ID: 1018203440

View in Genome Browser
Species Human (GRCh38)
Location 6:161415621-161415643
Sequence GCTTAGTTCCGGGCGGTCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018203440_1018203447 -2 Left 1018203440 6:161415621-161415643 CCCCCGACCGCCCGGAACTAAGC No data
Right 1018203447 6:161415642-161415664 GCCACAGCCACCTCCTGCCCTGG 0: 1
1: 0
2: 5
3: 76
4: 635
1018203440_1018203454 25 Left 1018203440 6:161415621-161415643 CCCCCGACCGCCCGGAACTAAGC No data
Right 1018203454 6:161415669-161415691 TGCAATAGTCTAATCTCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018203440 Original CRISPR GCTTAGTTCCGGGCGGTCGG GGG (reversed) Intronic