ID: 1018198603

View in Genome Browser
Species Human (GRCh38)
Location 6:161376121-161376143
Sequence CTGAAGCAGCAGTGGCTCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 403
Summary {0: 1, 1: 0, 2: 4, 3: 35, 4: 363}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018198603_1018198606 -8 Left 1018198603 6:161376121-161376143 CCCTGGAGCCACTGCTGCTTCAG 0: 1
1: 0
2: 4
3: 35
4: 363
Right 1018198606 6:161376136-161376158 TGCTTCAGTGTCCTCCACTGAGG No data
1018198603_1018198608 -4 Left 1018198603 6:161376121-161376143 CCCTGGAGCCACTGCTGCTTCAG 0: 1
1: 0
2: 4
3: 35
4: 363
Right 1018198608 6:161376140-161376162 TCAGTGTCCTCCACTGAGGGAGG 0: 1
1: 0
2: 0
3: 16
4: 198
1018198603_1018198611 18 Left 1018198603 6:161376121-161376143 CCCTGGAGCCACTGCTGCTTCAG 0: 1
1: 0
2: 4
3: 35
4: 363
Right 1018198611 6:161376162-161376184 GTGCACCTCCTAGCCTCTCCTGG 0: 1
1: 0
2: 1
3: 11
4: 153
1018198603_1018198607 -7 Left 1018198603 6:161376121-161376143 CCCTGGAGCCACTGCTGCTTCAG 0: 1
1: 0
2: 4
3: 35
4: 363
Right 1018198607 6:161376137-161376159 GCTTCAGTGTCCTCCACTGAGGG 0: 1
1: 0
2: 1
3: 16
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018198603 Original CRISPR CTGAAGCAGCAGTGGCTCCA GGG (reversed) Intronic
900254515 1:1691068-1691090 CTGAAGCTGCAGTCACACCATGG + Exonic
900263266 1:1744343-1744365 CTGAAGCTGCAGTCACACCATGG + Intronic
900989222 1:6090401-6090423 CTCCAGCTGCAGTCGCTCCAGGG - Exonic
900992545 1:6104587-6104609 CCAACGCAGCAGTGGCTCCGAGG + Exonic
901316739 1:8314890-8314912 CTGAAGCTGCAATGGCCCCGTGG - Intergenic
901323807 1:8355470-8355492 ATGGAGCAGCAGTGGCTGCATGG - Exonic
901328384 1:8384138-8384160 CTGAGGAAGCAGTGGACCCAAGG - Intronic
902057735 1:13616321-13616343 CTGACGTAGCACTGGATCCAAGG - Exonic
902277513 1:15350277-15350299 CGGAAGCAGGGGCGGCTCCAGGG + Intronic
902361683 1:15945462-15945484 GGGAAGCAGCAGAAGCTCCAGGG + Intronic
902761476 1:18583641-18583663 CTGAAAGAGCAATGGCTCCCCGG - Intergenic
903469271 1:23574406-23574428 AGGAAGCAGCAGTGCCTCAAAGG - Intergenic
903973234 1:27132843-27132865 CTTAATGAGCTGTGGCTCCAGGG + Intronic
904008727 1:27377940-27377962 GGGAAGCAGCAGGGGCTCTAGGG + Intergenic
904081001 1:27872570-27872592 CTGCAGCGGCACCGGCTCCATGG - Exonic
904369486 1:30039554-30039576 CTGAGGCAGCAGTAGGTACAAGG - Intergenic
904886206 1:33740457-33740479 CAGAAACAGCAGTGGCCCTAGGG + Intronic
906263895 1:44413853-44413875 CTGACGAAGCAGTGGCGACAGGG - Intronic
906552285 1:46674970-46674992 CTGAAGAAGCAAAGGCTGCAGGG - Intergenic
907368625 1:53982690-53982712 TTGAAGCAGCAGGAGCTCCCAGG + Intergenic
909961892 1:81856119-81856141 CTGAAGCAGCAGGTGCTTCTGGG + Intronic
910418707 1:87031283-87031305 CTGCAGCAGCAGTATTTCCACGG - Intronic
911943247 1:104073557-104073579 CAGAGGCGGCAGTGGCACCAGGG + Intergenic
912902367 1:113665864-113665886 CTGAACCTGCAGTATCTCCAAGG - Intronic
913602226 1:120432708-120432730 CTGAAGTGACAGTGGCTCCTTGG + Intergenic
914084824 1:144443930-144443952 CTGAAGTGACAGTGGCTCCTTGG - Intronic
914190832 1:145409091-145409113 CTGAAGTGACAGTGGCTCCTTGG - Intergenic
914363398 1:146956314-146956336 CTGAAGTGACAGTGGCTCCTTGG + Intronic
914488278 1:148130820-148130842 CTGAAGTGACAGTGGCTCCTTGG - Intronic
914588638 1:149085938-149085960 CTGAAGTGACAGTGGCTCCTTGG - Intronic
915137170 1:153740751-153740773 CAGCAGCAGCAGTGGCTGCAGGG - Intronic
915320347 1:155052719-155052741 CTGAAGGACCTGGGGCTCCAAGG - Exonic
915679801 1:157570250-157570272 CAGTAGCAGCAGAGGCCCCATGG + Intergenic
916259127 1:162822878-162822900 TTGAATCAGGCGTGGCTCCAGGG + Intergenic
916813860 1:168331507-168331529 ATTAAGCTGGAGTGGCTCCAGGG + Intergenic
916864943 1:168846424-168846446 CTGGTGCAGCAGTGGCGTCATGG - Intergenic
917367112 1:174244344-174244366 CTGAAGCAGGAGTAGCAGCATGG + Intronic
917627077 1:176857139-176857161 ATCAAGCAGCAGTGGCTGCCTGG - Intergenic
917951031 1:180036770-180036792 CTGAACCTGCAGTATCTCCAAGG + Intronic
918255639 1:182744211-182744233 TTAAAGCAGCAGTGACTGCAGGG - Intergenic
919701107 1:200631865-200631887 TTGAAGGGGCAGTGGCTACATGG + Intronic
919701516 1:200636201-200636223 AGGAATCAGTAGTGGCTCCAAGG - Intronic
919802159 1:201360573-201360595 CTCAGGCTGCAGTGGCTACAGGG - Intronic
919822904 1:201484134-201484156 CTGGAGAAGCAGGGGCTCCTAGG + Exonic
919919665 1:202160544-202160566 CTGAAGCAGCTGTGGCCCCCAGG + Exonic
919925289 1:202188889-202188911 CTGCTGCAGCAGCTGCTCCATGG - Intergenic
920799860 1:209176431-209176453 CTGAACCTGCAGTATCTCCAAGG + Intergenic
921175103 1:212586430-212586452 ATGACGTAGCAGTGACTCCATGG + Intronic
922322120 1:224498080-224498102 CTGCAGCAGCAGTGCCTTCCTGG + Intronic
922472846 1:225887536-225887558 CTGTAGCAGCAGCGGCTGCCGGG + Exonic
922480858 1:225939498-225939520 CTGTAGCAGCAGCGGCTGCCGGG + Exonic
922677828 1:227563624-227563646 CTGCAGCAGCAGAGTCACCAGGG - Exonic
922786406 1:228284643-228284665 CTGAAGCTTTAGTGGGTCCATGG + Intronic
923081976 1:230666343-230666365 CTAGAGCAGCAGAGTCTCCAGGG - Intronic
924052523 1:240092770-240092792 CAGCAGCAGCAGCAGCTCCAGGG + Exonic
924229100 1:241948515-241948537 CTGAAGGAGCAGCTGCTACACGG + Intergenic
924331784 1:242946808-242946830 CAGAAGCAGCAGTGGCAGTATGG - Intergenic
1063027590 10:2196706-2196728 CAGAAGCTGCATTGGCTCCTGGG + Intergenic
1066154416 10:32659467-32659489 CTGAACCTGCAGTATCTCCAAGG - Intronic
1067275608 10:44830398-44830420 CTGAACCCGCAATGTCTCCAAGG - Intergenic
1068579914 10:58727785-58727807 CTAAACCTGCAGTGTCTCCAAGG - Intronic
1070174499 10:73958532-73958554 CTGAAGGTGCAGTGGCACAATGG - Intergenic
1070625303 10:78046882-78046904 CAGCAGCAGCAGTGTCACCAGGG + Intronic
1070650820 10:78234919-78234941 CAGATGCAGCATTGGCTACATGG - Intergenic
1070668401 10:78361388-78361410 CAGAAGCAGCAGTAGCACCTGGG - Intergenic
1071882106 10:89910894-89910916 CAGCAGCAGCAGTGGCAGCATGG + Intergenic
1072555922 10:96513638-96513660 CAGCAGCAGCAGTGACACCAGGG + Exonic
1072577847 10:96716900-96716922 CTGTAGCAGCAGGGAGTCCATGG + Intronic
1073074174 10:100813174-100813196 CTGTGGGTGCAGTGGCTCCAGGG - Intronic
1073081743 10:100864932-100864954 TTGAAGAACCAGGGGCTCCAGGG + Intergenic
1074296405 10:112193317-112193339 CTCCAGTGGCAGTGGCTCCATGG - Intronic
1075216306 10:120539237-120539259 CTCTAACAGCAGTGGCTCTAGGG - Intronic
1075578511 10:123598276-123598298 CAGATGCAGGAGTGGCTCCCAGG - Intergenic
1075622923 10:123940797-123940819 CTGGAGCATCTGTGTCTCCATGG + Intergenic
1075830654 10:125408112-125408134 CTGCAGCAGCAGTGGCCGCATGG - Intergenic
1078659293 11:13273935-13273957 CTAAAGCACCAGTGGCCACATGG - Intergenic
1078900692 11:15639696-15639718 CTGTAATAGCAGTGGCTCCAAGG - Intergenic
1079312052 11:19375572-19375594 CTCAAGCAGCACTGGCTTGATGG - Intronic
1080593266 11:33743002-33743024 CTGAAACAGCTGGGGCTCCTGGG + Intronic
1080964176 11:37195145-37195167 CTGAGGCAGCCCTGGCCCCATGG + Intergenic
1081707617 11:45193945-45193967 CTGAAGGAGCAAGGGCTCCCTGG + Intronic
1083245443 11:61423681-61423703 CTGAAGAAACAGTTTCTCCAAGG + Intronic
1083259361 11:61514885-61514907 CTGAAACTACAGTGGCCCCATGG + Intergenic
1083430414 11:62611369-62611391 CTGAAGCCCCAGAGGCCCCAAGG + Intronic
1084065956 11:66704646-66704668 GAGAAGGAGCAGTGGCTCAACGG - Exonic
1084214343 11:67639431-67639453 CTGAAGCAGAGGTGGCCTCATGG - Intronic
1085319474 11:75565168-75565190 CAGCAGTAGCAGTGGCCCCAAGG - Intronic
1086007051 11:82049092-82049114 CTGGGGTGGCAGTGGCTCCAGGG + Intergenic
1087786563 11:102361393-102361415 GTGAAGCAGCTGTGGCTCTGGGG + Intronic
1089130707 11:116209746-116209768 CTGTAGCAGCTGTGGCTTCCCGG + Intergenic
1090276232 11:125421799-125421821 CTGGAGCAGCAAGGGCTCCCCGG - Intronic
1090423096 11:126589120-126589142 CTGGAGAGGCAGCGGCTCCAGGG - Intronic
1090523326 11:127502601-127502623 CTGAACCTGCAGTATCTCCAAGG + Intergenic
1091114977 11:133004569-133004591 ATGGAGCAGCAGTGCCTGCATGG - Intronic
1091333981 11:134753080-134753102 CAGCAGCAGCAGAGGCCCCACGG + Intergenic
1093434956 12:19126028-19126050 ATGAACCAGCAGTGTCTCCTAGG - Intergenic
1096602810 12:52742351-52742373 CTGAAGCAGCAGGGACTGGAGGG - Intergenic
1096652291 12:53067832-53067854 CTGAAGCCCCAGTGCCTGCAGGG - Intronic
1096817939 12:54213421-54213443 CTGAGGCACCAGTGGGTCCTTGG + Intergenic
1097675816 12:62602292-62602314 CAAAAGCAGAAGTGGCTCCATGG + Exonic
1098386806 12:69928402-69928424 CTGATCCAGCAGTGGCCCAAAGG + Intronic
1099747022 12:86718510-86718532 CTGAAACAGTAGAGGCTGCATGG + Intronic
1100359252 12:93861152-93861174 CTGAGGGAGCAGAGGCTGCAGGG + Intronic
1103596887 12:122029640-122029662 CTGAGCCATCAGTGGCTCCTTGG + Intronic
1105998101 13:25692364-25692386 CTGCAGCAGCTGCTGCTCCATGG + Intronic
1108747470 13:53409656-53409678 CTGCAGGAGGAGTGGCTCCCTGG + Intergenic
1108754312 13:53481459-53481481 CAGAAACAGCAGTGTGTCCAAGG - Intergenic
1109640123 13:65180588-65180610 CTGTACCAGAAGTGGCACCAGGG - Intergenic
1110211325 13:72976978-72977000 GTAAAGAAGCAGTGGCTCCCAGG - Intronic
1112502795 13:99955655-99955677 CAGAAGAAACAGTGGCTCCTGGG - Intergenic
1113145185 13:107200232-107200254 CTGAAGTAACTGTGGCTCCCAGG - Intronic
1113320467 13:109227765-109227787 CTGAAACAGAAGTCACTCCAGGG - Intergenic
1113931976 13:113973520-113973542 CTGAAGCAGGAGGGGCTTCCAGG - Intergenic
1114212988 14:20632010-20632032 CTGAAGCAGAGGTGGCTAGAAGG + Intergenic
1114227674 14:20753733-20753755 CTGGAGCTGAAGTGGCTCCCTGG - Intergenic
1115388924 14:32831714-32831736 GAGAAGCAGCAGTGGGTACAAGG + Exonic
1117106809 14:52405648-52405670 ATGAAGCAGCTGCAGCTCCAGGG - Intergenic
1117993943 14:61461132-61461154 CAGGAGCAGCATGGGCTCCAGGG - Intronic
1119573734 14:75699452-75699474 CTGCACCAGCAGTTACTCCATGG + Intronic
1119793613 14:77376639-77376661 CTGAAGCTGAAGAGGCGCCAGGG + Intronic
1120244282 14:81987991-81988013 CTGAAGCAGCAGTGGAGACCAGG - Intergenic
1120778411 14:88463115-88463137 CTGAAGGAGCAGCAGTTCCAAGG - Intronic
1120859072 14:89238218-89238240 CTGAAGCCGCAGTGCCTCAAGGG - Intronic
1121535166 14:94686157-94686179 CTGGGACAGCAGTGCCTCCAGGG + Intergenic
1121849735 14:97209925-97209947 CTGCAGCAGCTCTGTCTCCATGG - Intergenic
1121893058 14:97615974-97615996 CAGTAGCAGCAGTGGGTTCAGGG + Intergenic
1122386530 14:101351996-101352018 CTGATGCTGCAGGGGCCCCAGGG - Intergenic
1122745225 14:103893885-103893907 CTGACACAGCAAGGGCTCCAGGG - Intergenic
1123007929 14:105333364-105333386 CTAACACAGCAGTGGCGCCATGG - Intronic
1123503295 15:20911980-20912002 CAGGAGCAGCAGAGGTTCCAGGG - Intergenic
1123560543 15:21485645-21485667 CAGGAGCAGCAGAGGTTCCAGGG - Intergenic
1123596781 15:21922941-21922963 CAGGAGCAGCAGAGGTTCCAGGG - Intergenic
1123999082 15:25739920-25739942 CCGCAGCAGCAGGTGCTCCAGGG + Intronic
1126516070 15:49539476-49539498 ATGAAGAGTCAGTGGCTCCAGGG + Intronic
1128214265 15:65923437-65923459 CAGCAGCACCAGTGGCTCCTGGG - Intronic
1128538230 15:68506442-68506464 ATTAAGCATCACTGGCTCCAAGG - Intergenic
1128603001 15:69013686-69013708 CTGAACCAGCAGGGGCTCACTGG - Intronic
1129936819 15:79457728-79457750 CATGAGCATCAGTGGCTCCACGG + Exonic
1130290183 15:82592204-82592226 CTGAACCTGCAGTGTCTCCAGGG - Intronic
1130945695 15:88549358-88549380 GGGCAGCAGCAGTGGCTGCATGG + Intergenic
1131842245 15:96449852-96449874 CAGAAGCCATAGTGGCTCCAAGG - Intergenic
1202968890 15_KI270727v1_random:212809-212831 CAGGAGCAGCAGAGGTTCCAGGG - Intergenic
1132881124 16:2162167-2162189 CTGAAGGCTGAGTGGCTCCAGGG + Intronic
1132938702 16:2496251-2496273 CTGAAGCAGCTGGCGCGCCAGGG + Exonic
1133183890 16:4081334-4081356 CAGAACCAGCAGTGGCTCCATGG + Intronic
1133971939 16:10574495-10574517 CTGGAGGAGCAGTGGGTGCATGG - Intronic
1135357332 16:21780469-21780491 CTGGGGCAGGAGTGGGTCCAGGG - Intergenic
1135455836 16:22596585-22596607 CTGGGGCAGGAGTGGGTCCAGGG - Intergenic
1136294892 16:29295918-29295940 CTAAAGGAGCCGGGGCTCCATGG - Intergenic
1136614257 16:31386993-31387015 TTGAAGCAGCAGTGGCAGCAAGG - Intergenic
1136777214 16:32878466-32878488 CAGAAGCAGCAGTGGCAGCTTGG - Intergenic
1136893409 16:33983047-33983069 CAGAAGCAGCAGTGGCAGCTTGG + Intergenic
1138529452 16:57627186-57627208 CTGCAGCAGCCCTGGCTCCTAGG + Intronic
1138591470 16:58001507-58001529 CTACAGCAGCAGCGGCTCCGAGG + Exonic
1139660378 16:68416740-68416762 TTGAAGCCCCAGTGGCTGCATGG - Intronic
1141433129 16:83981156-83981178 CTGAAGCAGCACTGGAGCCCTGG - Intronic
1141686418 16:85572717-85572739 CTGGAGCAGCAGGGGCCCCTAGG - Intergenic
1141950558 16:87336508-87336530 CGGAGGCAGCAGGGGCTACAGGG + Intronic
1142100786 16:88269929-88269951 CTAAAGGAGCCGGGGCTCCATGG - Intergenic
1142210407 16:88805846-88805868 CTGCTCCAGCAGTGGCTCGATGG - Exonic
1142212756 16:88816267-88816289 CCCAGGCTGCAGTGGCTCCACGG - Intronic
1203079628 16_KI270728v1_random:1140575-1140597 CAGAAGCAGCAGTGGCAGCTTGG - Intergenic
1143433918 17:6908700-6908722 CAGCAACAGCAGTGGCACCATGG + Intronic
1144457515 17:15431138-15431160 CTGAACCAGGGGTCGCTCCATGG + Intergenic
1145937845 17:28725738-28725760 CAAAAGCCGCAGTGGCCCCAGGG - Intronic
1146595857 17:34168080-34168102 CTGCACCAGCAGTGGCACTATGG - Intronic
1146674577 17:34764468-34764490 CTGAGGAAGCGCTGGCTCCAAGG - Intergenic
1148382871 17:47212414-47212436 CTGAGGGAGCAGTGGCTTCAAGG + Intronic
1150506104 17:65700586-65700608 CTGAAGCAGGAGAGGCTACATGG + Intronic
1150533728 17:66013806-66013828 CAGTGGCAGCAGTGGCACCATGG + Intronic
1151010351 17:70486348-70486370 CTGAAACAGCATTAGTTCCAAGG + Intergenic
1151962873 17:77416471-77416493 CTGAAGCAGCAGTGAAGCCAGGG + Intronic
1152402626 17:80077182-80077204 CTGAACCTGCAGTATCTCCAAGG + Intronic
1152681694 17:81671805-81671827 CTGGAGCAGGAGTTGCTCCGAGG + Exonic
1152718890 17:81912900-81912922 GTGGGGCAGCAGTGGCCCCAGGG + Intronic
1152734328 17:81989750-81989772 CTCAAGCAGCAGGGGCCTCAGGG + Intronic
1153641789 18:7163929-7163951 ATGAAGCAGCTGTGGTTCAAGGG + Intergenic
1153896656 18:9568396-9568418 CTGAACCAGCAGTATCTCCAAGG + Intronic
1157489681 18:48114010-48114032 CTAGAGCACCAGTGGCTCCCAGG - Intronic
1159001972 18:62982481-62982503 CTGAAGCCACAGTGTCTGCAGGG + Intergenic
1160299753 18:77668971-77668993 CTGGAGCAGCAGTGGTACCGTGG - Intergenic
1160911540 19:1476150-1476172 CTGAAGCAGCACCGACTTCAGGG + Intronic
1161887211 19:7006064-7006086 CGGAGGCAGAAGTGGTTCCAAGG + Intergenic
1162066994 19:8131830-8131852 CTGCAGAAGCAGTGGCGGCACGG + Intronic
1164934479 19:32200415-32200437 CTGCAGCAGCTGAGGCTCCAGGG - Intergenic
1165075026 19:33275842-33275864 CAGAAGCAGCAGTGGGGACAGGG - Intergenic
1166916062 19:46196772-46196794 CTGCGGCAGCACTGGGTCCAAGG - Intergenic
925308955 2:2868328-2868350 CTGGGGCAGCAGTGGCCCCGCGG + Intergenic
926545845 2:14238784-14238806 GTGAAGCAGGAGTTGCTACATGG - Intergenic
927922544 2:26984507-26984529 CTCAGACAGCAGTGGCACCAGGG + Intronic
928427157 2:31188857-31188879 GGGAAGCAGGAGTGGCTTCAGGG - Intronic
928438568 2:31272495-31272517 CTGCAGCAGGAGAGGCTTCATGG + Intergenic
928646049 2:33353669-33353691 CTGAAGCAGCACTTCCTACACGG - Intronic
929946835 2:46378066-46378088 CAGCAGCAGCAGCTGCTCCACGG + Exonic
930034278 2:47075860-47075882 CAGAGGCAGCAGGGGCTTCAGGG - Exonic
931297285 2:60939894-60939916 ATGAGACAGCACTGGCTCCATGG + Intergenic
935365197 2:102281893-102281915 CTGAAGCAGCTATTGCTCCATGG + Intergenic
935979570 2:108613621-108613643 CTGAGGCAGCAAAGGCCCCAGGG - Intronic
936891718 2:117378472-117378494 CTGGAACAGCAGTTTCTCCAGGG - Intergenic
937071587 2:119067625-119067647 CAGAAGCAGAAATGGCTTCATGG - Intergenic
937145303 2:119639142-119639164 CTGCAGCAGCAGTGGGCCAAGGG - Intronic
937245392 2:120489139-120489161 CTGCAGAAGCCGTGGCTCCCTGG + Intergenic
937387310 2:121447353-121447375 CTGCAGCAGCTTTGCCTCCAGGG - Exonic
939285258 2:140121380-140121402 CTGAACCAGCAGTATCTTCAAGG - Intergenic
939560037 2:143721141-143721163 CAGCAGCAGCAGTGGCACCTGGG - Intronic
940202309 2:151165058-151165080 CTGAAGCAACTGTGGTCCCAGGG - Intergenic
942604045 2:177671881-177671903 CTCAAGGAGCAGTAGCCCCAGGG - Intronic
942712159 2:178848748-178848770 CAGAAGCAGCAGCAGCTCCTCGG + Intronic
942807471 2:179949169-179949191 CTGAATCAGCAGATGCTCCCAGG - Intronic
943484673 2:188464774-188464796 CTGAAGTGGCAGTGGCCACATGG - Intronic
943764695 2:191648129-191648151 CTGAGTCAGCAGTAGCTCCTTGG + Intergenic
944474575 2:200090456-200090478 CTTAAGCATCAGTAGCTTCATGG + Intergenic
946419438 2:219556707-219556729 CTTCACCAGCAGTGGCTCTAAGG + Exonic
946427815 2:219608706-219608728 CTGGAGCTCCAGTCGCTCCAAGG - Exonic
948356153 2:237378995-237379017 CTGAGGCAGCTGCAGCTCCAGGG - Exonic
1169307208 20:4502375-4502397 CTGAAGGAGCAGTGACTACTCGG + Intergenic
1169318230 20:4610597-4610619 CTGGAGGAGCAGTGGGTGCAGGG - Intergenic
1170456000 20:16533306-16533328 CAGCAACATCAGTGGCTCCAGGG + Intronic
1170698919 20:18685547-18685569 CTCCAGCTTCAGTGGCTCCATGG + Intronic
1170765876 20:19289761-19289783 CTGGAGCAGCAGTGTGCCCAGGG + Intronic
1172846954 20:37935252-37935274 CTGCAGCAGCTGGGGCTCCGAGG + Intronic
1172888122 20:38245530-38245552 CTGATGCCTCAGGGGCTCCAGGG + Intronic
1173879462 20:46400864-46400886 GTGAAGCAGCAGTCACTGCATGG - Intronic
1174998863 20:55603793-55603815 ATGAGCCAGCAGTGGCTCAAAGG - Intergenic
1175277608 20:57782899-57782921 CTGACGGAGCAGTGGCTGCTGGG - Intergenic
1175535260 20:59706546-59706568 CGGGAGCAGCACTGGCTCCTGGG - Intronic
1175856584 20:62123642-62123664 CTTAGGCAGACGTGGCTCCACGG - Intronic
1175929134 20:62485360-62485382 CTGCAGCAGCTGTGGCTGCTCGG - Intergenic
1176051658 20:63122973-63122995 CTGGTGCTGCTGTGGCTCCATGG + Intergenic
1178159456 21:29894799-29894821 CTCAAACAGAAGTGGATCCAGGG - Intronic
1179006860 21:37522906-37522928 CTGCAGCAGCAGCAGCTCCAGGG + Intergenic
1179040867 21:37801299-37801321 CAGAAGCCCCAGTGGCTCCTTGG - Intronic
1179902130 21:44399791-44399813 CTGGAGCAGCAGGGGCTCCCAGG + Intronic
1180666736 22:17519229-17519251 GTGGAGGAGCAGTGGCTGCACGG - Intronic
1180977267 22:19855226-19855248 CTGAAGCAGCATCGGCCCCTCGG - Intergenic
1182176842 22:28298858-28298880 CCGAAGCAGCAGTGGATACTGGG - Intronic
1182350621 22:29697339-29697361 CAGAAGCACCTGGGGCTCCAGGG + Exonic
1182452275 22:30428685-30428707 TTCAAGAAGCAGTGGCTGCAGGG + Exonic
1182565553 22:31195849-31195871 ATGTAGCAGGAGAGGCTCCAGGG + Intronic
1183092618 22:35533203-35533225 CTGAAGCAGCAAAGGTTCCATGG - Intergenic
1183193882 22:36339957-36339979 CTGAAGCATTAGGGCCTCCAAGG - Intronic
1183424249 22:37730268-37730290 CTGAAGCAACAGCGTCTCCTCGG - Intronic
1183490969 22:38115467-38115489 CTGACACAGGATTGGCTCCAGGG + Intronic
1183811873 22:40264695-40264717 TTGAAGCAGCAGCACCTCCAAGG - Exonic
949642004 3:6046785-6046807 CTGTAGCAGCTGTGGCACTAGGG - Intergenic
950090372 3:10290513-10290535 CTGAACCAGCAAGGGCCCCAGGG + Intronic
950141998 3:10621948-10621970 CTGGAGCAGCACTAGCTGCACGG + Intronic
951146119 3:19229522-19229544 CTGATCCAGCAGTGGCTGAAAGG - Intronic
951920549 3:27849727-27849749 CAGAAGAGGCAGTGGCTCCCAGG + Intergenic
952254307 3:31682295-31682317 CAAAAGCACCAGTGGCTTCAGGG + Intronic
952404995 3:32997583-32997605 CTGAAGCAGGAGTGGGTCTTTGG - Intronic
953405131 3:42656182-42656204 CTGCAGGTGCAGTGGCTCTAGGG + Intronic
953810265 3:46106601-46106623 CTGAACCTGCAGTATCTCCAAGG - Intergenic
954293271 3:49660894-49660916 CTCAACCAGCTGCGGCTCCAGGG + Exonic
954491660 3:50912708-50912730 CTGTGGCAGCAGTGGCTACAGGG - Intronic
954690117 3:52391303-52391325 CTTGAGCAGCACTGGCTCCAGGG - Exonic
954898337 3:53996631-53996653 CTGTTGCAGCAGAGACTCCAGGG + Intergenic
955380333 3:58433478-58433500 CAGAGGCAGCAGGAGCTCCACGG + Intronic
956308633 3:67854246-67854268 TTGAATCAGCATTGGCTCCCAGG + Intergenic
957929913 3:86864138-86864160 CTGAAGCAGAAGTGGCCCCTAGG + Intergenic
959142716 3:102505780-102505802 CTGCTCCAGCAGTGGCTACAAGG + Intergenic
961723199 3:128909390-128909412 GCGGAGCAGCAGTGTCTCCACGG - Exonic
964032626 3:152154876-152154898 CTGGAGCAGAAGGAGCTCCAGGG + Intergenic
964477975 3:157113750-157113772 CTGAAGCAGAGGTGGCTCTGAGG + Intergenic
965140849 3:164832352-164832374 CTGAAGCAGACGTGTGTCCAAGG - Intergenic
965350961 3:167610417-167610439 CTGGGGTAGCAGTGGCTACAGGG + Intronic
968441252 4:625591-625613 CTGGAGCAGCAGCGTCTCCAGGG + Exonic
968539533 4:1157097-1157119 CTGAACCTGCAGTGTCTCCAAGG - Intergenic
968818680 4:2834565-2834587 ATGAAGCAGCTGTAGCTGCAGGG - Exonic
968818698 4:2834681-2834703 ATGAAGCAGCTGTAGCTGCAGGG - Exonic
969648862 4:8451155-8451177 CTGAAGCACCTGTGGGTCCCCGG + Intronic
969829251 4:9781828-9781850 CTGAAGCGCCTCTGGCTCCATGG - Exonic
972846869 4:43001729-43001751 GAGAAGCAACAGTGGGTCCAGGG + Intronic
973566145 4:52189598-52189620 CTGAAGCAGCAGCAGCCCCTGGG - Intergenic
974888587 4:67851463-67851485 GCAAAGCACCAGTGGCTCCAGGG - Intronic
977296239 4:95212723-95212745 GAGAAGCAGCAGTGGCTCCAGGG - Intronic
977795358 4:101158278-101158300 GGGAAGCAGCAGCAGCTCCAGGG + Intronic
978380566 4:108124021-108124043 CTGGAGTAGCAGGGGCTACAGGG - Intronic
978730779 4:112024212-112024234 CTGAAATAGCAGTGGCTGAAAGG + Intergenic
978857835 4:113413323-113413345 CAGAAGCACCAGTGGCACCTTGG + Intergenic
982287104 4:153746950-153746972 CTGCTTCAGCTGTGGCTCCAGGG - Intronic
982615349 4:157633998-157634020 CTGGAGCAGCAGTGGCTATGAGG + Intergenic
982741520 4:159061838-159061860 CTGAAACAGCAGGAGCACCATGG + Intergenic
983646720 4:169999114-169999136 CTGATGCTGCAGTGGCTTCAAGG - Intronic
983859047 4:172681786-172681808 CTGAGGCAGCTGTGGCTGAAGGG - Intronic
984038716 4:174702445-174702467 CTGAACCAGCAATAGCTCTAAGG + Intronic
985033655 4:185817555-185817577 CTGTGGCAGCAGTGGCCCCCAGG + Intronic
985823395 5:2176103-2176125 CTGCAGCAGGGGTGGCCCCAAGG + Intergenic
986701170 5:10410162-10410184 CTGAAGCAGAAGCAGCTCGAGGG - Exonic
987124696 5:14801114-14801136 CCGAAGCCGCAATAGCTCCAAGG + Intronic
988586216 5:32509899-32509921 GTGGACCAGCAGTGGATCCATGG - Intergenic
990710157 5:58571851-58571873 CTGAAGTGGCAGAGCCTCCATGG + Intergenic
991228770 5:64305205-64305227 CTAAACCCGCAGTGTCTCCAAGG + Intronic
991654257 5:68887278-68887300 CAGCAGCAGCAGTAGCTGCAAGG + Intergenic
993364617 5:87020302-87020324 CTGAAGCTGCAGTTTCTCCCAGG - Intergenic
993996454 5:94729319-94729341 CTGTGGCAGGAGTGGCACCATGG + Intronic
995349381 5:111157498-111157520 CTGGAACAGCAATGGCTTCATGG - Intergenic
997827767 5:137122978-137123000 ATGAAGCAGAAGTGGCTTCAGGG + Intronic
998046513 5:138991238-138991260 CTGAAGTAGCTGTGGGACCAAGG + Intronic
998372971 5:141672865-141672887 CTGAAGGAGCAGCGCCTCCTGGG - Exonic
999173665 5:149616626-149616648 CTGCAGCAGCAGTGGGTACCTGG - Exonic
999446686 5:151646022-151646044 CTGAAGCAGCAGAGGATGAATGG + Intergenic
1001789633 5:174444897-174444919 CTGGAAGAGCAGTGGCTCCTGGG + Intergenic
1001893836 5:175362045-175362067 CTGAAGCAGCTGGGGCTCCGGGG + Intergenic
1002160198 5:177310487-177310509 CTGAAGCAGCAGATGCCCCTGGG - Exonic
1003152317 6:3563224-3563246 CTGAAGAGGCAGTCCCTCCAGGG + Intergenic
1004258702 6:14088901-14088923 CTGAAGAAGCAGTGGCCGCCTGG + Intergenic
1004450416 6:15739972-15739994 CAGAAGCAGCAGGGACTCGAAGG - Intergenic
1005475894 6:26207449-26207471 CGGAAGCTTCAGTGGCTGCAAGG - Intergenic
1006806865 6:36794338-36794360 CTCAAGCCCCAGTGGCTCCTGGG - Intronic
1007928487 6:45669111-45669133 CTGAAGCACCAGTGGCTCCTAGG + Intergenic
1008111916 6:47504682-47504704 CTGAACCTGCAGTATCTCCAAGG - Intronic
1008136678 6:47785362-47785384 ATTAAGCAGCACTGACTCCAGGG + Intronic
1009866671 6:69406595-69406617 GTGAAGCAGCACTGGCCCTATGG - Intergenic
1010731471 6:79395900-79395922 ATGAAGAGGCAGTGGCTACAGGG - Intergenic
1011290482 6:85772062-85772084 CAGCAGCAGCAGTGGCAGCACGG + Intergenic
1016177268 6:141096303-141096325 GAGAAGCAACAGTGGGTCCAGGG + Intergenic
1016303191 6:142654751-142654773 CAGAGGCAGCACTGGCTGCAGGG - Intergenic
1016948834 6:149560937-149560959 TCGGAGCAGCAGTGTCTCCAGGG + Intergenic
1017613973 6:156224591-156224613 CTGAATGATCAATGGCTCCATGG + Intergenic
1017908177 6:158771036-158771058 CTGACGGAGCAGCCGCTCCAGGG + Intronic
1018198603 6:161376121-161376143 CTGAAGCAGCAGTGGCTCCAGGG - Intronic
1018327728 6:162691841-162691863 CTGAAGCAGCAGTAGCAGCCTGG + Intronic
1019618865 7:1979823-1979845 CTGCAGCCGCAGGGGCTGCATGG - Intronic
1020007846 7:4791864-4791886 CTGTAGCAGCAGTGGCACGCCGG - Intronic
1020951017 7:14677435-14677457 CTGAAGCAGAAATGTTTCCATGG + Intronic
1021132626 7:16929476-16929498 CTGAAGCTTCAGTATCTCCAAGG - Intergenic
1021308796 7:19065654-19065676 CTGGAGCAGCAGTGGCTCAAAGG + Intronic
1021578303 7:22125710-22125732 CTGAAGAAGCAGTGCCTGCTAGG + Intronic
1021817350 7:24460555-24460577 CTGGAGCAGCTGTGGCTCCTTGG + Intergenic
1023185828 7:37531825-37531847 CTGAAGAGGCAGTGAATCCATGG + Intergenic
1023966615 7:44966185-44966207 CTGGAGCAGCACGGGCTGCAGGG - Exonic
1024865846 7:53904448-53904470 CTGAAGCAGCTGGGGATGCAGGG + Intergenic
1026554297 7:71392461-71392483 CTGAAGCAGAACTTCCTCCAGGG - Intronic
1032634369 7:133690468-133690490 CTGATGCAGCAGTGCCTCCTTGG + Intronic
1032735731 7:134691187-134691209 CCAAAACAGCAGTGCCTCCATGG - Intergenic
1033241249 7:139681789-139681811 CTGGAGCAGTGGTGGCTGCATGG - Intronic
1034210950 7:149362474-149362496 CTGAACCTGCAGTATCTCCAAGG + Intergenic
1034557649 7:151860206-151860228 CTCCAGCAGGAGGGGCTCCACGG - Intronic
1034593402 7:152163641-152163663 CTGAAGCTGCTGTGGCACCATGG + Exonic
1034898815 7:154894898-154894920 CTGAGGCAGCAGCTGCTCCATGG - Intergenic
1035201254 7:157268176-157268198 CATAAGCAGCAGCGGCCCCATGG - Exonic
1035736787 8:1894195-1894217 CTGAAGCAGCCATGCCCCCATGG + Intronic
1036196479 8:6720706-6720728 CTGAATCATCAGGGTCTCCATGG - Intronic
1036556338 8:9863448-9863470 CTGGAGCCGCAGTGGCTTCCAGG + Intergenic
1036563603 8:9919166-9919188 CCGCAGCAGCAGTTGCTCTAGGG - Intergenic
1036922713 8:12873178-12873200 CTGTAGCAACAGTGGCCCTAAGG - Intergenic
1038269175 8:26061433-26061455 TGGAAGCAGGAGTGGCCCCATGG - Intergenic
1038527104 8:28284857-28284879 CTGAACCAGCAATGTCTCCAAGG + Intergenic
1039146617 8:34454185-34454207 ATGAAGCAGCATTGCCTTCAAGG + Intergenic
1039798327 8:40933801-40933823 CAGTAGCAGCAGTGGTGCCAGGG - Intergenic
1041021822 8:53645612-53645634 CTAAAGAAGCAGGGGCTACAGGG - Intergenic
1043323044 8:79014605-79014627 CTGAAACACCAGTGGGTCAATGG - Intergenic
1044157881 8:88872690-88872712 ATGATGCAACTGTGGCTCCATGG + Intergenic
1044348681 8:91137285-91137307 TAGAAGTAGCAGTGGCACCAGGG - Intronic
1045477968 8:102569316-102569338 GTGAAGCAGCCCTGGGTCCAGGG - Intergenic
1046465255 8:114593523-114593545 CTGAGGTAGCAGAGGCTTCATGG + Intergenic
1046750752 8:117923811-117923833 CTGAATCAGCACTTGCTGCATGG + Intronic
1047513811 8:125536300-125536322 CTGAAGGAGCAGGGGCTGCCCGG + Intergenic
1048950764 8:139495202-139495224 CTGAATCAGCAGCCTCTCCAAGG + Intergenic
1050287614 9:4118789-4118811 ATGAAGCAGGAGTGGTCCCAGGG - Exonic
1050317999 9:4423035-4423057 CAGAAGCAGCAGTGGGGACATGG + Intergenic
1050424921 9:5502655-5502677 TAGAAGCAGCAGTGGCAGCATGG - Intergenic
1051774894 9:20622463-20622485 CAGCAGCAGCAGCAGCTCCAGGG + Exonic
1053047540 9:34932281-34932303 CTGAAGCAGCAAGAACTCCAGGG + Intergenic
1053172320 9:35897541-35897563 CTGAACCTGCAGTACCTCCAAGG - Intergenic
1053370781 9:37560035-37560057 GTCGAGCACCAGTGGCTCCAAGG - Intronic
1055462015 9:76528425-76528447 CTGAGGCAGCAGTGGCTACTTGG - Intergenic
1055585397 9:77754116-77754138 CAGAAGCAGCAGAGACTCCAGGG - Intronic
1055948951 9:81713122-81713144 CTGAATCAGCCATGTCTCCAAGG - Intergenic
1057075912 9:92138067-92138089 CTGCTGCAGCAGCTGCTCCATGG - Intergenic
1057488093 9:95501913-95501935 GTGAAGCATTCGTGGCTCCAGGG + Intronic
1057524408 9:95786029-95786051 CTGGTGTAGCAGAGGCTCCAAGG - Intergenic
1059299671 9:113302285-113302307 CTGAAACAGCAGTGGATCCCTGG - Intronic
1059619521 9:115988078-115988100 CTGAAGCAGCAATAACTCTATGG + Intergenic
1060423077 9:123483352-123483374 CTGGAGCAGCAGCGGCGGCATGG - Intronic
1060553690 9:124497698-124497720 CTGGAGCAGGAGTGGGTCCTTGG - Intronic
1061149895 9:128822717-128822739 GTGAAGCAGCAGTGAAACCAGGG - Exonic
1061714836 9:132512210-132512232 TTGAGGCAGCAGTGGCTGAAGGG - Intronic
1062403580 9:136383088-136383110 GTGCAGCAGCAGGGGCCCCAGGG - Intronic
1062554094 9:137106275-137106297 CTGCTGAAGCAGTGGATCCAGGG + Exonic
1062616335 9:137398185-137398207 CAGAAGGAACTGTGGCTCCACGG + Intronic
1062724609 9:138064767-138064789 CTGGAGCTGCAGAGGCTCCATGG - Intronic
1187102784 X:16212286-16212308 CTGAAGATGCAGTGGCTCTTTGG + Intergenic
1187494046 X:19778743-19778765 TTGAAGCAGCAGGGGCTTCCAGG + Intronic
1188705256 X:33320353-33320375 CTGAACCTGCAGTATCTCCAAGG - Intronic
1188968900 X:36588902-36588924 TTAAAGCAGCATTGCCTCCAGGG + Intergenic
1189380676 X:40500266-40500288 CTGAGCCACCAGTGGCTTCATGG - Intergenic
1190196541 X:48324140-48324162 CTGAAGCAGCTGTGCCCCCCGGG + Intergenic
1190901692 X:54680718-54680740 CTGAACCAGCATTGCATCCAAGG - Intergenic
1190981484 X:55460041-55460063 CTGAAGTAGCAGTGGCACACAGG - Intergenic
1190987214 X:55513139-55513161 CTGAAGTAGCAGTGGCACACAGG + Intergenic
1191166790 X:57400506-57400528 CTGAAGCAGAAGTGGCTTTCCGG - Intronic
1191730736 X:64332526-64332548 CAGAAGCAGCAGTAGGTGCAAGG - Intronic
1192134284 X:68582448-68582470 CTGCAGCTGGATTGGCTCCATGG - Intergenic
1193736214 X:85159838-85159860 CAGCAGCAGCAGTGGCAGCATGG - Intergenic
1194394265 X:93361444-93361466 ATCAAGGGGCAGTGGCTCCAAGG + Intergenic
1195544476 X:106100009-106100031 CTGCAGCAGCATTGGCAGCATGG + Intergenic
1199050628 X:143232657-143232679 CTGTAGTGGCAGTGGCTACAGGG + Intergenic
1199885303 X:152015394-152015416 CTGTAGCAGCTGTAGCACCAAGG - Intergenic
1200102646 X:153695582-153695604 CAGAAGCAGCAGTGGCAGCTTGG + Exonic
1200742368 Y:6868142-6868164 CTGTGGCAGCAGGGGCTGCATGG + Exonic
1201229125 Y:11845973-11845995 CAGAAGCAGCAGTGGCAGTATGG - Intergenic