTGGTGCCAGG + Intergenic
1043946229 8:86256063-86256085 CTAAGTGGCCATTTCGTGCAAGG + Intronic
1044485514 8:92748562-92748584 AGGAGCTACCAGTTGGTGCAGGG + Intergenic
1045772678 8:105762239-105762261 ATTAGTTCCAAGATGGTGCAAGG + Intronic
1046721488 8:117624466-117624488 TTAACTTGCCTGTTGGTGGAGGG - Intergenic
1048719837 8:137311319-137311341 GAAAGTTGCCAGGTGGTGCTAGG - Intergenic
1051573640 9:18588754-18588776 ATGGGTTGGCTGTTGGTGCATGG + Intronic
1057763827 9:97898676-97898698 ATAAGTTTCCTGGTGGGGCACGG - Intergenic
1059966457 9:119619297-119619319 ATAAGGGGCCAGGTGGAGCAGGG - Intergenic
1060372056 9:123083445-123083467 AAATTTTGCCAGTTGTTGCAAGG + Intronic
1203638197 Un_KI270750v1:133773-133795 ACAAGTAGCTAGTTGGTACATGG - Intergenic
1186360307 X:8834455-8834477 ACAAGTTTCCAGATGTTGCAGGG + Intergenic
1186550667 X:10501717-10501739 GTAAGTTGCTACTGGGTGCACGG + Intronic
1188191550 X:27176919-27176941 ATAAATTGCCAATTGAAGCATGG - Intergenic
1189669050 X:43388192-43388214 ATAAATTGGCAGCTGGTGCCAGG - Intergenic
1190518925 X:51256618-51256640 ATAACTTGGTAGTTGGTACAAGG + Intergenic
1195220486 X:102741575-102741597 AAAAATTGGCAGTTGGTGCCAGG - Intronic
1197108630 X:122745578-122745600 ATAATTTTCCAGGTGCTGCAGGG + Intergenic
1199808583 X:151327037-151327059 TTAATTTGCCTGTTGGTGAAAGG - Intergenic