ID: 1018183837

View in Genome Browser
Species Human (GRCh38)
Location 6:161247724-161247746
Sequence CTGTAATCACAGATTTTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018183832_1018183837 -2 Left 1018183832 6:161247703-161247725 CCAGGCCATGGTGGCTTACACCT 0: 1
1: 18
2: 202
3: 989
4: 2937
Right 1018183837 6:161247724-161247746 CTGTAATCACAGATTTTGGGAGG No data
1018183833_1018183837 -7 Left 1018183833 6:161247708-161247730 CCATGGTGGCTTACACCTGTAAT 0: 22
1: 361
2: 1152
3: 2565
4: 3593
Right 1018183837 6:161247724-161247746 CTGTAATCACAGATTTTGGGAGG No data
1018183831_1018183837 3 Left 1018183831 6:161247698-161247720 CCTGGCCAGGCCATGGTGGCTTA 0: 1
1: 1
2: 4
3: 74
4: 780
Right 1018183837 6:161247724-161247746 CTGTAATCACAGATTTTGGGAGG No data
1018183826_1018183837 27 Left 1018183826 6:161247674-161247696 CCTATTCAACATAGTATTAGAAG 0: 119
1: 2373
2: 11493
3: 5412
4: 2761
Right 1018183837 6:161247724-161247746 CTGTAATCACAGATTTTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018183837 Original CRISPR CTGTAATCACAGATTTTGGG AGG Intronic
No off target data available for this crispr