ID: 1018185461

View in Genome Browser
Species Human (GRCh38)
Location 6:161262435-161262457
Sequence GAGCCAGCTGTGGAAGAGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 323
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 301}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018185461 Original CRISPR GAGCCAGCTGTGGAAGAGTT TGG (reversed) Intronic
901778900 1:11579692-11579714 GAGCCACCTGGGGAAGAAGTGGG - Intergenic
901829088 1:11881250-11881272 GAGCCAGATGTTGCAGAGCTGGG + Intergenic
902340526 1:15780595-15780617 GAGCCAGCTGTAGAAGGGGTGGG - Intronic
902647296 1:17808961-17808983 GTGGGAGCTGTTGAAGAGTTTGG + Intronic
902818572 1:18929779-18929801 GAGCCAGCTGGGGCAGAGGCAGG - Intronic
904534150 1:31188181-31188203 CAGCCACCTGTGGAAGAGACAGG + Exonic
904841393 1:33373985-33374007 GGGCAACATGTGGAAGAGTTGGG - Intronic
904965877 1:34372199-34372221 GAGGCATCTGTGGGAGAGTCAGG + Intergenic
907436461 1:54452389-54452411 GAGCATGTTGTGGGAGAGTTTGG - Intergenic
910509660 1:87989483-87989505 GAGCCAGTTGTGCAAAAGCTGGG + Intergenic
911455921 1:98123688-98123710 AAGCCAGCTGAAGAAGAGGTTGG + Intergenic
912949628 1:114111804-114111826 GAGCCAGCTGTGGGAACGTGGGG - Intronic
916498696 1:165368182-165368204 GAGCTAGCTCTGCATGAGTTGGG - Intergenic
917020776 1:170583775-170583797 GAGTCAGCTTTGGAAAAATTTGG - Intergenic
917083810 1:171285304-171285326 GAGCCAGATGTGGATCCGTTAGG - Exonic
917577766 1:176342052-176342074 GACCCAGTTTTGGATGAGTTGGG + Intergenic
918051571 1:180977409-180977431 GGGGCAGCTGTTGTAGAGTTGGG - Intronic
918465850 1:184820739-184820761 GAGCTAGTTGTGGTAGAGTCGGG - Intronic
919865030 1:201774946-201774968 GAGCCAGCAGTGGAGGAAGTGGG + Intronic
919934691 1:202243772-202243794 GAGCCAGTTGTGCATGAATTTGG + Intronic
920186096 1:204160408-204160430 CAGCCAGATGTGGCAGAGTAGGG + Intronic
922507054 1:226132748-226132770 GAGCCAGCTGGGGAAGGGCATGG + Intergenic
922778716 1:228232603-228232625 TAGCCAGCTGTGTGAGTGTTAGG + Intronic
923541924 1:234894414-234894436 GACGCAGCTGTGGAAAAGTCTGG - Intergenic
924068666 1:240254101-240254123 GTGCCAGCAGTGGAAGAAGTGGG + Intronic
924094089 1:240533262-240533284 GAGCTAGCTGTGAAAAGGTTGGG + Intronic
1063272585 10:4527727-4527749 GATGCAGCTGTGGAATAGGTGGG - Intergenic
1063302739 10:4866557-4866579 GAGCCAGCTGTGCAGGAGACCGG + Intergenic
1063482803 10:6391208-6391230 GAGCCAGCTGTGCAGGAGACTGG - Intergenic
1065217072 10:23459412-23459434 GAGCCAGCTGTGCAGGAGACCGG - Intergenic
1065882035 10:30045180-30045202 GAGCGAGTTGTGGATGAGGTTGG + Intronic
1066239365 10:33518293-33518315 CCTCCAGCTGTGGAGGAGTTTGG - Intergenic
1071981240 10:91006010-91006032 CAGCCAGCTGTGGAAGTGTTTGG + Intergenic
1072120601 10:92402522-92402544 GAGCCAGCTGTGCAGGAGACTGG - Intergenic
1072797545 10:98367420-98367442 AAGCCAGGTTTGGAAGAGGTGGG - Intergenic
1073440475 10:103549688-103549710 GACCCTGCTGTGGAGGAGCTGGG - Intronic
1077286739 11:1769816-1769838 GAGCCAGCTGTGCAGGAGAGTGG - Intergenic
1077584559 11:3440723-3440745 GTGTCAGCTGGGGAAGAGGTGGG + Intergenic
1077847218 11:6039067-6039089 CAGCCAGCTGTGGAGGAGACTGG - Intergenic
1078669196 11:13350023-13350045 GATCCAGCTTGGGAGGAGTTAGG - Exonic
1078827347 11:14941872-14941894 GAGCCAGCTGTGCAAGAGACTGG + Intronic
1080028737 11:27638508-27638530 GAGCCAGCTGTGCAGGAGACTGG + Intergenic
1080272742 11:30467841-30467863 GATGCAGCTGTGGAACTGTTGGG + Intronic
1081613495 11:44577351-44577373 GAGCCAGGTGTAGAAGAATGAGG - Intronic
1082997503 11:59265455-59265477 GTGCCATCTGTGGCAGAGCTGGG - Intergenic
1083368331 11:62157287-62157309 GAGCCAGCTGTGCGGGAGATCGG - Intergenic
1083503781 11:63136594-63136616 GAGCCAGCTGTGCAGGAGACCGG - Intronic
1083508496 11:63184286-63184308 GAGCAAACTGAGGAAGATTTAGG - Intronic
1083931516 11:65848790-65848812 TAGCCAGCTGGGGAAGGGGTGGG + Intronic
1084113097 11:67025923-67025945 CAGCCAGCGGTGGTAGAGCTGGG - Intronic
1084241458 11:67823376-67823398 GTGTCAGCTGGGGAAGAGGTGGG + Intergenic
1084830981 11:71769264-71769286 GTGTCAGCTGGGGAAGAGGTGGG - Intergenic
1085426496 11:76409348-76409370 GAGCCAGCTTTGGAAAATTTAGG + Intronic
1087050538 11:93882351-93882373 GAGCCAGCTGTGTGGGAGGTGGG - Intergenic
1087431927 11:98066086-98066108 GAGCCAGCTGTACAGGAGATTGG - Intergenic
1087870667 11:103289259-103289281 GAGCCAGCTGTGCAGGAGACTGG - Intronic
1088932665 11:114367699-114367721 GAGGCAGGAGGGGAAGAGTTTGG - Intergenic
1090249972 11:125244410-125244432 GAGACAGATCTGGAAGGGTTGGG - Intronic
1091794465 12:3289799-3289821 GAGCCAGCTGGGGCAGAGCTGGG + Intergenic
1092879428 12:12876415-12876437 GAGCCAGCTGTGCAGGAGACTGG - Intergenic
1092965983 12:13642851-13642873 GAGCTGGCTTTGGCAGAGTTGGG + Intronic
1093889174 12:24498950-24498972 GAGCCAACTGTGGAAAATCTAGG - Intergenic
1095305492 12:40634111-40634133 GAGCAAGCAGTAGAAGAATTTGG - Intergenic
1095395816 12:41761303-41761325 CATCCATCTGTGAAAGAGTTTGG + Intergenic
1096913608 12:55009273-55009295 AAGAGAGCTGTGGAAGATTTAGG - Intergenic
1097446399 12:59678031-59678053 GAGCCAGGTGTGGAGCAGTGAGG + Intronic
1097896861 12:64833154-64833176 GAGCAAGATATGGAGGAGTTGGG + Intronic
1099392535 12:82098365-82098387 GAGGAAGCAGTGGAAGAGCTTGG - Intergenic
1100295272 12:93255027-93255049 GAGCCAGCTGTGCAGGAGACTGG + Intergenic
1101394364 12:104331603-104331625 GAGAAAGCTGTGGAGAAGTTTGG + Exonic
1102075351 12:110055624-110055646 GAGCCAGCTGTGGGGGAGACCGG + Intronic
1102226984 12:111235793-111235815 GAGACAGGTTTGAAAGAGTTGGG + Intronic
1102492993 12:113299968-113299990 GCTCCAGCTGTGGAAGAATGAGG + Exonic
1102948013 12:117006694-117006716 GCCCCAGCTGGGGAAGAGGTGGG + Intronic
1103880988 12:124165863-124165885 CAACCAGCTGTGGTGGAGTTGGG - Intronic
1104097831 12:125575142-125575164 GTGACTGCTGTGGAAAAGTTTGG - Intronic
1105390320 13:19971053-19971075 GAGCAAGGTGGGGAAGAGTAGGG + Intronic
1108247332 13:48531415-48531437 GAACCAGCAGTACAAGAGTTTGG + Intronic
1108588506 13:51892056-51892078 TACCCAGATGTGGAAGAGGTGGG + Intergenic
1111142118 13:84132689-84132711 GAGCCATCTATGGATGAGGTAGG + Intergenic
1111607611 13:90561289-90561311 GAGCTGGCTGTGGAAGAGACTGG - Intergenic
1113305981 13:109079161-109079183 AAGTCAGCTGGGGCAGAGTTAGG + Intronic
1113536963 13:111075952-111075974 GTGCCAGCAGTGGGAGAGGTAGG + Intergenic
1113871733 13:113564099-113564121 GTGGGAGCTGAGGAAGAGTTTGG - Intergenic
1114438472 14:22727393-22727415 GAGCCAGCTGTGCAGGAGACTGG + Intergenic
1116313634 14:43359463-43359485 GAGCCAGCTGTGGAGTGGTGAGG + Intergenic
1117181193 14:53193535-53193557 GAGCCAGCTGTGCAGGAGACCGG - Intergenic
1117956479 14:61127428-61127450 GAGCTACCTGGGGAAGGGTTTGG - Intergenic
1119101396 14:71883315-71883337 GAGCCAGGTATGGGACAGTTAGG + Intergenic
1119644925 14:76341260-76341282 GAACCAGCTGAGGGAGAGCTGGG - Intronic
1120760596 14:88281194-88281216 GAGCCAGCCGTGGAAGAATGGGG - Intronic
1123996266 15:25719819-25719841 GAACCGGCTGTGGAAGCCTTGGG - Intronic
1124902428 15:33836813-33836835 GAGCCTGCTCTGGAAAGGTTAGG - Intronic
1125059063 15:35397267-35397289 AAGCCAGCTGTCAAAGAATTGGG - Intronic
1125247544 15:37659013-37659035 GAGTTAGCTGTGGTGGAGTTGGG + Intergenic
1125449462 15:39793039-39793061 GAGGGTGCTGTGGAAGAATTGGG + Intergenic
1125584287 15:40809325-40809347 GAGTCAGCCGAGGAAGTGTTTGG + Intronic
1129960260 15:79678065-79678087 AAGCCAGCTGTGCAGGAGTCTGG + Intergenic
1130744279 15:86634192-86634214 CACCCAGCCATGGAAGAGTTGGG - Intronic
1130837293 15:87663536-87663558 GAGCCAGCTGTGCAGGAGACCGG - Intergenic
1132354959 15:101164374-101164396 GAGCCAGCTGTGCAAGAGCCTGG - Intergenic
1133352953 16:5114317-5114339 GTGTCAGCTGGGGAAGAGGTGGG + Intergenic
1133362317 16:5184286-5184308 GAGCCAGCTGTGCAGGAGACTGG + Intergenic
1133706436 16:8359242-8359264 AAACCAGCTGAGGAAGAGCTGGG - Intergenic
1133764800 16:8830371-8830393 GAGCCAGCTGTGCAGGAGACTGG + Intronic
1134098394 16:11434795-11434817 GAGGCAGCCGTGGCCGAGTTGGG + Intronic
1136230717 16:28883752-28883774 GAAACAGGTGTGGAAGAGTGGGG - Intronic
1136356875 16:29749945-29749967 GAGCCAGCTGTGCAGGAGACCGG - Intergenic
1136598108 16:31265745-31265767 GAGAAGGCTGTGGAAGAGCTGGG - Intronic
1136609368 16:31356967-31356989 GAGAAGGCTGTGGAAGAGCTGGG - Intronic
1137758881 16:50924688-50924710 GATCCATCTCTGGAGGAGTTTGG - Intergenic
1137825466 16:51490670-51490692 GAGCCAGGTTTTGAAGACTTTGG + Intergenic
1138029736 16:53550832-53550854 GAGGAAGCTGTGGAATATTTTGG - Intergenic
1138222959 16:55268640-55268662 GAGACAGCTGAGGAGGAGTCTGG - Intergenic
1139014860 16:62677684-62677706 GAGCCAGCTGTGCAGGAGACTGG - Intergenic
1140244275 16:73233969-73233991 AAACCAGCTGTGGATGACTTGGG + Intergenic
1141546002 16:84769684-84769706 GAGCCAGCTATGGGAGTCTTTGG + Intronic
1143014600 17:3885001-3885023 GTGCAAGCTGGAGAAGAGTTAGG + Intronic
1144122280 17:12166675-12166697 TAGGCAGAGGTGGAAGAGTTTGG - Intergenic
1144770561 17:17757188-17757210 GGGACAGCTGTGGAGGTGTTGGG + Intronic
1145783851 17:27581536-27581558 GAGCCAGCTATGGAAGAAGGTGG - Intronic
1145833175 17:27934028-27934050 GAGCCAGCTGTGCCAGAGACCGG + Intergenic
1146722714 17:35134348-35134370 GAGCTAGCTGCTGAAGAGGTAGG - Intronic
1148053355 17:44779862-44779884 GAGCCAGGAGTTGAAGGGTTTGG - Exonic
1149701396 17:58658188-58658210 GAGCCAGCTGTGCAGGAGACCGG - Intronic
1150718450 17:67593245-67593267 CAGCCAGGTGTGGAAGAGGAAGG + Intronic
1150948686 17:69777194-69777216 GAGTCATCCGTGGCAGAGTTGGG - Intergenic
1151252652 17:72849162-72849184 GAGTCAGCTGAGGAAGAGGAGGG + Intronic
1151978409 17:77495231-77495253 GCTCCAGCTGAGGAAGAGTCTGG + Intronic
1152407585 17:80106499-80106521 AAGCCAGCTGTGCAGGAGTGGGG + Intergenic
1153936342 18:9927851-9927873 GTGACAGCTGTAGAGGAGTTGGG + Intronic
1154194024 18:12253291-12253313 GAGCCAGCGGAGGAAGAGGGCGG + Intergenic
1155211935 18:23609458-23609480 GAGCCAGCTGTGCGGGAGATAGG - Intronic
1157652304 18:49346046-49346068 GAAACTGCTGTGGAAAAGTTTGG + Intronic
1159026966 18:63192230-63192252 GAGCCAGCCCTGGGAAAGTTAGG + Intronic
1161157855 19:2742837-2742859 GAGCCCTCTGGGCAAGAGTTGGG + Intergenic
1161303453 19:3554585-3554607 GAAACAGCTGTGGAAAAGGTAGG - Intronic
1161572057 19:5036143-5036165 GAGCGAGCTGTGGGGGTGTTGGG + Intronic
1162321785 19:9974735-9974757 GGGTCAGCATTGGAAGAGTTGGG + Intronic
1165256670 19:34580450-34580472 GACCCGGCTGTGGAGGAGCTGGG + Intergenic
1165259435 19:34599266-34599288 GACCCAGCTGTGGAGGAGTTGGG + Intronic
1165602353 19:37065408-37065430 GATCCAGCTGGGAAAGTGTTGGG - Intronic
1166719910 19:44990834-44990856 GGTCCAGCTGTGGATGAGGTGGG - Exonic
1166831704 19:45643370-45643392 ATGCCTGCTGGGGAAGAGTTTGG - Intronic
1168455929 19:56508147-56508169 GAGTGAGCTGTGGGAGAGATGGG + Intronic
926250235 2:11151540-11151562 GAGCCAGCTGTGCGGGAGATTGG + Intergenic
927562006 2:24080462-24080484 GAGCCAGCCATGGTAGGGTTGGG - Intronic
928672526 2:33616995-33617017 GAGCCAGCTGTGCAGGAGACTGG + Intergenic
929139661 2:38655814-38655836 GAGCCAGCTCTGCAAGGGTTGGG + Intergenic
929579980 2:43075945-43075967 GAGCCAGCCATGGATGAGTGGGG - Intergenic
929743986 2:44636359-44636381 GACCCAGATGTGCAAGAGTTTGG + Intronic
932361343 2:71109517-71109539 GAGCAAGCTGTGTAAGATTAGGG - Intergenic
932880910 2:75501096-75501118 AAGGCTCCTGTGGAAGAGTTTGG - Intronic
935620115 2:105122110-105122132 CAGCCAACTGGGGAACAGTTTGG - Intergenic
935794453 2:106627928-106627950 CAGCCACCTGTGGATGAGCTGGG + Intergenic
936833367 2:116677137-116677159 GATCTAACTGTGGAAGATTTTGG - Intergenic
938681573 2:133696967-133696989 GAGCCAGTTGGGAAAGAATTTGG - Intergenic
940187573 2:151003926-151003948 GAGTCTGCTGTGGAAGAGGAGGG - Intronic
940940025 2:159549488-159549510 GAGACAGCTCTGGAAGTTTTAGG - Intronic
940986475 2:160056888-160056910 GAGAGAGATGAGGAAGAGTTTGG - Intronic
941043749 2:160649893-160649915 GAGCCAGGTGTGGAGAAGTGAGG - Intergenic
942552000 2:177129459-177129481 GAGGCAGCTGTGGAAGAGGAGGG + Intergenic
943040778 2:182802430-182802452 CAGCCAGCAATGGAAGAGTAGGG + Intergenic
943720447 2:191198611-191198633 GCTCCAGCTGTGGAGGAGCTTGG + Intergenic
944186639 2:196956210-196956232 GAGCCAGCTGTGCAGGGGATCGG + Intergenic
946115283 2:217455958-217455980 GAGTCAACTGGGGAAGACTTCGG - Intronic
946309777 2:218877007-218877029 GACCCAGCAGTGGTAGAGTCTGG - Intergenic
946534496 2:220611066-220611088 GAGCCAGCCATGGAAGAATTAGG - Intergenic
947807982 2:232981764-232981786 GAGCCAGCTGTGCGGGAGATGGG - Intronic
948424327 2:237877859-237877881 GGGCCAGGTGGGGAAGGGTTCGG - Intronic
1168957150 20:1842087-1842109 GAGCCAGATGTGGAATTGCTGGG - Intergenic
1170580327 20:17694343-17694365 GAACCAGCTGTTGAAGATGTGGG + Intronic
1172093090 20:32447335-32447357 GGGGCAGCTCTGGAAGGGTTGGG - Exonic
1172197494 20:33102088-33102110 GGGCCAGCTGGGCAAGAGCTGGG + Intronic
1172799585 20:37566539-37566561 GAGGCAGTGGTGGGAGAGTTTGG + Intergenic
1173470604 20:43320658-43320680 GAGACAGCTGAGGAGGATTTTGG - Intergenic
1173600878 20:44294323-44294345 GAGCCAGCTGTGCAGGAGACCGG + Intergenic
1173907806 20:46641570-46641592 CACCCAGCTGTGGAAGATCTGGG + Intronic
1173935379 20:46857588-46857610 GAGCCAGATGTGGAAAGGTGAGG + Intergenic
1175348959 20:58304394-58304416 GAGCTATCTGTGAAAGAGCTTGG - Intergenic
1175523832 20:59619957-59619979 GTGCCAGCTGTGAAAGTGTCAGG + Intronic
1177656105 21:24019611-24019633 CAGGCAGATGTGGGAGAGTTTGG + Intergenic
1178172896 21:30061810-30061832 GAGCCATCTGAGGAAAATTTGGG - Intergenic
1178382452 21:32122125-32122147 GAGCCAGCTGTGCAGGAGACCGG - Intergenic
1179109321 21:38432758-38432780 CAGCCAGTAGTGGAAGAATTGGG + Intronic
1179109473 21:38433989-38434011 GAGAAAGCTTTGGAAGAGTTCGG - Intronic
1179461272 21:41536879-41536901 CAGCCAGCTGTGGACTACTTTGG - Intergenic
1179542637 21:42093585-42093607 GAGCCAGCTGTGGATGTGGCGGG + Intronic
1179875876 21:44267151-44267173 GAAGCAGCTTTGGAAGAGATGGG - Intergenic
1181567239 22:23746538-23746560 GGGCCAGGTGTGAAGGAGTTGGG - Intronic
1182427467 22:30282548-30282570 AAGCCAGCTGTGGAACCATTTGG + Intergenic
1182942225 22:34287744-34287766 GAGCCAGCCCTGGCAGAGTGGGG + Intergenic
1183319003 22:37153710-37153732 GAGCCAGGTGAGGAAGGGTTAGG + Intronic
1183376036 22:37465929-37465951 AAGCCAGCTGTGCAGGAGTGAGG + Intergenic
1185419176 22:50725877-50725899 GAGCCATCTCTGGAAAAGGTGGG - Intergenic
949939165 3:9141166-9141188 GAGACAGCTATGGCAGAGTGGGG - Intronic
950207738 3:11093403-11093425 GAGCCAGGTGTGGAACGGTGAGG - Intergenic
950941663 3:16898901-16898923 CAGCCAGCTGTGGCAGGGGTTGG + Intronic
951408566 3:22332191-22332213 GAGGCAGGTGTGGAGGAGCTGGG - Intronic
952003823 3:28818687-28818709 GAGCCAGAAGTGGAGGATTTAGG + Intergenic
952302843 3:32119800-32119822 GGGTCAGCTCTGGAAGAGATGGG + Intronic
952640808 3:35593238-35593260 AAGCCAGATGTGAAAGATTTTGG - Intergenic
953534673 3:43768710-43768732 GAGCCGGCTGTGAAGGAGCTTGG + Intergenic
954446758 3:50550950-50550972 GGGCCTGCTGTAGAAGAGCTAGG + Intergenic
955994931 3:64670110-64670132 GAGACAGAGGTAGAAGAGTTTGG - Intronic
956989859 3:74751079-74751101 GAGCCAGGTGTGGAGCAGTGAGG + Intergenic
957056933 3:75450284-75450306 GTGTCAGCTGGGGAAGAGGTGGG + Intergenic
957543955 3:81612828-81612850 GATGCAGGTGTGGATGAGTTAGG + Intronic
959043144 3:101441625-101441647 GTGCCAGCTGTGGCCGAGGTAGG - Intronic
959084201 3:101834185-101834207 AAGCCAGCTGAAGGAGAGTTGGG - Intronic
959489580 3:106972162-106972184 TAGCAAGCAATGGAAGAGTTTGG + Intergenic
960324554 3:116279465-116279487 AAGCCAGGTGTAGAAGAGTAGGG + Intronic
960627660 3:119697552-119697574 GAGCCAGCTGTACAAGAGACTGG + Intergenic
961296537 3:125889432-125889454 GTGTCAGCTGGGGAAGAGGTGGG - Intergenic
961346040 3:126263967-126263989 GAGGCAGCTGGGGAAGCGGTAGG + Intergenic
961616441 3:128186012-128186034 GTACCAGCTGTGAAAAAGTTTGG - Intronic
962054184 3:131851372-131851394 GCACCAGCTGTGTAACAGTTGGG + Intronic
962094160 3:132276489-132276511 GAGCCAGCTGTGCAGGAGACTGG + Intronic
963051274 3:141146094-141146116 GAGGCAGCTCTGGAAGAGGGTGG - Intronic
963087986 3:141455916-141455938 GAGACAGCAGGGGAAGAGGTGGG - Intergenic
963269056 3:143267822-143267844 AAGCCAGTGGAGGAAGAGTTGGG - Intronic
963979929 3:151526155-151526177 GAGCTACCTGTTGAAGAGATTGG + Intergenic
964224559 3:154383213-154383235 GACCCAGCTGTGGGAGAACTGGG + Intronic
966591848 3:181692900-181692922 GAGCCAGTTCTGGAAGATATAGG + Intergenic
967810309 3:193754230-193754252 GAGGAAACTGTGGAAAAGTTTGG + Intergenic
968001770 3:195211419-195211441 GAGCCAGCTCTGGCAGACTGAGG + Intronic
969754261 4:9138066-9138088 GTGTCAGCTGGGGAAGAGGTGGG - Intergenic
969814156 4:9674342-9674364 GTGTCAGCTGGGGAAGAGGTGGG - Intergenic
970032380 4:11691320-11691342 GAGCCAGCTCAGGAAGAACTAGG + Intergenic
971784694 4:31085042-31085064 GAGCCAGCTGTGCAGGAGACTGG + Intronic
972244029 4:37225780-37225802 GAGCCAGAAGTTCAAGAGTTTGG - Intergenic
975170871 4:71230748-71230770 GAGCAGGCTGTGGAAGAGAGTGG + Intronic
975234196 4:71972301-71972323 GAGCCAGCTCTGAATGAGTAGGG + Intergenic
976367638 4:84247636-84247658 GAACCTGCTGTGGAAGGGATTGG + Intergenic
976883960 4:89963768-89963790 GAGCCAGCTGTGCAGGAGACCGG + Intergenic
977105763 4:92882030-92882052 GAGCCAGCTGGGGCAGATTATGG + Intronic
977192625 4:94019699-94019721 GAGCCTTTTGTGGAAGATTTGGG - Intergenic
977347973 4:95841216-95841238 GAGCCACATTTGGAAGAATTAGG + Exonic
977610319 4:99023891-99023913 GAGCCAGCTGTGTGGGAGATGGG + Intronic
977835984 4:101646974-101646996 GAGCAAGCAGTGGAACAGGTGGG + Intronic
978319329 4:107477096-107477118 GAGCCGGCTGTGCAGGAGATCGG + Intergenic
981255383 4:142655399-142655421 GGGCCAGGTCTGAAAGAGTTTGG - Intronic
983651582 4:170041436-170041458 GAGCCAGCTGAGGCAATGTTTGG + Intergenic
983957124 4:173710732-173710754 AAGACAGCTGTGGAAGGGGTAGG + Intergenic
993494971 5:88598029-88598051 GGGCCAAATGTGGAAGAGTAAGG - Intergenic
994034670 5:95185019-95185041 GAGCCGGCTGTGCAAGAGACCGG - Intronic
995200995 5:109425137-109425159 GAGCCAGCTGTGCAGGAGATCGG - Intergenic
997764515 5:136486706-136486728 CAGCAAGCTGTGGGATAGTTAGG + Intergenic
998016399 5:138735559-138735581 GAGCCAGCTGAGGAGGAGCTGGG - Intronic
1000556950 5:162737618-162737640 GAGCCAGCTCTGCAAGAGACTGG - Intergenic
1001847911 5:174937847-174937869 GAGCCAGCTGTGGAAAACCCAGG - Intergenic
1003490854 6:6620382-6620404 GGACTAGCTGTGTAAGAGTTGGG + Intronic
1003606018 6:7561660-7561682 GAGACAGCTGTGGGAGAGAAGGG + Intronic
1003913077 6:10760287-10760309 GAGCCAGCTGTGCAGGAGACTGG - Intronic
1004368307 6:15030579-15030601 GAGCCAGCTGTGCAGGAGACTGG + Intergenic
1004390167 6:15203313-15203335 GAGCCAGCTGTGCAGGAGACTGG + Intergenic
1004720705 6:18265387-18265409 GAGCTAGTGGTTGAAGAGTTGGG - Intergenic
1004975444 6:20960726-20960748 CATCCAGTTTTGGAAGAGTTTGG + Intronic
1006374556 6:33664773-33664795 GTGGCAGCTGTGGCAGTGTTGGG + Intronic
1008959646 6:57253299-57253321 GAGGCAGTTTTGGAAGGGTTTGG + Intergenic
1010377800 6:75193206-75193228 GTGCCAGTTTTGGAAGTGTTAGG + Intronic
1012339689 6:98104622-98104644 CAGGCAGCTGGGGAGGAGTTGGG + Intergenic
1016028726 6:139315313-139315335 GAGCCAGCTGTGGGGGAGACTGG - Intergenic
1018185461 6:161262435-161262457 GAGCCAGCTGTGGAAGAGTTTGG - Intronic
1018274823 6:162119395-162119417 GAGCAGAGTGTGGAAGAGTTTGG - Intronic
1019039470 6:169091558-169091580 GAGCCATCGGTGGAAGAATATGG + Intergenic
1020664940 7:11028801-11028823 GAGGCAGCGGCGGAAGAGGTAGG + Exonic
1020707733 7:11566947-11566969 GATCCAGCTGTGGGAGAGTGGGG + Intronic
1021897212 7:25248649-25248671 GAGCCAGCTGTGTGGGAGATGGG - Intergenic
1022360355 7:29650790-29650812 GAGGAAGAAGTGGAAGAGTTGGG + Intergenic
1022668543 7:32433228-32433250 GAGCCTGGGGTGGAAGATTTGGG - Intergenic
1022799815 7:33765701-33765723 GAGCCAGCTGTGAAAAAATTTGG + Intergenic
1025626533 7:63227306-63227328 GAGCCAGCTAAGCAAGAGATAGG - Intergenic
1025739433 7:64183553-64183575 GAGCCAGGTGGGCGAGAGTTGGG + Intronic
1026566374 7:71492881-71492903 GAAGTAGCTGTGGAAGATTTGGG + Intronic
1027798483 7:82722789-82722811 TAGCCAGCAGAGGAGGAGTTTGG - Intergenic
1028378495 7:90173331-90173353 TAGCCAGCTGTGCAAGTCTTTGG - Intronic
1030766697 7:113419274-113419296 GAGCAAGTTGGGGAATAGTTTGG + Intergenic
1033791275 7:144795263-144795285 TAGCCAGCTCTGCAAGAGTGGGG + Intronic
1034897518 7:154886853-154886875 GAGCCCGCTGTGAAGGTGTTGGG - Intronic
1035044297 7:155953739-155953761 GAGCCTGCTGTGCATGAGTGGGG + Intergenic
1035459275 7:159029350-159029372 GAGCCAGCTGCAGAAGGGTGGGG - Exonic
1037928424 8:22863313-22863335 GAGCCAGCTGTGCAGAAGATGGG - Intronic
1038186002 8:25275419-25275441 GAGGCAACTGTGGAAGACCTGGG + Exonic
1040386377 8:46917584-46917606 GAGCCAGCTGTGCAGGAGACTGG - Intergenic
1040493612 8:47947203-47947225 GAGACAGCTGGGGAAGTGCTGGG - Intronic
1040647649 8:49418632-49418654 GAGCCAGCTGTGTGAGAGACTGG - Intergenic
1041478837 8:58295703-58295725 GAGCCAGCTGTGCAGGAGACTGG - Intergenic
1047233503 8:123018151-123018173 TAGCAAGATGTGGAAGGGTTTGG + Intronic
1047529449 8:125661851-125661873 TAGCCAGGTGTTGAAGAGTGTGG - Intergenic
1048286122 8:133142994-133143016 GAGCTAGCCGTGGAAGAGCTGGG + Intergenic
1049299691 8:141862975-141862997 GAGCCAGCTGAGGCCCAGTTGGG + Intergenic
1049814921 8:144594364-144594386 GTGGCCACTGTGGAAGAGTTTGG + Intronic
1050138854 9:2496364-2496386 GAGCCAGCTGTGCAAGGCTGAGG - Intergenic
1051643635 9:19246978-19247000 GAGCCAGCCTGGAAAGAGTTGGG - Intronic
1053128339 9:35600485-35600507 GAGACAGGCGTGGAACAGTTAGG - Intergenic
1053310751 9:37017755-37017777 GTGCCAACTGTGGAAGACTGCGG + Intronic
1054946065 9:70797520-70797542 GAGAGAGCTCTGGAAGAGATGGG - Intronic
1057468688 9:95338560-95338582 GAGTCAGGTGTGGAAGGGTGAGG - Intergenic
1059437332 9:114284604-114284626 CAGCCAGCTGGGGCAGAGCTGGG + Intronic
1059536058 9:115081939-115081961 GAGGCAGCTTGGTAAGAGTTAGG + Intronic
1059651381 9:116319098-116319120 GACCCAGCAGTGAAAGACTTGGG - Intronic
1060053362 9:120392641-120392663 AAGGCAGCTGTGGAATATTTAGG - Intronic
1061218698 9:129236622-129236644 CAGCCAGCAGTGGCAGAGCTGGG + Intergenic
1061506273 9:131033581-131033603 GAGGAAGCTGTGGAAGGATTTGG + Intronic
1061858592 9:133456431-133456453 TAGCCAGCAGTGGGAGAGGTGGG + Intronic
1185737922 X:2507172-2507194 GATTCAGGTGTGGAAGACTTTGG + Intergenic
1186166551 X:6832600-6832622 GAGCTAACTGTGAAAGAGATAGG + Intergenic
1187445767 X:19359552-19359574 GAGCCACCTTTGGAAGAGCTGGG + Exonic
1188247946 X:27856825-27856847 GAGTCAGCTCTGGAAGAATCTGG - Intergenic
1188495988 X:30783455-30783477 GAGCCAGATGTGCAGGAGATGGG - Intergenic
1188751184 X:33907375-33907397 GAGCCAGCTGTGTAGGAGACAGG - Intergenic
1190478460 X:50850868-50850890 GAGCCAGCTGTGCAGGAGACTGG + Intergenic
1191675609 X:63789258-63789280 GAGCCAGCCATGTAAGAGGTAGG + Intergenic
1192463283 X:71336280-71336302 GAGCCAGCTGTGGAGGAGACCGG + Intergenic
1194476105 X:94361617-94361639 GAGCTAGCTGTGCAAGAGACAGG - Intergenic
1194758459 X:97765715-97765737 GAGCCAGCTGTGTGGGAGATCGG + Intergenic
1194932484 X:99904400-99904422 GAGCCAGCTGTGGGGGAGACTGG + Intergenic
1196441373 X:115722845-115722867 GAGGCAGCTTTGGGAAAGTTGGG - Intergenic
1196444902 X:115840834-115840856 GAGGCAGCTTTGGGAAAGTTGGG - Intergenic
1196543870 X:116939873-116939895 GAGCCAGCTGTGCAGGAGACTGG - Intergenic
1200008517 X:153104041-153104063 GGGACAGCTGTGGAGGAGTGCGG + Intergenic
1201319722 Y:12684851-12684873 GGGACAGTTGTGGAAGAGGTAGG + Intergenic