ID: 1018199296

View in Genome Browser
Species Human (GRCh38)
Location 6:161380261-161380283
Sequence GGGACCTGGCCAGTTCTCCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 237}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018199296 Original CRISPR GGGACCTGGCCAGTTCTCCA CGG (reversed) Intronic
900321500 1:2086582-2086604 TGGACCTGGCCGTTTCTCCACGG + Intronic
900574958 1:3378525-3378547 GGGAGCTGGCCCTGTCTCCAGGG + Intronic
900679226 1:3907187-3907209 GGGCCCTGCCCAGTTCTCACGGG + Intergenic
900940999 1:5798528-5798550 TGGCCGTGGCCAGTTGTCCACGG + Intergenic
901013219 1:6212497-6212519 AGGACCTGGCCTGTACCCCACGG + Intronic
901202108 1:7472864-7472886 GGGACAATGCCAGTTCACCATGG + Intronic
901399433 1:9005915-9005937 GGGCCCGGGCCCCTTCTCCAGGG + Intronic
901630232 1:10644370-10644392 GGGAACGGTCAAGTTCTCCATGG - Intronic
902714444 1:18262830-18262852 GCGACCTGGCATGTTTTCCAAGG + Intronic
905823156 1:41009753-41009775 GGGACCTGGCCAATATGCCAGGG - Intronic
906961137 1:50420052-50420074 TGGACCTGGCCACTTCTCCACGG - Intronic
910386979 1:86694429-86694451 GGTATGAGGCCAGTTCTCCAAGG + Intergenic
912491232 1:110063925-110063947 GGGCCGTGGCCAGTTTTACATGG - Intronic
913207116 1:116549368-116549390 GGGACCTGCCCTGCTCTCCTGGG - Intronic
915342984 1:155186300-155186322 GAGTCCTGGCCAGCTCTCAAAGG + Intronic
915599592 1:156913924-156913946 GGGACCTGCCCAGCTTGCCAGGG + Exonic
915900497 1:159843329-159843351 GGGTCAAGGACAGTTCTCCATGG - Intronic
915900791 1:159845317-159845339 GGGTCAAGGACAGTTCTCCATGG + Intronic
920189179 1:204181500-204181522 GGAACCTGGTCAGATATCCAGGG + Intergenic
920421961 1:205840948-205840970 GGGATCTGGCTTGTTCTCTAGGG + Intronic
920422189 1:205842505-205842527 GGGATCTGGCTTGTTCTCTACGG - Intronic
922747159 1:228050857-228050879 GGCATCTGGCCGGTTCTCCCGGG - Exonic
1064230063 10:13521822-13521844 CGGACCTGCCGAGTCCTCCAGGG + Intronic
1067053529 10:43038600-43038622 TGCCCCTGGCCAGTCCTCCATGG + Intergenic
1069640977 10:69955394-69955416 AAGACCTGGCCAGTGCTCAAGGG - Intronic
1070858524 10:79629427-79629449 GTGTCCTGGGCAGCTCTCCAGGG - Intergenic
1073594069 10:104783298-104783320 TGGACCTGGCCAGCTCTCACAGG + Intronic
1076166276 10:128285126-128285148 GGGGCCTGGCTAGGTCACCAAGG + Intergenic
1076704791 10:132295286-132295308 TAGAACTGGCCATTTCTCCAAGG - Intronic
1076904461 10:133355248-133355270 GGGCCCTGGCCAGGGCTCTAGGG - Exonic
1077484571 11:2832863-2832885 AGGGCCTGGCCAGGGCTCCATGG + Intronic
1077515393 11:2998698-2998720 TGGAACTGGCCATTTCTCCAGGG + Intergenic
1080305436 11:30829892-30829914 GGGACCTGGTCAGTTTTGGAAGG + Intergenic
1083651881 11:64208816-64208838 GGTGCCTGGCCAGCTCTGCATGG + Intronic
1084067132 11:66711102-66711124 TGGGCCTGCCCAGTCCTCCAAGG + Intronic
1084476911 11:69394421-69394443 GTGACCTGGCCGATTCTCCAGGG + Intergenic
1084507095 11:69575024-69575046 GGGTCCAGGCCATTTCTACAGGG + Intergenic
1084875449 11:72129027-72129049 GGGTCCAGGCCAGATCTTCAGGG - Intronic
1086350105 11:85936024-85936046 GGGACCGGGCCAGGGCTACAGGG - Intergenic
1088536556 11:110867891-110867913 GGCACCTGGCCTGGTCCCCAAGG - Intergenic
1090266073 11:125353766-125353788 TTGACCTGGTCAGTTCACCATGG - Intronic
1090412755 11:126520358-126520380 GGCTCCTGGCCAGGGCTCCAGGG - Intronic
1090710494 11:129380423-129380445 GGGAGCTGGCTAGTGCTTCATGG + Intronic
1091312007 11:134581268-134581290 GGGACCTCGCCAGTCCTCAGAGG + Intergenic
1094176901 12:27550205-27550227 GGGAGCTGGGCAGTAATCCAAGG + Intronic
1095201462 12:39389449-39389471 GGCATCTGGCAAGTTCACCATGG - Intronic
1095951942 12:47786368-47786390 AGGACCAGGCCGGTTCACCACGG - Intronic
1095985666 12:47997823-47997845 GGGACCTGGGAAGTCCACCAGGG + Intronic
1096523784 12:52198797-52198819 GGGACCTGGCCTCTCCTCCTGGG - Intergenic
1098150132 12:67538115-67538137 GGGCCCTGGTCACTTTTCCAAGG + Intergenic
1098350844 12:69558427-69558449 GGCACATGGCCATTTCACCAAGG - Intronic
1099329744 12:81268475-81268497 GTGACCTGGCCAGATACCCATGG - Intronic
1099880148 12:88458311-88458333 GGGTCCTGTTCAGTTCTCAATGG - Intergenic
1101212376 12:102547170-102547192 CAGAAGTGGCCAGTTCTCCAAGG + Intergenic
1103085741 12:118060977-118060999 GGGCCCTGGCCCGTTCTCCCCGG - Intronic
1103097051 12:118140440-118140462 GGGACCTAGTAAGTTCTCTAGGG + Intronic
1104422832 12:128651308-128651330 GGGCCCTGGCCTCATCTCCAAGG + Intronic
1107795195 13:44044708-44044730 GGCCCCTGGCCAGTACTGCACGG - Intergenic
1108153067 13:47556894-47556916 GGGATCTGGGCAGCTCTCCATGG - Intergenic
1108570653 13:51746430-51746452 GGTACCAGGCCAGTTTTCCTGGG + Intronic
1113976213 13:114229367-114229389 TGCACCTGGACAGGTCTCCAAGG + Intergenic
1114139445 14:19894217-19894239 GGCACCTGACCATTTCCCCAGGG - Intergenic
1114515978 14:23300843-23300865 GGAACCTGGCCACTGCTCCTTGG - Exonic
1117489038 14:56227740-56227762 TGGAATTGGTCAGTTCTCCAAGG - Intronic
1118448386 14:65873190-65873212 GGAACCAGGCCAGTTTTCCTGGG + Intergenic
1118756945 14:68851828-68851850 GGGTCCTGGATAATTCTCCAGGG + Intergenic
1120985024 14:90327158-90327180 TGGAGTTGGCCATTTCTCCAGGG - Intronic
1121105707 14:91278126-91278148 GGGACCTGGCCACTTTGCCCCGG - Exonic
1121336101 14:93078404-93078426 GGGACCTGGTCAGCTCTCCTTGG - Intronic
1122199596 14:100114414-100114436 GGGGTCTGGACAGTCCTCCAGGG + Intronic
1122211877 14:100178719-100178741 GGGACCAGGCCAGTGACCCAAGG - Intergenic
1124254190 15:28127654-28127676 TCGACCTGGCCATTTCTCCAAGG - Intronic
1125545353 15:40499380-40499402 TGCCCCTGGCCAGTGCTCCATGG - Intergenic
1125782649 15:42283879-42283901 GGGCACTGGCCTGTTCCCCAAGG - Intronic
1128269299 15:66294077-66294099 GGGACCTCCCCATTTCTCCACGG - Intronic
1128764794 15:70244479-70244501 CTGGCCTGGCCAGATCTCCAGGG - Intergenic
1131060956 15:89404480-89404502 AGGACAAGGACAGTTCTCCAAGG - Intergenic
1132542327 16:516324-516346 CAGAACTGGCCATTTCTCCAAGG - Intronic
1132681817 16:1145611-1145633 GGCTCCTGTCCAGTTCTCCCAGG + Intergenic
1132838528 16:1966936-1966958 GAAACCTGCCCAGTTGTCCAGGG + Intronic
1133225243 16:4337702-4337724 GGGACCTGGCCTGTCATGCAGGG + Exonic
1133601551 16:7344846-7344868 GAGACATGGCCATTTCCCCATGG - Intronic
1133978530 16:10617303-10617325 GGGACAAGGCCAGCTCTGCAGGG + Intergenic
1136143059 16:28299492-28299514 GGGACCTCGCCTGAGCTCCAGGG + Intronic
1136227126 16:28866645-28866667 GGGGCCTGACGAGGTCTCCAGGG - Exonic
1136268304 16:29133451-29133473 TGGAGCTGGCCAATTCTCCCAGG + Intergenic
1138559903 16:57795199-57795221 CGGCCCTGGCCAGTGGTCCATGG - Intronic
1138574054 16:57895717-57895739 TGGAAATGGCCATTTCTCCAAGG - Intronic
1139382461 16:66542092-66542114 GGGACCTTGCCAGTTTCCCGAGG - Intronic
1140451380 16:75073731-75073753 GGGACCTTGCCCGTTCCCCTGGG + Intronic
1140860454 16:79013358-79013380 GGGATCGGGGCAGTTCTCCTGGG - Intronic
1141394453 16:83692293-83692315 GGAGTCTGGCCAGATCTCCATGG + Intronic
1141685218 16:85566239-85566261 GTGACTTGGCCAGGTCTCCCAGG - Intergenic
1142071613 16:88093785-88093807 TGGAGCTGGCCAATTCTCCCAGG + Intronic
1142236026 16:88922990-88923012 GGGACCCGACCAGCTCTACACGG + Intronic
1142269375 16:89081239-89081261 GGATCCAGGCCAGTTCTCCGTGG - Intergenic
1142485538 17:245644-245666 GGGACATGGACAGATCTCGAGGG + Intronic
1142642955 17:1295311-1295333 AGGCCCTGGCCACTTCTCCGGGG + Intronic
1144394816 17:14833919-14833941 GTGACCTGTGCAGTTCTACAGGG - Intergenic
1145035284 17:19536337-19536359 GGGACCTCTCCAGGTCTCCAGGG + Intronic
1148334874 17:46834441-46834463 GGCACCTGGCAAGTTCTGCTAGG + Intronic
1148354826 17:46968842-46968864 GGGACCTGTCCAGACCCCCAAGG + Intronic
1150641752 17:66954053-66954075 GGGTGGTGACCAGTTCTCCACGG + Intergenic
1151627481 17:75286270-75286292 GGGACCTGGCCAGACCTCTGGGG - Intronic
1151792795 17:76319807-76319829 TGTACTTGGCCATTTCTCCAAGG - Intronic
1151805935 17:76405403-76405425 GAGAACTGGCCAGCTCTGCAGGG - Intronic
1151895133 17:76974966-76974988 GGGACCTGCCCACTTCTGCCGGG - Intergenic
1152152166 17:78608924-78608946 GGTGCCTGGCCTGTGCTCCAGGG + Intergenic
1152586154 17:81190371-81190393 TGGGCCTGGCGAGTTCTCCAGGG - Intronic
1152722438 17:81929548-81929570 GGCTCCTGGCCAGCTCCCCACGG + Intergenic
1153847975 18:9066898-9066920 GGCACCTGGCCTGTTCTCAGTGG + Intergenic
1154179602 18:12121517-12121539 GGGACCTCTGCAGATCTCCAGGG + Intronic
1156480396 18:37432755-37432777 AGGCACTGGCCAGGTCTCCAGGG - Intronic
1157453178 18:47802996-47803018 GGGATATGGCCAGTTGGCCAAGG + Intergenic
1157663314 18:49464739-49464761 AGCACCTGGCCACTCCTCCAAGG + Intergenic
1157727130 18:49973334-49973356 GGGAAGTGGCCACTTCTACAGGG + Intronic
1157799866 18:50610365-50610387 GGGCAGTGCCCAGTTCTCCAAGG - Intronic
1157963177 18:52179452-52179474 GGGACCTGGGCTGTCCACCATGG + Intergenic
1159024084 18:63166892-63166914 AGCACCTGGTCAGTGCTCCATGG - Intronic
1159929909 18:74299740-74299762 GGGACCTGGCAAGTTCTGATTGG - Intergenic
1160379942 18:78446527-78446549 GGGCTCTGGCCAGCTCCCCACGG - Intergenic
1160893187 19:1390277-1390299 TGGACCTGGCCATTTCTGCCCGG + Intronic
1160952409 19:1674072-1674094 GGCACCTGGTCTGCTCTCCAAGG - Intergenic
1161257148 19:3315672-3315694 GGGAGCTGGCCGGTGATCCATGG + Intergenic
1163297518 19:16421842-16421864 GTGGCCGGGCCGGTTCTCCAGGG - Intronic
1163777924 19:19228657-19228679 GGGCTCTGTCCAGCTCTCCATGG + Intronic
1164691979 19:30217940-30217962 GGCCCATGGCCAGCTCTCCATGG + Intergenic
1165075476 19:33277860-33277882 TGGGCCTCCCCAGTTCTCCAAGG + Intergenic
1166313331 19:41975544-41975566 GGGAACTGGCCAGGGCTGCAGGG - Intronic
1166430692 19:42724382-42724404 GAGACCCTGCCAGGTCTCCATGG + Intronic
1166443708 19:42839735-42839757 GAGACCCTGCCAGGTCTCCATGG + Intronic
1167729882 19:51246118-51246140 GGGAGCTGGGAACTTCTCCAGGG - Intergenic
1168375979 19:55879596-55879618 GGGGCCAGGCCTGTTCACCATGG - Intronic
927476985 2:23420962-23420984 GGCGCCTGGCCAGGTCTCTAAGG - Intronic
933992433 2:87643324-87643346 GAGAACTGGTCAGTTCTCCTGGG + Intergenic
935583018 2:104775078-104775100 TGGACCTGGGCAGATCACCATGG + Intergenic
936461200 2:112714824-112714846 GGGACCTAACCAGTACACCAGGG - Intergenic
939223176 2:139329708-139329730 GGGAGCTGGATAATTCTCCATGG + Intergenic
940944370 2:159599232-159599254 GGGACCAGGCTAGTTTTCCAGGG - Intronic
941010324 2:160292474-160292496 GGGGACTGGCCTGTTATCCATGG + Intronic
1168956585 20:1838594-1838616 GGTGCATGGCCAGGTCTCCAAGG + Intergenic
1169701701 20:8454276-8454298 GGATCCTGGCTACTTCTCCAAGG - Intronic
1170812458 20:19685176-19685198 GGGCCCTGTCCCATTCTCCACGG - Exonic
1173530007 20:43762103-43762125 CAGACCTGGGCAGTGCTCCAGGG + Intergenic
1175213890 20:57379595-57379617 GGGACCTTGCCACCTCCCCAAGG + Intergenic
1175369474 20:58478230-58478252 TGAAACTGGCCATTTCTCCAAGG + Intronic
1178533519 21:33394210-33394232 GGGGCCCGGCCAGACCTCCATGG + Intergenic
1180062010 21:45390411-45390433 GGGACCTGGCCAGCCCACCCGGG - Intergenic
1180352136 22:11814340-11814362 GTTACCTGGCCATTTCTCCACGG - Intergenic
1180353345 22:11821213-11821235 GTTACCTGGCCATTTCTCCACGG + Intergenic
1180384896 22:12171144-12171166 GTTACCTGGCCATTTCTCCACGG - Intergenic
1180386070 22:12177726-12177748 GTTACCTGGCCATTTCTCCACGG + Intergenic
1180874912 22:19170694-19170716 GTGACCTTGCCACATCTCCATGG - Intergenic
1180876073 22:19175788-19175810 GGGACCGGGCCAGGGCTACAGGG + Exonic
1182795543 22:32989143-32989165 GGGACCTGGGCTTGTCTCCAAGG - Intronic
1183320856 22:37164283-37164305 GAGACCTGGCCAGTGCACAAGGG + Intronic
1183476699 22:38039558-38039580 GAGACCTGGGCAGTTCACCCAGG + Intronic
1184589720 22:45473790-45473812 GGAATCTGGCCTGTTCTCCCTGG - Intergenic
1185060133 22:48602333-48602355 GGGGCCTGGCCTGGGCTCCAGGG + Intronic
1185060293 22:48603093-48603115 GGGGCCTGGCCTGGGCTCCAGGG - Intronic
1185146125 22:49137578-49137600 GGGGACTGGCCAGGCCTCCATGG + Intergenic
949419990 3:3855537-3855559 TTGTCCTGGCCAGTTCCCCAGGG + Intronic
949918855 3:8985807-8985829 GGGGCCTGGCGGGTTCTTCAGGG + Exonic
953193447 3:40710887-40710909 GGGTCCAAGCCAGATCTCCAAGG - Intergenic
953449798 3:42996689-42996711 GGGAGATGGCCAGGTCCCCATGG - Intronic
953949359 3:47176615-47176637 GGGACCTGGACAGGTGACCATGG + Intergenic
954117430 3:48474908-48474930 GGGGCCTGGCCTCTTCTGCATGG - Intronic
954252645 3:49380052-49380074 GGTACATGGCCATGTCTCCAAGG - Intronic
954681285 3:52347375-52347397 GGGACCAGGCCAGATCTCTTGGG + Intronic
955973056 3:64455003-64455025 GAAGCCTGGCCAGTTCTCCTAGG - Intergenic
957179847 3:76862336-76862358 GGTACCTGGCTAGGTCTACAAGG + Intronic
961472881 3:127127700-127127722 CAGACATGGCCAGTTCCCCAGGG + Intergenic
962344787 3:134611001-134611023 GGCAGCTGGCCAGTCCTCCCTGG - Intronic
968075391 3:195813320-195813342 GGGACCACGCCACTTCCCCACGG - Intergenic
968569137 4:1330199-1330221 GGGACCTGGCCTGTACTTCATGG + Intronic
969624026 4:8293458-8293480 AGGGCCTGGCCAGCTCACCAGGG - Intronic
971148198 4:24002692-24002714 TTGACTTGGCAAGTTCTCCATGG + Intergenic
973374789 4:49279236-49279258 GTTACCTGGCCATTACTCCACGG - Intergenic
973375690 4:49285258-49285280 GTTACCTGGCCATTACTCCACGG - Intergenic
973376588 4:49291277-49291299 GTTACCTGGCCATTACTCCACGG - Intergenic
973377507 4:49297429-49297451 GTTACCTGGCCATTACTCCACGG - Intergenic
973378425 4:49303565-49303587 GTTACCTGGCCATTACTCCACGG - Intergenic
973379731 4:49311798-49311820 GTTACCTGGCCATTACTCCACGG + Intergenic
973380635 4:49317938-49317960 GTTACCTGGCCATTACTCCACGG + Intergenic
973381721 4:49324983-49325005 GTTACCTGGCCATTACTCCACGG + Intergenic
973382622 4:49331005-49331027 GTTACCTGGCCATTACTCCACGG + Intergenic
975536392 4:75455747-75455769 GGTACCGGGCCAGTTTTCCAAGG + Intergenic
978615383 4:110588209-110588231 GGGACTTGGTCACGTCTCCATGG + Intergenic
979122839 4:116925987-116926009 GAGACCAGCCCAGTCCTCCATGG + Intergenic
980200330 4:129648980-129649002 GGGTTGAGGCCAGTTCTCCAGGG + Intergenic
984102217 4:175499739-175499761 GGGACCTGCCCAGGCCCCCAAGG + Intergenic
992564606 5:77985407-77985429 GGGAACTGGCCAGGGCTCCTAGG - Intergenic
992564608 5:77985412-77985434 GAGCCCTGGCCAGTTCCCCTGGG + Intergenic
999838024 5:155395345-155395367 AGAACCTAGCCTGTTCTCCATGG + Intergenic
1000824220 5:166024029-166024051 TGAACCTTGCCAGTTCTCCTAGG - Intergenic
1002280782 5:178128996-178129018 GAGACCTGGCTTTTTCTCCAGGG + Intergenic
1002477456 5:179476007-179476029 GGGACCTGGACAGTTTTGAAGGG + Intergenic
1003501050 6:6703106-6703128 GGGACCAGGCCATCTCTGCAAGG + Intergenic
1003860691 6:10319462-10319484 GGGACGTGGGCAGTTTTCCGTGG + Intergenic
1003860700 6:10319492-10319514 GGGACGTGGGCAGTTTTCCGTGG + Intergenic
1003860710 6:10319522-10319544 GGGACGTGGGCGGTTTTCCATGG + Intergenic
1004630029 6:17412214-17412236 GGGGGCTGGCCAGCTGTCCATGG - Intronic
1005250015 6:23934705-23934727 GGGACTTGACCAGATCTCAAGGG + Intergenic
1005831302 6:29673123-29673145 GGGACCTGGCCACTGGTGCATGG + Exonic
1006598999 6:35213666-35213688 GGGAGCGGGCCTGGTCTCCATGG - Intergenic
1007050700 6:38825662-38825684 TGGACCTAGCCAGTTGTCCCAGG - Intronic
1012375569 6:98557951-98557973 GGCACCTGGCCAGTGCCCCGGGG - Intergenic
1013614060 6:111825144-111825166 GAGGCCTGGACAGCTCTCCATGG + Intronic
1014758854 6:125332602-125332624 TGGAATTGGCCATTTCTCCAGGG + Intergenic
1017298646 6:152830699-152830721 GAGAATTAGCCAGTTCTCCAGGG + Intergenic
1018199296 6:161380261-161380283 GGGACCTGGCCAGTTCTCCACGG - Intronic
1018669468 6:166167306-166167328 GGGACCTGGCAAGTTCCCGGAGG - Intronic
1018710573 6:166495622-166495644 TGCACCTGGCCAGGCCTCCAAGG - Intronic
1019335600 7:481114-481136 GGCAGCTGGCCAGGGCTCCAGGG + Intergenic
1021054149 7:16026453-16026475 GGGGCCTGGCCAGTTGACCCTGG + Intergenic
1021202561 7:17742254-17742276 GGCACCTGACCACTTCCCCAGGG + Intergenic
1021481318 7:21120935-21120957 GGGAGGTGGCAAGTTCTCCCGGG - Intergenic
1021765510 7:23944166-23944188 GGCACCTGGGCACTTCTCCTAGG + Intergenic
1022438432 7:30412162-30412184 GGCACCAGGCCAGTCCTCCCTGG + Intronic
1023079885 7:36516563-36516585 CGAAGCTGGCCAGTGCTCCAGGG + Intronic
1024096062 7:45983721-45983743 GGGCCCTGGCCAGTTTTCTATGG + Intergenic
1024756533 7:52539831-52539853 GGACCCTAGCCAGCTCTCCATGG + Intergenic
1031180536 7:118409101-118409123 GGTGCCAGGCCAGTTTTCCAGGG + Intergenic
1031997393 7:128241537-128241559 GGGACCTGGCTGGTTCTGCAAGG - Intronic
1033039913 7:137908536-137908558 CTGACCTGGACAGATCTCCAAGG + Intronic
1034726945 7:153344919-153344941 TGGATTTGGCCACTTCTCCAGGG + Intergenic
1035323165 7:158047270-158047292 GGCTCCTGGCCTGTTCTGCATGG - Intronic
1035522321 8:284713-284735 GGGACCTGTGCTGTTCCCCACGG + Intergenic
1039102682 8:33957841-33957863 GCAATCTGGCCAATTCTCCATGG + Intergenic
1045019286 8:98027714-98027736 GGGGCCTGGCCCCTTCTCCTTGG - Exonic
1046511308 8:115207716-115207738 GATACCAGGCCAGTTTTCCAAGG - Intergenic
1048974720 8:139664747-139664769 GGGTCTTGCCCAGTTCTCCTTGG + Intronic
1049470208 8:142771909-142771931 GGGACATGGCCAGGTCAGCATGG - Intronic
1050259242 9:3823848-3823870 GGTACCTGCCCCTTTCTCCAGGG + Intergenic
1051903202 9:22064738-22064760 GGCATCTGGCCTGTTCTCCCTGG + Intergenic
1053877472 9:42558724-42558746 GGGTCCTGCCCAGTTGTGCAAGG + Intergenic
1054234223 9:62542998-62543020 GGGTCCTGCCCAGTTGTGCAAGG - Intergenic
1054264842 9:62908054-62908076 GGGTCCTGCCCAGTTGTGCAAGG - Intergenic
1055024388 9:71703775-71703797 GGGAAAGGGCCAGTTCTCCTGGG - Intronic
1056798558 9:89675567-89675589 GCAACCCGGCCAGTTCACCAAGG - Intergenic
1057800954 9:98191460-98191482 GGGACCTGACCACTGCCCCAGGG + Intronic
1058813649 9:108664624-108664646 GGGACCTGGCCCTGTCTCAAGGG - Intergenic
1060602565 9:124888021-124888043 GACACTTGTCCAGTTCTCCAGGG + Intronic
1062020991 9:134319368-134319390 TGGTCCTGGGCAGTTGTCCAGGG + Intronic
1062475447 9:136724493-136724515 GGGTCCTTGCCTGTTCTCCTAGG - Intergenic
1062494965 9:136827306-136827328 GGCACCTGGTGAGTTCTCAAGGG + Intronic
1203699413 Un_GL000214v1:123492-123514 GTTACCTGGCCATTTCTCCACGG - Intergenic
1203700357 Un_GL000214v1:129775-129797 GTTACCTGGCCATTTCTCCACGG - Intergenic
1203701279 Un_GL000214v1:135795-135817 GTTACCTGGCCATTTCTCCACGG - Intergenic
1203480104 Un_GL000224v1:4378-4400 GTTACCTGGCCATTTCTCCACGG - Intergenic
1203481074 Un_GL000224v1:10706-10728 GTTACCTGGCCATTTCTCCACGG - Intergenic
1203482037 Un_GL000224v1:17015-17037 GTTACCTGGCCATTTCTCCACGG - Intergenic
1203416711 Un_KI270330v1:229-251 GTTACCTGGCCATTTCTCCATGG + Intergenic
1203550757 Un_KI270743v1:163835-163857 GTTACCTGGCCATTACTCCATGG + Intergenic
1203569704 Un_KI270744v1:119729-119751 GTTACCTGGCCATTTCTCCACGG - Intergenic
1187270357 X:17775150-17775172 CTGCCCTGGCCATTTCTCCAAGG + Intergenic
1187320151 X:18230558-18230580 CTGCCCTGGCCATTTCTCCAAGG - Intergenic
1187447381 X:19371687-19371709 GGGTCCTGGCCCCTTCTCCCTGG + Intronic
1189033644 X:37474541-37474563 GGGACCAGGCATGTTCACCATGG + Intronic
1193721448 X:84991661-84991683 GTCACTGGGCCAGTTCTCCAGGG - Intergenic
1193822301 X:86181108-86181130 GGGACATAGCCAGTTCTTTAGGG - Intronic
1197089903 X:122523827-122523849 GGTACCTGACCACTTCTCCCAGG + Intergenic
1199727985 X:150603857-150603879 GGGACATGGACACTTTTCCATGG + Intronic
1200141935 X:153906816-153906838 AGGCTCTGGCCAATTCTCCACGG - Exonic
1200955291 Y:8938359-8938381 GAGACCTGCCCAGTGCTCGAGGG + Intergenic
1201390201 Y:13489732-13489754 GGCACCTGGGCACTTCTCCCAGG - Intergenic