ID: 1018186831

View in Genome Browser
Species Human (GRCh38)
Location 6:161272916-161272938
Sequence TGAGTAACAAATTAACTGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 112}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018186831_1018186833 0 Left 1018186831 6:161272916-161272938 CCCGGCAGTTAATTTGTTACTCA 0: 1
1: 0
2: 0
3: 13
4: 112
Right 1018186833 6:161272939-161272961 TACTTGTTGAACTTAAGATTTGG 0: 1
1: 0
2: 1
3: 15
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018186831 Original CRISPR TGAGTAACAAATTAACTGCC GGG (reversed) Intronic
912760872 1:112366175-112366197 TGAGCCACAAACTAACTGCCTGG - Intergenic
917325792 1:173830611-173830633 TGAGAAACAAATGAACTTACAGG - Intronic
918328188 1:183430530-183430552 TGAATAAAAAATTAATTGACAGG + Intergenic
918596932 1:186305630-186305652 TGACTAAAAGATTAAATGCCTGG - Intronic
918742697 1:188155375-188155397 AGAGTAACAAAAATACTGCCAGG - Intergenic
920177228 1:204109594-204109616 TGAATAACAAAGAAATTGCCTGG + Intronic
922326023 1:224529286-224529308 TGCTAAATAAATTAACTGCCAGG - Intronic
923318827 1:232808132-232808154 TTAGTAATAAATAAACTTCCAGG + Exonic
1063775841 10:9262853-9262875 TGAATAACAAATTAGGGGCCTGG - Intergenic
1064765376 10:18665095-18665117 TGAGGAACAAACAGACTGCCTGG - Intronic
1064999494 10:21324832-21324854 CCAGAAACAAAATAACTGCCAGG + Intergenic
1065055966 10:21842663-21842685 TGAGGCACAAATGAACTGGCAGG + Intronic
1067275897 10:44833924-44833946 TGAGTGACAAAAAAAATGCCAGG - Intergenic
1068435611 10:56987827-56987849 TGAGTAAAACATTAACTGGATGG - Intergenic
1069097815 10:64281196-64281218 TTAGTAAAAAATTAGCGGCCAGG - Intergenic
1069101366 10:64325159-64325181 TAAGTCAAAAATTAACTTCCAGG - Intergenic
1072771633 10:98144865-98144887 AGAGTAACAAATTGACTGGAGGG + Intronic
1072968777 10:99998280-99998302 TAAGAAACACATTAACGGCCGGG + Intronic
1073670792 10:105585442-105585464 TGATTACCAAAATAACTGCAGGG - Intergenic
1078844151 11:15106765-15106787 TGAGTCACAAAGTTACTGCGGGG - Intergenic
1079684986 11:23348001-23348023 TGAGTAATATATTAACTGTAGGG + Intergenic
1084110890 11:67013606-67013628 TCAGTAACAAGGTAACTGGCTGG - Intronic
1086511731 11:87565698-87565720 TGATCATCAAATTTACTGCCTGG - Intergenic
1086825876 11:91495779-91495801 TGAGTAACTGAATAATTGCCAGG - Intergenic
1088853921 11:113729201-113729223 TGAGTTTCAAATACACTGCCTGG + Intergenic
1097572555 12:61352949-61352971 AGGGTACCAAATTAATTGCCTGG - Intergenic
1103661578 12:122523970-122523992 ACAGTAAGAAATTAACTACCAGG + Intronic
1110577588 13:77077338-77077360 TGGGTAACAAGTGAACTTCCAGG - Exonic
1113090517 13:106613118-106613140 TGAGTAACAAATTATCTTAAAGG - Intergenic
1115586700 14:34821478-34821500 TGAGTAATAAATTGACTTCCAGG - Intronic
1116226450 14:42159628-42159650 TGAGTAACAAATCCTCTGCTGGG + Intergenic
1120306935 14:82782770-82782792 TGGGTAAGAAATGATCTGCCAGG + Intergenic
1121748347 14:96321607-96321629 TTAGTATCAAAATACCTGCCTGG + Intronic
1126851993 15:52802902-52802924 CCAGTAATAATTTAACTGCCAGG + Intergenic
1129585362 15:76857458-76857480 AAAGAAAAAAATTAACTGCCTGG + Intronic
1131195273 15:90350362-90350384 TCAGTAACAAAGTAACACCCAGG - Intergenic
1135070475 16:19347207-19347229 TGAGTAACAATTTTGGTGCCTGG + Intergenic
1153464081 18:5369508-5369530 TGAGTAAGAAATAAACTACGTGG - Intergenic
1158226329 18:55205302-55205324 TGAGTCACAAAATAACAGCTTGG - Intergenic
1164521708 19:28984719-28984741 TGAGTACCATGTTCACTGCCTGG + Intergenic
1164914059 19:32036042-32036064 TTATAAACAAATTAACTGCAAGG - Intergenic
1165570821 19:36773212-36773234 TGAGTTCCAAACTAACAGCCAGG - Exonic
1165939664 19:39408693-39408715 TGAGTGACAAAGTGACTGCCCGG + Exonic
925504522 2:4546192-4546214 TGAAAAACAAATTTACTGTCTGG - Intergenic
925626163 2:5843723-5843745 TGAGTTTCAAAGTAAGTGCCTGG + Intergenic
925787916 2:7451177-7451199 TGAGTAACACATTAAATTGCAGG - Intergenic
925824668 2:7835897-7835919 TGAGAAACAAATTAATTCCCCGG - Intergenic
928647072 2:33365807-33365829 GTAGTAAAAAATGAACTGCCAGG - Intronic
928739786 2:34337914-34337936 TGAGTCACAAAGTAGCTGTCAGG + Intergenic
930412256 2:51039864-51039886 TCAGTTATGAATTAACTGCCTGG + Intergenic
930709071 2:54533084-54533106 TGATTATCAGATTAACTGTCAGG - Intronic
930788362 2:55296301-55296323 AGAGTAACAACTTCACTTCCAGG + Exonic
932711388 2:74066920-74066942 AAAGTAACAAATTGACTGCAGGG - Intronic
938688460 2:133763888-133763910 TGAGGAAAATAATAACTGCCGGG + Intergenic
938922934 2:136011836-136011858 TGAGTAAAGAAATAAATGCCCGG + Intergenic
942072500 2:172328566-172328588 CGAGTAATAAACTAAATGCCTGG + Intergenic
945878863 2:215306039-215306061 TCAGTAAGAAATTCTCTGCCAGG + Intergenic
946125938 2:217562724-217562746 TGACTTGCAAATTAACAGCCTGG - Intronic
946231902 2:218296593-218296615 AGAGTAACACATTAAATGCTAGG - Intronic
946743973 2:222827684-222827706 TGAATAGCTAATTAACTACCTGG - Intergenic
1172985138 20:38980458-38980480 TGAGTACCTTATTAAGTGCCAGG - Intronic
1175645895 20:60671391-60671413 TGAGTCACAAACTCACAGCCGGG - Intergenic
1177065900 21:16435780-16435802 TCAGAAACAAATTAACTGAAAGG + Intergenic
1177357090 21:20022287-20022309 TGAGTTACAATGTAACTGCCTGG - Intergenic
1179924120 21:44523130-44523152 TGACTGACAAATTAACTGACTGG - Intronic
1179924127 21:44523214-44523236 TGACTGACAAATTAACTGACTGG - Intronic
1182124555 22:27807104-27807126 TAAGGGACAAAATAACTGCCGGG + Intergenic
1182701400 22:32242411-32242433 TAAGTATCAAAATAACTGGCTGG + Intronic
950169337 3:10826899-10826921 TGAGTAACCAAGTAGCTGGCAGG - Intronic
951606477 3:24440230-24440252 TGAGTAACAGAATTACTACCTGG - Intronic
951913349 3:27774110-27774132 TGAGTCCCTAATTAACTGCCTGG - Intergenic
952571720 3:34725803-34725825 AGAGGAAAAAATTAAGTGCCAGG - Intergenic
953283691 3:41583529-41583551 ACAGTAACATATTACCTGCCAGG + Intronic
953738798 3:45518619-45518641 TGTGTAACAAAGTAACTGAGTGG - Intronic
959161560 3:102730975-102730997 TCAGTAACTAATTTATTGCCAGG + Intergenic
959843546 3:111006394-111006416 AGAGTAAAAAATTCACTTCCAGG - Intergenic
965395324 3:168154932-168154954 TGAGGAAGAAAATAAATGCCAGG + Intergenic
966463578 3:180203971-180203993 TGAGGAACACAGTAACTGCCTGG - Intergenic
967224513 3:187278000-187278022 TGAGTAATAAAGTGTCTGCCTGG - Intronic
974391801 4:61280050-61280072 TAAGAAAGAAATAAACTGCCTGG - Intronic
975032649 4:69640707-69640729 TGAGTAACAAAAGAACTGGGAGG + Intronic
975563701 4:75731828-75731850 TCAGTAACTACTTAACTGACAGG - Intronic
975707165 4:77122623-77122645 GGAATAACAAATTAACTACAAGG + Intergenic
983195701 4:164803832-164803854 TGGGTAACAAAATAATAGCCTGG - Intergenic
983686604 4:170417299-170417321 TGAGTAACAAATTAATTTCTAGG - Intergenic
987919507 5:24260555-24260577 TGAATAACAATTTAGCTGCCAGG + Intergenic
989597045 5:43166239-43166261 TCAGTCACAACTTAACTACCTGG + Intronic
989780398 5:45257409-45257431 TGAGTAATACATTAAATGCTGGG - Intergenic
993735485 5:91471328-91471350 TGATTAATCAATTAACTGCATGG - Intergenic
994218945 5:97172352-97172374 TGAGTAGCAAATTAACTGGAAGG - Intronic
994252482 5:97552567-97552589 AAATTAACAACTTAACTGCCAGG + Intergenic
995676333 5:114666647-114666669 CAAATAACCAATTAACTGCCAGG + Intergenic
995831221 5:116358203-116358225 TGAGTGACAGATTCACTGTCAGG - Intronic
1002183637 5:177443905-177443927 TGAGTACCAAACTAACCACCTGG + Intergenic
1008058497 6:46971658-46971680 TGAGTAACAATTCAAATTCCAGG + Intergenic
1008164672 6:48121636-48121658 TAAGTAACAAATTCACTGGATGG - Intergenic
1008243309 6:49140105-49140127 TGACTAAGAAATTAACTGATAGG - Intergenic
1009571227 6:65388116-65388138 TGAGCAACAAGGTCACTGCCTGG + Intronic
1009640994 6:66336269-66336291 GGAGAAACAAATTAAGTGCATGG - Intergenic
1009978008 6:70693782-70693804 TGAGTCTCAAATCAACTTCCAGG - Intronic
1012380153 6:98611347-98611369 TGGGTAAAAAATTAACTTTCAGG - Intergenic
1016702958 6:147074698-147074720 TGAGTAACACTTCAACTGTCAGG + Intergenic
1018186831 6:161272916-161272938 TGAGTAACAAATTAACTGCCGGG - Intronic
1027460245 7:78443001-78443023 TTAGTATCAAGTTAACTGACAGG - Intronic
1027577811 7:79952813-79952835 TGAGTGACAAAATAACTACTGGG + Intergenic
1027733640 7:81906005-81906027 TGAGTTACAACTTACATGCCAGG - Intergenic
1028583368 7:92429401-92429423 TGAGCAACAACTGAACTGACAGG + Intergenic
1031166491 7:118234656-118234678 TGAGTAACCAATTTACTACTTGG - Intronic
1032696101 7:134337707-134337729 TGAGTACCTAATTACCAGCCAGG + Intergenic
1032995160 7:137437032-137437054 TAAGTAAGAAGTTCACTGCCAGG - Intronic
1035060519 7:156066138-156066160 TGAGTAACAAAACAGCTACCTGG - Intergenic
1036035173 8:5010810-5010832 TGATAAGCAAATTAACAGCCAGG - Intergenic
1044674626 8:94717124-94717146 TGAGTAAGAAAATAAAGGCCTGG - Intergenic
1046148338 8:110191012-110191034 TCAGTAAAAAGTTAACTGCAGGG - Intergenic
1047738365 8:127786452-127786474 TAAATAACAAATTAAATGACTGG + Intergenic
1047895961 8:129366418-129366440 AGAATAAAAAATCAACTGCCTGG + Intergenic
1049525031 8:143120687-143120709 TGAGTAAGAGATTAAATGCAAGG - Intergenic
1051778825 9:20666273-20666295 TGAATAAAAAAATAACTGGCTGG + Intronic
1052542846 9:29833130-29833152 ATTGTAACAAATTAACTGACGGG + Intergenic
1054191727 9:61989474-61989496 GGACTAACAAATTAGCTGCAAGG + Intergenic
1054646643 9:67598238-67598260 GGACTAACAAATTAGCTGCAAGG - Intergenic
1058480694 9:105391444-105391466 TGAGTTGCAAATTAATTGCCAGG + Exonic
1059090237 9:111348865-111348887 AGACTCCCAAATTAACTGCCTGG + Intergenic
1188992291 X:36836402-36836424 TGTGTAACAAATGCACTTCCAGG - Intergenic
1195695331 X:107662897-107662919 GGAGTAATTAAATAACTGCCTGG + Intergenic
1199496973 X:148463329-148463351 TGAGCCACAAATGAACTGCATGG - Intergenic