ID: 1018202628

View in Genome Browser
Species Human (GRCh38)
Location 6:161409883-161409905
Sequence CAGGGTAAACTTTATGAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 167}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018202628_1018202629 -9 Left 1018202628 6:161409883-161409905 CCATTCTCATAAAGTTTACCCTG 0: 1
1: 0
2: 1
3: 12
4: 167
Right 1018202629 6:161409897-161409919 TTTACCCTGTCTTGCTTTTCAGG No data
1018202628_1018202633 20 Left 1018202628 6:161409883-161409905 CCATTCTCATAAAGTTTACCCTG 0: 1
1: 0
2: 1
3: 12
4: 167
Right 1018202633 6:161409926-161409948 GCAGAATTGGAAAATATTTCAGG No data
1018202628_1018202634 21 Left 1018202628 6:161409883-161409905 CCATTCTCATAAAGTTTACCCTG 0: 1
1: 0
2: 1
3: 12
4: 167
Right 1018202634 6:161409927-161409949 CAGAATTGGAAAATATTTCAGGG 0: 1
1: 0
2: 1
3: 47
4: 513
1018202628_1018202632 7 Left 1018202628 6:161409883-161409905 CCATTCTCATAAAGTTTACCCTG 0: 1
1: 0
2: 1
3: 12
4: 167
Right 1018202632 6:161409913-161409935 TTTCAGGTGAGAAGCAGAATTGG 0: 1
1: 0
2: 1
3: 29
4: 251

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018202628 Original CRISPR CAGGGTAAACTTTATGAGAA TGG (reversed) Intronic
904406414 1:30292174-30292196 CAAGTTAAACTTTATTAAAATGG + Intergenic
907532809 1:55118514-55118536 CAGGGAAAACTTTGTGACACAGG + Intronic
910130484 1:83899055-83899077 CAGGGTTAACTTTATAAAAATGG + Intronic
910664649 1:89711187-89711209 CAGTGTATATTTTCTGAGAAAGG - Intronic
911220327 1:95238705-95238727 AAAGGTAAAATTTAAGAGAATGG - Intronic
914406956 1:147385044-147385066 CTGGGTGAATTTTCTGAGAAGGG - Intergenic
916252921 1:162755776-162755798 CCTGGGAAACTTTATTAGAATGG + Intronic
916661029 1:166922306-166922328 TAGGATAAAATATATGAGAAGGG + Intronic
917464830 1:175266993-175267015 CAGGGCAAAGTTTAGAAGAAGGG + Intergenic
919231305 1:194778425-194778447 CAATGTAAATTTTATGTGAATGG + Intergenic
920547731 1:206832458-206832480 CATGGTAACCTTTCTGAGCAAGG + Intronic
920827940 1:209439203-209439225 CATGGTAAAGTTAATGAGAGAGG - Intergenic
921554606 1:216582981-216583003 CAGGAAAGACTTCATGAGAAAGG + Intronic
923348144 1:233077609-233077631 CAGGGAAGACTTTGTGAGAGAGG - Intronic
1063127820 10:3150887-3150909 CAGGGTAAACATTAGGAAAAAGG + Intronic
1066367792 10:34793478-34793500 CAGAGTAAACTTTCTAAGGATGG - Intronic
1066609352 10:37222732-37222754 CAGAGAAAGCTTTATGAAAATGG - Intronic
1069877600 10:71572666-71572688 CAGGGAAAAAATTATAAGAAAGG - Intronic
1071569258 10:86687457-86687479 CATGGTCAGCTTTAGGAGAAGGG + Intronic
1072326293 10:94301924-94301946 AAGGATAAACATTATGTGAATGG + Intronic
1074751847 10:116594548-116594570 CAGGGTGAATGCTATGAGAAAGG - Intronic
1078838038 11:15050824-15050846 AAGGATAAACTATATGAAAATGG + Intronic
1079768612 11:24428849-24428871 GAGAATAAACTTGATGAGAACGG + Intergenic
1080333074 11:31164091-31164113 AAGAGAAATCTTTATGAGAAAGG + Intronic
1082983275 11:59143543-59143565 CAATGTTAACTTTATGAAAATGG + Exonic
1087607279 11:100392223-100392245 CAGGGAAAACTTTAAGAGCCAGG - Intergenic
1089322469 11:117635715-117635737 AAGGGCAGAGTTTATGAGAAAGG + Intronic
1091197810 11:133746926-133746948 CAGGGTTACTTTTATGACAAAGG - Intergenic
1093338620 12:17942049-17942071 CAGTTTAAAATTGATGAGAAAGG - Intergenic
1101102375 12:101407341-101407363 GAGGGAAAACTTCATGATAAGGG + Intronic
1101125424 12:101628975-101628997 GAGGGTAAACTGTCTGACAAGGG - Intronic
1101209320 12:102520378-102520400 CAGGGTAAAAGTGATTAGAAGGG - Intergenic
1103811092 12:123614520-123614542 CAGGGTGAACTTTATTAGAAGGG + Intronic
1106219996 13:27738515-27738537 AAGGGTCAACTGTATTAGAAAGG - Intergenic
1107887096 13:44882704-44882726 CAGGGACAACTTTATTAAAAGGG - Intergenic
1109131178 13:58587860-58587882 CAGAGTAAAATTTATAAGAATGG - Intergenic
1109914275 13:68960129-68960151 CAAGGAAAACTCCATGAGAATGG - Intergenic
1111510292 13:89252752-89252774 CAGAATAAACTTTCTGAAAATGG - Intergenic
1111574692 13:90137227-90137249 CAAGGTAAACTTTATAAAAGAGG + Intergenic
1113991661 14:16032392-16032414 CAGGGTAAATCTTTTGTGAAAGG + Intergenic
1115165293 14:30441428-30441450 CAGGGCAAACTTGATGTGAGGGG - Intergenic
1117509525 14:56435840-56435862 CAAGTTAAAATTTATGAAAATGG - Intergenic
1118507518 14:66429698-66429720 AAGCATAAACTTTCTGAGAAAGG - Intergenic
1120389957 14:83893838-83893860 CAGGGTGACCTTGAAGAGAATGG - Intergenic
1124642921 15:31408425-31408447 CAGTGTCATCCTTATGAGAAAGG + Intronic
1126020342 15:44394306-44394328 CAGGGGATACATTCTGAGAAAGG + Intronic
1126310277 15:47308094-47308116 CAGGGTATATTTTATAAAAAAGG + Intronic
1126579044 15:50226161-50226183 CATGGTAAAATTTATCAGAGTGG + Intronic
1128572478 15:68744765-68744787 CACAGTGAACTTTAGGAGAAAGG + Intergenic
1130457506 15:84127553-84127575 CACAGTCAACTTTATTAGAAAGG + Intergenic
1133427080 16:5701922-5701944 CAGTATAAACTCTAGGAGAATGG + Intergenic
1133983447 16:10650562-10650584 CAGGGTCATCTTCATTAGAAGGG + Intronic
1135722060 16:24826411-24826433 CAGGGTAAACTTTTTAACACAGG + Intronic
1139183895 16:64780369-64780391 CATTGTAAACTTAATGAGAATGG - Intergenic
1139223309 16:65207607-65207629 CTGGAAAAACTTTATGAAAAGGG + Intergenic
1140814702 16:78610634-78610656 CTGGGTTCACTTTAGGAGAAGGG - Intronic
1143206607 17:5145073-5145095 CATTGTAAACTTTATGGGACTGG + Intronic
1145813130 17:27776882-27776904 CAGGGTAAACTTCAAAAGATGGG - Intronic
1147736149 17:42639645-42639667 CTGGGTAAACTTTCTCAAAAGGG - Intergenic
1149573037 17:57688413-57688435 AAGGATAAACTTTATAAGAGAGG + Intergenic
1151376355 17:73691497-73691519 CAGGGAAGACTGTAGGAGAAGGG - Intergenic
1152760956 17:82106829-82106851 CTGGGTAAAATTCATGAAAAGGG + Intronic
1154405312 18:14085209-14085231 CATGATAAACTTTATTATAAAGG + Intronic
1157754290 18:50204328-50204350 AAGGGTAAACTTTCTGAGCCAGG + Intergenic
1159968395 18:74619582-74619604 AATGGAAAACTTAATGAGAAAGG + Intronic
1161804756 19:6436472-6436494 CAGAGCAAATGTTATGAGAAAGG + Intronic
1162626893 19:11891782-11891804 CATGGGAAACTTTATGATCATGG + Intronic
1165385361 19:35507418-35507440 CAGGGTTGGCTTTAGGAGAAGGG - Intronic
1166087143 19:40484238-40484260 AAAGGTAAATTTTATGAAAAAGG + Intronic
1166435477 19:42763613-42763635 CAGGGTCAAATTTATGAAGAGGG + Intronic
1166445341 19:42853646-42853668 CAGGGTCAAATTTATGAAGAGGG + Intronic
1166448339 19:42877610-42877632 CAGGGTCAAATTTATGAAGAGGG + Intronic
1166452743 19:42915822-42915844 CAGGGTCAAATTTATGAAGAGGG + Intronic
1166455229 19:42935101-42935123 CAGGGTCAAATTTATGAAGAGGG + Intronic
1166465013 19:43024388-43024410 CAGGGTCAAATTTATGAAGAGGG + Intronic
1166471147 19:43080578-43080600 CAGGGTCAAATTTATGAAGAGGG + Intronic
1166482301 19:43184479-43184501 CAGGGTCAAATTTATGAAGAGGG + Intronic
1166491902 19:43267481-43267503 CAGGGTCAAATTTATGAAGAGGG + Intronic
928467921 2:31540477-31540499 CAGGGTAAACGTAATAAAAAGGG + Intronic
929252749 2:39777756-39777778 CAGGGAAAACTTTTTGACAGTGG - Intronic
929269111 2:39953457-39953479 CAGGGAAAACAGTAAGAGAAAGG + Intergenic
929985711 2:46730277-46730299 CAGGGTAAAACTTTTGAGATTGG + Intronic
933120584 2:78531896-78531918 CAGTGTAAACTGTATGAGCAAGG + Intergenic
935309053 2:101765030-101765052 CAAGGTAAACTTGAGGATAAAGG + Intronic
939575054 2:143885808-143885830 CAGGGTATAATTTAGGGGAAAGG + Intergenic
941248271 2:163128805-163128827 GATGGTAAACTTTATTATAAGGG + Intergenic
944657603 2:201891566-201891588 CAGGGTAATCTTGAGGAGGAAGG + Intronic
945215706 2:207431656-207431678 CAGGATAAAATTTATGAACAAGG - Intergenic
945473319 2:210252450-210252472 GAGGGTAATCTTTATGAAAAAGG - Intergenic
946192287 2:218013916-218013938 CAGGGCAAACTTGGGGAGAAGGG - Intergenic
946349324 2:219138807-219138829 CAGGGTAAACTCTATTGGGAAGG + Intronic
946991898 2:225341910-225341932 CAGGAGAAAATTTGTGAGAAAGG - Intergenic
1170452001 20:16492454-16492476 GGTGTTAAACTTTATGAGAAAGG - Intronic
1176318699 21:5283338-5283360 AAGGTTCAACTTTGTGAGAAAGG + Intergenic
1177912892 21:27053934-27053956 CAGGGGAACAGTTATGAGAATGG + Intergenic
1178518412 21:33267157-33267179 CAGGGAAGAGTTCATGAGAAAGG - Intronic
1180396478 22:12349593-12349615 AAGGTTCAACTTTGTGAGAAAGG + Intergenic
1180403236 22:12514536-12514558 AAGGTTCAACTTTGTGAGAAAGG - Intergenic
1182760934 22:32721859-32721881 CAGGGAAGGCTTTCTGAGAAGGG + Intronic
1183837236 22:40464903-40464925 CAGGGTAAAATTGATAAGAGGGG - Intronic
1184558902 22:45249977-45249999 CAGGGGAAACATTTTGATAAGGG + Intergenic
949744319 3:7270828-7270850 AAGGGAAAACTTGAAGAGAAAGG + Intronic
949804835 3:7943417-7943439 AAAGGTAAACTTTATGTAAACGG - Intergenic
951275917 3:20685911-20685933 CAAAGTTAACATTATGAGAATGG - Intergenic
953135844 3:40181124-40181146 CACAGTAAACTGTATGATAATGG - Intronic
954001022 3:47557185-47557207 CAGGATAAATTATCTGAGAAAGG + Intergenic
954469134 3:50676525-50676547 CAGGGAATACTCTAAGAGAAGGG - Intronic
956369494 3:68542991-68543013 CAGGGTAAAATTCAACAGAAAGG + Intronic
958987286 3:100796430-100796452 CAGGGTATGGTTTATGAGGAAGG + Exonic
960655345 3:119997846-119997868 AAGGATAAACTTTATAAAAATGG + Intronic
963208029 3:142656374-142656396 AAGGGTAAAATATATGAAAATGG - Intronic
963409615 3:144910587-144910609 CAGTTTAAACTTTATTAGCAAGG + Intergenic
964252513 3:154735015-154735037 TAGGTTAAAGTTTATTAGAAGGG + Intergenic
966053125 3:175646795-175646817 AAGGGGAAACTATATAAGAAAGG - Intronic
973320961 4:48809800-48809822 CAGGGCAAACTTTCTGGGAAAGG - Intronic
974146141 4:57949812-57949834 CAGGGTTAAGATTATGAGTATGG - Intergenic
976319856 4:83701800-83701822 CAGGGAATTCTTTATAAGAAAGG - Intergenic
976768205 4:88620768-88620790 CAGGGTAAACACTCTGAGGAGGG - Intronic
977794244 4:101143371-101143393 AAGGGAAAACTTTATGACCATGG - Intronic
978480412 4:109183722-109183744 AAAGGCAAACTTTATGAGAGAGG + Intronic
979771430 4:124529693-124529715 CAAGGAAAACTGTCTGAGAATGG + Intergenic
981778530 4:148398041-148398063 CAGGGGAAACCATATGACAATGG - Intronic
981944854 4:150329675-150329697 CAGGGCAAACTTCATGGGAGTGG - Intronic
983426029 4:167583941-167583963 CAGGGTATAATATATGTGAAAGG - Intergenic
984371179 4:178867236-178867258 CATGGTAAAATTTATCAGCAAGG - Intergenic
984963336 4:185119486-185119508 AAGGGTAAACGTTTTGGGAAGGG - Intergenic
986627571 5:9736928-9736950 TAGGGAGAACTTAATGAGAAAGG - Intergenic
988656957 5:33222515-33222537 CAGGAATAACTTTATGACAAAGG + Intergenic
990642227 5:57799608-57799630 CAGGGTAATCTTTAACAAAATGG - Intergenic
992088843 5:73300371-73300393 CAGGGTAAATTATAGGATAATGG - Intergenic
992657569 5:78925584-78925606 CAGGGTAGAATTTAAGAAAAAGG + Intronic
993060499 5:83032898-83032920 CAGGGCAAACTTAAGGAGTAGGG - Intergenic
994049643 5:95348033-95348055 TAGGGTAAACATTGGGAGAATGG + Intergenic
994682467 5:102906363-102906385 CAGAGAAAACTTCATGATAAAGG + Intronic
995578090 5:113562923-113562945 CAGTGTAAACTCAATGAGAATGG + Intronic
995740714 5:115353333-115353355 CAGTGAAAACATTATGTGAAGGG + Intergenic
996703652 5:126475079-126475101 CAGGGTAAACTGCTTTAGAAGGG - Intronic
996992076 5:129647477-129647499 CAGGGTAAAGATTATGGGTAGGG - Intronic
998906492 5:146910994-146911016 CAGAGTTAACTATATGAAAAGGG - Intronic
999486400 5:152001141-152001163 TAGGGTTAGCTATATGAGAATGG + Intergenic
1004204057 6:13574889-13574911 CAGGGTGACCTTTCTGAAAAGGG - Intronic
1004261278 6:14109707-14109729 CTGTGTAAACTTCTTGAGAATGG + Intergenic
1004734713 6:18393794-18393816 AAGGGGAAAGTTTTTGAGAAGGG - Intronic
1014005239 6:116410299-116410321 CAGGGTAGTCTTTGTGGGAAGGG - Intronic
1014618941 6:123641593-123641615 CAGGAAAAACTTTAAGAGAAAGG + Intergenic
1015252027 6:131136646-131136668 CATCTTAAACTTTATGAGTAAGG - Intronic
1018202628 6:161409883-161409905 CAGGGTAAACTTTATGAGAATGG - Intronic
1020971832 7:14953120-14953142 CAGGGTAAAATTTCTGACATTGG + Intronic
1021913120 7:25406031-25406053 CAGGGAAAGATTTATGAGCAAGG - Intergenic
1022503980 7:30899301-30899323 CAGCGTAAACTATATAAGATTGG + Intergenic
1022552958 7:31259133-31259155 CATGGAGAACTTTATGTGAATGG + Intergenic
1022958360 7:35401834-35401856 CAGGGAAGATTTTATGAGCAGGG + Intergenic
1025265597 7:57454156-57454178 TATGCTAAACTTTATGAGATGGG + Intronic
1025719008 7:63992189-63992211 TATGCTAAACTTTATGAGATGGG + Intergenic
1026337009 7:69403069-69403091 CAATGTAAACATGATGAGAATGG + Intergenic
1028098545 7:86792498-86792520 TAGGCTAAACTGTTTGAGAATGG + Intronic
1028131550 7:87181513-87181535 CAGATTATACATTATGAGAATGG - Intronic
1028638919 7:93021677-93021699 CAGGGTCAACTGTGTTAGAAAGG + Intergenic
1030928375 7:115486973-115486995 GAGGGGAATCTTTATTAGAATGG + Intergenic
1032848289 7:135770469-135770491 CAAGGATAACTTCATGAGAAGGG + Intergenic
1033408975 7:141098892-141098914 AAGGGTAAACTTCATCGGAAAGG - Intronic
1037546349 8:19927685-19927707 AAAGGTAAACTTTATAAGAAAGG + Intronic
1040813859 8:51485610-51485632 CAGAGGAAACATTAGGAGAAAGG - Intronic
1041681766 8:60600809-60600831 CAGGATCAACCTTTTGAGAATGG - Intronic
1041704616 8:60832698-60832720 CAGGGTAAACTTGATGGAACTGG - Intronic
1042069981 8:64921612-64921634 CAGGAAAAACTTCATGACAATGG - Intergenic
1044360333 8:91275777-91275799 AAGGGTAAATTGTGTGAGAAGGG + Intronic
1044974824 8:97654033-97654055 CAGGGTTACCTTTATGAGATGGG - Intronic
1045798617 8:106076353-106076375 CAGGTTAAATTTTTTGAAAATGG - Intergenic
1047112324 8:121804125-121804147 TAGTTTTAACTTTATGAGAATGG + Intergenic
1049858784 8:144883035-144883057 CAAGGCAAGCTTTAAGAGAAAGG + Intronic
1050005555 9:1125920-1125942 CAGGGTGAACTTGAAAAGAAAGG - Intergenic
1050760382 9:9062049-9062071 TGGGGTTAATTTTATGAGAAAGG - Intronic
1051656205 9:19384270-19384292 AGGGGTAAACTTTATGACACTGG - Intergenic
1054913778 9:70477671-70477693 TAGGGTAAACTACATGAGACTGG + Intergenic
1059489107 9:114652537-114652559 CAGGGGATACAGTATGAGAATGG + Intergenic
1061598866 9:131652117-131652139 CAGGGTAAACTTTATAACCATGG + Intronic
1186235732 X:7507472-7507494 TAGGGTAAACTTGATACGAATGG + Intergenic
1191605411 X:63057296-63057318 CAGGGACAACTTTTTGGGAAGGG + Intergenic
1194674563 X:96778819-96778841 CAGGGTAAACATTGTGGGCAAGG + Intronic
1196274060 X:113745705-113745727 CAGAGTATACTTTCTGAGATGGG - Intergenic