ID: 1018203440 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 6:161415621-161415643 |
Sequence | GCTTAGTTCCGGGCGGTCGG GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1018203440_1018203447 | -2 | Left | 1018203440 | 6:161415621-161415643 | CCCCCGACCGCCCGGAACTAAGC | No data | ||
Right | 1018203447 | 6:161415642-161415664 | GCCACAGCCACCTCCTGCCCTGG | 0: 1 1: 0 2: 5 3: 76 4: 635 |
||||
1018203440_1018203454 | 25 | Left | 1018203440 | 6:161415621-161415643 | CCCCCGACCGCCCGGAACTAAGC | No data | ||
Right | 1018203454 | 6:161415669-161415691 | TGCAATAGTCTAATCTCTCCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1018203440 | Original CRISPR | GCTTAGTTCCGGGCGGTCGG GGG (reversed) | Intronic | ||