ID: 1018196685

View in Genome Browser
Species Human (GRCh38)
Location 6:161361594-161361616
Sequence GTGGTATCCCTGACAGTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 240}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018196677_1018196685 3 Left 1018196677 6:161361568-161361590 CCCCGTGAAATGGGCAGGGCACA 0: 1
1: 0
2: 1
3: 13
4: 124
Right 1018196685 6:161361594-161361616 GTGGTATCCCTGACAGTGGTGGG 0: 1
1: 0
2: 1
3: 15
4: 240
1018196678_1018196685 2 Left 1018196678 6:161361569-161361591 CCCGTGAAATGGGCAGGGCACAT 0: 1
1: 0
2: 2
3: 18
4: 208
Right 1018196685 6:161361594-161361616 GTGGTATCCCTGACAGTGGTGGG 0: 1
1: 0
2: 1
3: 15
4: 240
1018196672_1018196685 14 Left 1018196672 6:161361557-161361579 CCAAAATAGGACCCCGTGAAATG 0: 1
1: 0
2: 1
3: 1
4: 54
Right 1018196685 6:161361594-161361616 GTGGTATCCCTGACAGTGGTGGG 0: 1
1: 0
2: 1
3: 15
4: 240
1018196679_1018196685 1 Left 1018196679 6:161361570-161361592 CCGTGAAATGGGCAGGGCACATG 0: 1
1: 0
2: 1
3: 18
4: 216
Right 1018196685 6:161361594-161361616 GTGGTATCCCTGACAGTGGTGGG 0: 1
1: 0
2: 1
3: 15
4: 240
1018196671_1018196685 22 Left 1018196671 6:161361549-161361571 CCAAACATCCAAAATAGGACCCC 0: 1
1: 0
2: 0
3: 5
4: 83
Right 1018196685 6:161361594-161361616 GTGGTATCCCTGACAGTGGTGGG 0: 1
1: 0
2: 1
3: 15
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018196685 Original CRISPR GTGGTATCCCTGACAGTGGT GGG Intronic
902019403 1:13331622-13331644 CTGGTATACCTGAAAGTGATGGG + Intergenic
906900984 1:49836193-49836215 TTGGTATACCTGAAAGTGATGGG - Intronic
907027235 1:51132618-51132640 TTGGTATCCCTGAAAGAGATGGG + Intronic
908415854 1:63912656-63912678 GTTGTATCCTTGACACTGTTGGG + Intronic
910865000 1:91780219-91780241 GTGGTATTCCTGACTGTGATAGG - Intronic
911213051 1:95163119-95163141 CTGGTATACCTGAAAGTGATGGG - Intronic
911217825 1:95215304-95215326 CTGGTATACCTGAAAGTGATGGG - Intronic
911338172 1:96605759-96605781 TTGGTATACCTGAAAGTGATGGG + Intergenic
913054926 1:115149202-115149224 TTGGTATACCTGAAAGTGATGGG + Intergenic
914458205 1:147856371-147856393 TTGGTATACCTGAAAGTGATGGG + Intergenic
917549238 1:176006966-176006988 TTGGTATACCTGAAAGTGATGGG - Intronic
920090786 1:203451508-203451530 GTGGTTTCACTGTCAGTGGATGG + Intergenic
920845662 1:209591181-209591203 GAGGTCTCACTGGCAGTGGTGGG - Intronic
920995490 1:210986901-210986923 CTGGTATACCTGAAAGTGATGGG - Intronic
921461389 1:215431768-215431790 TTGGTATACCTGAAAGTGATGGG - Intergenic
922396948 1:225211525-225211547 TTGGTGTACCTGAAAGTGGTGGG + Intronic
922795037 1:228335633-228335655 GTGGTCACCCTGACAGTGATGGG - Intronic
1064236461 10:13580665-13580687 GTGGTAACCCTGGCTGAGGTGGG + Intergenic
1067338763 10:45384294-45384316 GTGCTGTCCCTGAAAGTGATTGG - Intronic
1068263724 10:54619868-54619890 GTGTTATCCAAGACAGGGGTTGG + Intronic
1070758654 10:79009336-79009358 GGAGTGTCCCTGGCAGTGGTGGG - Intergenic
1070762416 10:79032530-79032552 GTGTTATCCCTCACAGTTCTTGG - Intergenic
1070999887 10:80819347-80819369 TTGGTATCCCTGAAAGTGACAGG + Intergenic
1072774930 10:98181633-98181655 GTGGTATACCTGAAAGTGACGGG - Intronic
1072912368 10:99514794-99514816 GTGGTGTACGTGACATTGGTGGG - Intergenic
1076592026 10:131589987-131590009 GGGGTATCCCTGAGAGAGGAGGG + Intergenic
1078951833 11:16142875-16142897 TTGGTATACCTGAAAGTGATGGG + Intronic
1079577954 11:22026470-22026492 TTGGTATACCTGACAGTGACGGG + Intergenic
1080234724 11:30055824-30055846 TTGGTATACCTGAAAGTGATGGG - Intergenic
1083231771 11:61326079-61326101 GTGGTAGCCCTGATAATGGGGGG - Intronic
1085209446 11:74761921-74761943 TTGGTATACCTGAAAGTGATGGG - Intronic
1086171036 11:83836706-83836728 GTTGTCTCTCTGATAGTGGTAGG - Intronic
1086422624 11:86652118-86652140 CTGGTATGCCTGAAAGTGATGGG + Intronic
1086979381 11:93177069-93177091 TTGGTATACCTGAAAGTGTTGGG - Intronic
1090252982 11:125264102-125264124 GTGCCATCCCTGACACTGTTAGG + Intronic
1090312852 11:125757434-125757456 TTGGTGTACCTGAAAGTGGTGGG + Intergenic
1090358080 11:126153962-126153984 TTAGTATCCCCTACAGTGGTGGG + Intergenic
1090895961 11:130975701-130975723 TTGGTATACCTGAAAGTGATGGG - Intergenic
1091529158 12:1338149-1338171 CTGGTATCCCTGAAAGAGATGGG - Intronic
1092398754 12:8153366-8153388 TTGGTATACCTGAAAGTGATGGG - Intronic
1093153973 12:15657845-15657867 CTGGTATCTCTGACAGTGCTAGG - Intronic
1093694925 12:22148028-22148050 GTGGTGTACCTGAAAGTGATGGG + Intronic
1094430625 12:30365965-30365987 TTGGTATACCTGAAAGTGATGGG - Intergenic
1094824685 12:34260744-34260766 GGGCTATCCCTGACAGGGGCAGG - Intergenic
1095910838 12:47424803-47424825 GTGATATCACTAGCAGTGGTGGG - Intergenic
1096326688 12:50669102-50669124 TTGAAATCCCTGACTGTGGTTGG + Intronic
1096671137 12:53198851-53198873 CTGGTATCCCTGGGACTGGTTGG + Intronic
1097309548 12:58103207-58103229 GTGGTGTCCCTGACAGGGAGAGG + Intergenic
1099266399 12:80452983-80453005 TTGGTATACCTGAAAGTGATGGG - Intronic
1100073768 12:90754098-90754120 TTGGTATACCTGAAAGTGATGGG - Intergenic
1101929177 12:108998335-108998357 TTGGTATACCTGAAAGTGATGGG + Intronic
1103704749 12:122865480-122865502 GTGGCATCCCCGACAGCGGCCGG + Exonic
1104770326 12:131357692-131357714 GTGGTATTGCTTTCAGTGGTTGG - Intergenic
1108304760 13:49119864-49119886 TTGGTATACCTGAAAGTGATGGG + Intronic
1110479209 13:75954701-75954723 TTGGTATACCTGAAAGTGATGGG - Intergenic
1110826463 13:79976552-79976574 TTGGTGTACCTGAAAGTGGTGGG + Intergenic
1112731923 13:102372726-102372748 TTGTTTTTCCTGACAGTGGTAGG - Intronic
1114058809 14:19000500-19000522 TTGGTCTCCCTGAGAGTGGCTGG + Intergenic
1114103735 14:19401254-19401276 TTGGTCTCCCTGAGAGTGGCTGG - Intergenic
1116209076 14:41910213-41910235 GTGGTGTACCTGAAAGTGATGGG - Intergenic
1117900501 14:60527869-60527891 TTGGTATACCTGAAAGTGATGGG - Intergenic
1119930434 14:78541231-78541253 TTGGTTTCCCTGAAAGTGATGGG - Intronic
1120065896 14:80040324-80040346 TTGGTATACCTGAAAGTGATGGG + Intergenic
1120641152 14:87014750-87014772 GTTGTATCACTGACAGTTGGAGG - Intergenic
1122262480 14:100531225-100531247 GGGGTATCCCAGACAGAGGGAGG + Intergenic
1202835089 14_GL000009v2_random:72069-72091 ATTGTATTCCTGACAGTTGTAGG + Intergenic
1123911877 15:24976378-24976400 TTGGTATCCATGACTGTGGAGGG + Exonic
1124419906 15:29511822-29511844 GTGGTGTGCCTTACAGTTGTTGG - Intronic
1124821732 15:33052951-33052973 GTGGTTTCTCTGCCTGTGGTTGG - Intronic
1125779363 15:42250855-42250877 TTGGTATACCTGAAAGTGATGGG - Intronic
1126302486 15:47213695-47213717 GTGGTGTGCCTGACATTGTTTGG + Intronic
1126597574 15:50397630-50397652 GTGGAGTGCCTGACAGTGGGGGG + Intergenic
1128311149 15:66632368-66632390 GTGGGACCCCTCACAGTCGTGGG - Intronic
1128861637 15:71078988-71079010 GTGGTTATTCTGACAGTGGTAGG + Intergenic
1130879839 15:88045512-88045534 GTGCTACCCCAGACACTGGTAGG + Intronic
1133203473 16:4218767-4218789 GTGGTCTTCCTGGCAGTTGTAGG - Intronic
1136618268 16:31411371-31411393 GGGGCAGCCCTGACAGTGTTGGG + Exonic
1136780055 16:32892702-32892724 TTGGTATACCTGAAAGTGATAGG + Intergenic
1136890555 16:33968825-33968847 TTGGTATACCTGAAAGTGATAGG - Intergenic
1138060505 16:53885037-53885059 GTGGTAACCATGACAGGAGTTGG - Intronic
1203082476 16_KI270728v1_random:1154789-1154811 TTGGTATACCTGAAAGTGATAGG + Intergenic
1146751755 17:35388268-35388290 CTGGAATCCCTGAAAGGGGTGGG - Intergenic
1153316246 18:3725088-3725110 GTGGTTTCCCAGAAAGTAGTAGG - Intronic
1153384460 18:4476766-4476788 TTGGTATACCTGAAAGTGATGGG - Intergenic
1153592278 18:6686265-6686287 GTGGTTTCACAGACAGTGATGGG - Intergenic
1156186521 18:34670044-34670066 TTGGTATACCTGAAAGTGATGGG - Intronic
1156624759 18:38895261-38895283 GTGGTCTCTCTGACAGTGTCTGG - Intergenic
1157557152 18:48620311-48620333 GTGGCATCCCTGACCTTGGAGGG + Intronic
1158694684 18:59693394-59693416 TTGGTCTCCCTGAGAGTGGGTGG + Intronic
1162124185 19:8490449-8490471 GTGCCAGCCCTGACCGTGGTGGG - Intronic
1163302770 19:16458113-16458135 GGGGTGTTCCTGACAGTGGGGGG + Intronic
1164347561 19:27285159-27285181 TTGGTATACCTGAAAGTGATGGG - Intergenic
1166655010 19:44604748-44604770 GTGGGATAACTGAAAGTGGTGGG - Intergenic
1167741904 19:51328928-51328950 GCGTTATCCCTCACAGTGATGGG - Exonic
1202637537 1_KI270706v1_random:55279-55301 ATTGTATTCCTGACAGTTGTAGG - Intergenic
925431535 2:3798988-3799010 TTGGTATACCTGAAAGTGATGGG - Intronic
925467408 2:4119637-4119659 TTGGTGTACCTGAAAGTGGTGGG - Intergenic
929217535 2:39431501-39431523 ACTGTATCCCTGAAAGTGGTGGG + Intronic
930728718 2:54708539-54708561 GTGCTATTGATGACAGTGGTGGG + Intergenic
930834802 2:55782112-55782134 TTGATATCCCTGAAAGTGGGAGG + Intergenic
930860196 2:56064166-56064188 TTGGTATACCTGAAAGTGATGGG - Intergenic
931488959 2:62724088-62724110 CTGGTATCCCTGAAAGAGATGGG - Intronic
932595373 2:73089939-73089961 GAGGTATTCCTGACAGGGCTTGG - Intronic
932938802 2:76138323-76138345 TTGGTATACCTGAAAGTGATGGG - Intergenic
934675455 2:96246660-96246682 GTGGCACCGCTGGCAGTGGTTGG - Intergenic
935256790 2:101316868-101316890 TTGGTATACCTGAAAGTGATGGG + Intergenic
938282386 2:130073717-130073739 TTGGTCTCCCTGAGAGTGGCTGG - Exonic
938333016 2:130462289-130462311 TTGGTCTCCCTGAGAGTGGCTGG - Exonic
938356793 2:130658382-130658404 TTGGTCTCCCTGAGAGTGGCTGG + Intergenic
938433229 2:131265188-131265210 TTGGTCTCCCTGAGAGTGGCTGG + Exonic
939840754 2:147183921-147183943 TTGGTATACCTGAAAGTGATGGG + Intergenic
940045674 2:149407350-149407372 TTGGTATACCTGAAAGTGATGGG - Intronic
940673399 2:156698384-156698406 GTGGCTTCCCTGACAGTGAGTGG - Intergenic
940891493 2:159040376-159040398 TTGGTATACCTGAAAGTGATGGG - Intronic
941149103 2:161891412-161891434 TTGGTGTACCTGAAAGTGGTGGG - Intronic
941704729 2:168645692-168645714 GGGGCCTCCCTGACGGTGGTGGG - Intronic
945486735 2:210405850-210405872 TTGGTGTACCTGACAGTGATGGG - Intergenic
945945370 2:215989920-215989942 TTGGTATACCTGAAAGTGATGGG + Intronic
946175460 2:217919632-217919654 GTGGGATCCCTGTGAGTTGTGGG - Intronic
947200563 2:227611368-227611390 ATGGTATCCCTGTCAGAGGTGGG + Exonic
947225695 2:227838298-227838320 TTGGTGTACCTGACAGTGGCGGG - Intergenic
948459627 2:238122845-238122867 GTGGTGTCACCGACAGAGGTGGG - Intronic
1169012959 20:2265975-2265997 TTGGTGTACCTGACAGTGATGGG + Intergenic
1170140980 20:13124688-13124710 GTGGCCTGCCTTACAGTGGTCGG - Intronic
1171443390 20:25185450-25185472 TTGGTATACCTGAAAGTGATGGG - Intergenic
1174543025 20:51304527-51304549 GTGCTATCTGTGACAGTGGCAGG - Intergenic
1174793900 20:53505236-53505258 TTGGTATACCTGAAAGTGATGGG + Intergenic
1176970062 21:15254685-15254707 ATGGTATTTCTGGCAGTGGTGGG - Intergenic
1178266443 21:31146828-31146850 GTTGTGTGGCTGACAGTGGTTGG - Intronic
1178799647 21:35780697-35780719 GTGGGATCCATGCCAGTGGTGGG - Intronic
1179068635 21:38051156-38051178 GTGGTCTCCCTGAGATTGGGAGG + Intronic
1180477294 22:15723116-15723138 TTGGTCTCCCTGAGAGTGGCTGG + Intergenic
1182560663 22:31156395-31156417 TTGGTATCCATGACTGTGGAGGG - Intergenic
1183773070 22:39943649-39943671 GTGCTTTCCCTGCCAGTGATGGG - Intronic
1184678379 22:46055552-46055574 CTGGTATTCCTGACAATGATGGG + Intronic
1184736223 22:46399225-46399247 GTGGTATCCCAGACAATGTTCGG - Intronic
949106879 3:210391-210413 GTGGTATCTCAGAGAGTGGCTGG + Intronic
949708640 3:6848077-6848099 GTGATATACCTGACAGAGTTTGG - Intronic
951123981 3:18962425-18962447 GTGGTGTACCTGAAAGTGATGGG - Intergenic
951873747 3:27396952-27396974 GTAGTATATCTGACAGTAGTTGG - Intronic
953286805 3:41618148-41618170 CTGGTATACCTGAAAGTGATAGG + Intronic
953517712 3:43612429-43612451 GTGGTATCCCTGAGAAAGGCAGG - Intronic
954048047 3:47949867-47949889 GTGGTATCCCTAAAACTGGTGGG - Intronic
954154888 3:48679981-48680003 GTAGCATCCCTCACAGTGCTAGG - Intronic
955022861 3:55137709-55137731 TTGGTATACCTGAAAGTGATGGG + Intergenic
956371962 3:68572447-68572469 GTGGTATCCCTGAAAGAGATGGG + Intergenic
959693055 3:109220105-109220127 TTGGTATACCTGAAAGTGATGGG + Intergenic
962090815 3:132242350-132242372 GTGGCATCCCAGACAGTGGGTGG + Intronic
962316091 3:134360372-134360394 GTGGTAGCAGTGGCAGTGGTGGG - Exonic
962394603 3:135004576-135004598 TTGGTATACCTGAAAGTGATGGG - Intronic
962397490 3:135029841-135029863 TTGGTATACCTGAAAGTGATGGG - Intronic
962752107 3:138441099-138441121 GTGGTATTGCTGGCTGTGGTAGG + Intronic
963048363 3:141121529-141121551 TTGGTATTCCTGAAAGTGATGGG - Intronic
964243320 3:154620884-154620906 GTGGTGTCCCTGAAAGTGACAGG + Intergenic
964286476 3:155124036-155124058 TTGGTATACCTGAAAGTGATGGG - Intronic
964371212 3:156002697-156002719 CTGGTGTACCTGACAGTGATGGG - Intergenic
964630381 3:158803076-158803098 GTGGTAGTCTTGACAGTGGTTGG + Intronic
964715396 3:159715775-159715797 TTGGTATACCTGAAAGTGATGGG + Intronic
965030242 3:163356350-163356372 TTGGTATACCTGAAAGTGATGGG - Intergenic
966251232 3:177867243-177867265 TTGGTATCCCTGAAAATGATGGG + Intergenic
967715766 3:192759592-192759614 TTGGTATACCTGAAAGTGATGGG + Intronic
973366364 4:49212689-49212711 TTGGTCTCCCTGAGAGTGGCTGG - Intergenic
973393275 4:49573785-49573807 ATTGTATTCCTGACAGTTGTAGG + Intergenic
973798553 4:54452707-54452729 TTGGTATACCTGAAAGTGATGGG + Intergenic
974065318 4:57072150-57072172 GGGGTCTACCTGACAGTGGAGGG - Intronic
976065704 4:81185002-81185024 GTGGTATACCTGAAAGTGATGGG + Intronic
976941220 4:90704591-90704613 TTGGTATACCTGAAAGTGATGGG - Intronic
977203728 4:94147106-94147128 TTGGTATACCTGAAAGTGATGGG - Intergenic
978313419 4:107410801-107410823 TTGGTATACCTGAAAGTGATGGG + Intergenic
979457761 4:120945595-120945617 TTGGTATACCTGAAAGTGATGGG + Intergenic
980200744 4:129653033-129653055 CTGGTGTACCTGAAAGTGGTGGG + Intergenic
980507160 4:133738555-133738577 TTGGTATACCTGAAAGTGATGGG - Intergenic
983101721 4:163633620-163633642 TTGGTATACCTGAAAGTGATGGG + Intronic
983668435 4:170208608-170208630 GTGGTGTACCTGAAAGTGATGGG + Intergenic
984201881 4:176732602-176732624 GTGGAATCCGTGAAAGTGGATGG + Intronic
985591337 5:766974-766996 GTGGTCTCCCTGACAGTGGGTGG - Intergenic
987949677 5:24659340-24659362 TTGGTGTCCCTGAAAGTGATGGG - Intergenic
990037359 5:51338061-51338083 GTAGTATTCATGACAGTTGTGGG + Intergenic
993563264 5:89439003-89439025 CTGGTTGCCTTGACAGTGGTAGG - Intergenic
993627170 5:90239761-90239783 TTGGTATACCTGAAAGTGATGGG + Intergenic
995364881 5:111347279-111347301 GAGGTCTACATGACAGTGGTTGG + Intronic
995467406 5:112465351-112465373 ATGGTGTACCTGAAAGTGGTGGG - Intergenic
996426458 5:123318895-123318917 TTGGTATACCTGAAAGTGATGGG - Intergenic
996477147 5:123934997-123935019 TTGGTATACCTGAAAGTGATGGG + Intergenic
997134520 5:131311560-131311582 TTGGTATACCTGAAAGTGATGGG - Intronic
999177045 5:149639007-149639029 GTAGCATCTCTGACAGTGGCCGG + Intergenic
999984086 5:156985977-156985999 TTGGTATACCTGAAAGTGATGGG + Intergenic
1002229911 5:177755359-177755381 TTGGTATACCTGAAAGTGATGGG + Intronic
1003710674 6:8586030-8586052 CTGGTGTACCTGAAAGTGGTGGG + Intergenic
1008396015 6:51007832-51007854 GTGGTTTCCCTGTGAGAGGTAGG - Intergenic
1009652217 6:66490560-66490582 TTGGTATACCTGAAAGTGATGGG + Intergenic
1011268654 6:85552723-85552745 GAGGTCTACGTGACAGTGGTTGG - Intronic
1011619534 6:89229880-89229902 TTGGTGTACCTGACAGTGATGGG - Intronic
1012540491 6:100356092-100356114 TTGGTGTCCCTGAAAGTGATGGG + Intergenic
1012757326 6:103248646-103248668 TTGGTATACCTGAAAGTGATGGG + Intergenic
1012941137 6:105416532-105416554 TTGGTATACCTGAAAGTGATGGG + Intergenic
1013939749 6:115646688-115646710 TTGGTATACCTGAAAGTGATGGG + Intergenic
1014379788 6:120725807-120725829 TTGGTGTACCTGAAAGTGGTGGG - Intergenic
1014975052 6:127870057-127870079 CTGATTTCCCTGACAGGGGTTGG - Intronic
1018196685 6:161361594-161361616 GTGGTATCCCTGACAGTGGTGGG + Intronic
1021755351 7:23846066-23846088 TTGGTATACCTGAAAGTGATGGG + Intergenic
1023509264 7:40933550-40933572 TTGGTATACCTGAAAGTGATGGG - Intergenic
1024516750 7:50265970-50265992 GTGGCATCTCTGAAGGTGGTGGG + Intergenic
1024624742 7:51196469-51196491 GTGGTGTCCCTGTCAGTTTTTGG + Intronic
1027637243 7:80690528-80690550 GTGGTATACCTGAAAGTGACAGG + Intergenic
1029789463 7:102827336-102827358 GTGGTTCTTCTGACAGTGGTTGG - Intronic
1030177872 7:106673255-106673277 CTGGTGTCCCTGAAAGTGATGGG + Intergenic
1030549068 7:110935614-110935636 TTGGTGTACCTGAAAGTGGTGGG - Intronic
1030612479 7:111704831-111704853 TTGGTATACCTGAAAGTGATGGG - Intergenic
1030944100 7:115694663-115694685 GTGATATCCATGACCTTGGTGGG - Intergenic
1031477443 7:122239909-122239931 TTGGTGTCCCTGAAAGTGATGGG + Intergenic
1031481483 7:122283536-122283558 TTGGTGTCCCTGAAAGTGATGGG - Intergenic
1031612405 7:123843614-123843636 TTGGTATACCTGAAAGTGATGGG - Intronic
1032250559 7:130253637-130253659 TTGGTATACCTGAAAGTGATGGG - Intergenic
1033651292 7:143345855-143345877 GTAGTTTCCCTGAAAGTAGTGGG + Intronic
1033962358 7:146929963-146929985 CTGGTGTACCTGACAGTGATGGG + Intronic
1035546883 8:488420-488442 GTGGTGGCTCTGTCAGTGGTTGG - Intergenic
1037655132 8:20876497-20876519 GAGGAATCCCTGCCAGTTGTTGG - Intergenic
1039146213 8:34450357-34450379 TTGGTATACCTGAAAGTGATGGG - Intergenic
1039965509 8:42280948-42280970 CTGGTATCCCTGACAGAGCTCGG - Intronic
1040540466 8:48348980-48349002 CTGGTGTCCCTGAAAGTGATGGG + Intergenic
1041634619 8:60129279-60129301 TTGCTATACCTGACAGTGATGGG - Intergenic
1043244289 8:77978353-77978375 TTGGTATACCTGAAAGTGATGGG - Intergenic
1044183127 8:89219699-89219721 TTGGTATACCTGAAAGTGATGGG + Intergenic
1044548409 8:93484750-93484772 CTGGTATACCTGAAAGTGATGGG + Intergenic
1044738076 8:95299514-95299536 GAGGTATCCCTGAGAGTGGAAGG + Intergenic
1045398486 8:101785855-101785877 CTGGAATCCCTGACACTGATGGG + Intronic
1045974941 8:108121646-108121668 GTGGTGTACCTGAAAGTGATGGG - Intergenic
1046845319 8:118908915-118908937 GTGGTGTCCCTGACAGAACTGGG + Intergenic
1048569893 8:135643426-135643448 CTGGTATCCCTGAGTGAGGTTGG - Intronic
1048805558 8:138237966-138237988 GTGATATCCCTGACACTGCCTGG - Intronic
1049744652 8:144258144-144258166 CTGGTCTCCCTGGCAGTGGCTGG - Intronic
1050943007 9:11484363-11484385 TTGGTGTACCTGAAAGTGGTGGG - Intergenic
1051112711 9:13657464-13657486 GTGGTATCCCTGAAGGGGGGTGG + Intergenic
1052514618 9:29463736-29463758 GTGGTATTCCTGAAAGAGATGGG + Intergenic
1053726477 9:41006919-41006941 TTGGTATACCTGAAAGTGATGGG - Intergenic
1054890119 9:70241827-70241849 TTGGTGTACCTGAAAGTGGTGGG + Intergenic
1055053072 9:71999109-71999131 TTGGTATACCTGAAAGTGATGGG - Intergenic
1055338826 9:75260575-75260597 TTGGTATACCTGACAGTGATGGG - Intergenic
1055682006 9:78724872-78724894 GTGGTAGCCCTGCCACTGGAGGG - Intergenic
1058796053 9:108499292-108499314 TTGGTGTCCCTGAAAGTGATGGG + Intergenic
1059954343 9:119500246-119500268 GTGGTGTCCCTGACTCTGGAGGG + Intronic
1061276928 9:129574323-129574345 GTTGTCTTCCTGACAGTGGTGGG - Intergenic
1185993468 X:4917043-4917065 GCGGTAACCCTGAAAGGGGTGGG - Intergenic
1186237065 X:7524644-7524666 TTGGTGTACCTGACAGTGATGGG + Intergenic
1188289602 X:28371106-28371128 CTGGCATCTCTGACAGTGATGGG - Intergenic
1190910613 X:54768996-54769018 TTGGTGTACCTGAAAGTGGTGGG - Intronic
1191115537 X:56848279-56848301 TTGGTATGCCTGAAAGTGATGGG + Intergenic
1191757166 X:64606080-64606102 TTGGTATGCCTGAAAGTGATAGG - Intergenic
1194708292 X:97201691-97201713 TTGGTATACCTGAAAGTGATGGG + Intronic
1195102463 X:101568362-101568384 GTGGTGTACCTGAAAGTGATGGG + Intergenic
1195557055 X:106238773-106238795 GTGGTCTACATGACAGTGGGGGG + Intergenic
1198643335 X:138779688-138779710 TTGGTATACCTGAAAGTGATGGG + Intronic
1200357750 X:155569359-155569381 TTGGTATACCTGAAAGTGATGGG + Intronic
1201353517 Y:13072404-13072426 CTGGTATACCTGAAAGTGATGGG + Intergenic
1201353602 Y:13073242-13073264 CTGGTATACCTGAAAGTGATGGG + Intergenic
1201409245 Y:13681999-13682021 GTGGGCTCCCTGAAAGTGATGGG + Intergenic