ID: 1018187096

View in Genome Browser
Species Human (GRCh38)
Location 6:161274695-161274717
Sequence GTGTGTGCACGCCTGTGCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018187096_1018187098 17 Left 1018187096 6:161274695-161274717 CCACTGCACAGGCGTGCACACAC No data
Right 1018187098 6:161274735-161274757 CATGCACGTGGCATTTACACAGG No data
1018187096_1018187099 30 Left 1018187096 6:161274695-161274717 CCACTGCACAGGCGTGCACACAC No data
Right 1018187099 6:161274748-161274770 TTTACACAGGTGTATCAGAGAGG No data
1018187096_1018187097 5 Left 1018187096 6:161274695-161274717 CCACTGCACAGGCGTGCACACAC No data
Right 1018187097 6:161274723-161274745 GTCGCATGCTCACATGCACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018187096 Original CRISPR GTGTGTGCACGCCTGTGCAG TGG (reversed) Intergenic
No off target data available for this crispr