ID: 1018206752

View in Genome Browser
Species Human (GRCh38)
Location 6:161443739-161443761
Sequence AGCACACTTGTTTCTACCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 137}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018206752_1018206755 21 Left 1018206752 6:161443739-161443761 CCTTTGGTAGAAACAAGTGTGCT 0: 1
1: 0
2: 0
3: 15
4: 137
Right 1018206755 6:161443783-161443805 GCCTAAACTGATGCCCCGGTAGG No data
1018206752_1018206753 17 Left 1018206752 6:161443739-161443761 CCTTTGGTAGAAACAAGTGTGCT 0: 1
1: 0
2: 0
3: 15
4: 137
Right 1018206753 6:161443779-161443801 TCCTGCCTAAACTGATGCCCCGG 0: 1
1: 0
2: 0
3: 10
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018206752 Original CRISPR AGCACACTTGTTTCTACCAA AGG (reversed) Intronic
904582269 1:31553202-31553224 ACAACACTTGTGTCTAACAAAGG - Intergenic
905421995 1:37853542-37853564 AGCACACTTTTTTCTGCTTAGGG - Intronic
908346188 1:63236092-63236114 TGCAGACATGTTTCTTCCAATGG + Intergenic
908791141 1:67782876-67782898 AAAACACATGTTTCTATCAAAGG - Intronic
913663229 1:121022776-121022798 ATCACACTAGTTTCTAGCAATGG + Intergenic
914014615 1:143806041-143806063 ATCACACTAGTTTCTAGCAATGG + Intergenic
914163205 1:145155160-145155182 ATCACACTAGTTTCTAGCAATGG - Intergenic
914653239 1:149714598-149714620 ATCACACTAGTTTCTAGCAATGG + Intergenic
917619546 1:176782084-176782106 AGCATTCAGGTTTCTACCAATGG - Intronic
920608360 1:207412409-207412431 GGCACATTTCATTCTACCAAGGG - Intergenic
921935902 1:220796778-220796800 AGCAGACTTGTTCCGACCCAAGG + Exonic
1063143969 10:3279882-3279904 TGCACAGTTGTTTCTGCAAACGG - Intergenic
1065229345 10:23581291-23581313 ATCACACATGTTTATAACAAGGG + Intergenic
1067298810 10:44991577-44991599 AGCACCATTGTTTCTAACAATGG - Intronic
1068029225 10:51686624-51686646 AGCACATTTGTTTCCCCCATAGG + Intronic
1073548685 10:104376653-104376675 ACCTCACTTGGTTATACCAAAGG + Intronic
1078538209 11:12192163-12192185 AGCACATTTTTTTCTATAAAGGG - Intronic
1079162532 11:18008471-18008493 ACCACACTTTTTTCTACCTCAGG + Intronic
1079665532 11:23100326-23100348 AGCACAGCAGTTTCTAGCAATGG + Intergenic
1080870251 11:36230418-36230440 AGGACACTGGTTTCTATCACAGG + Exonic
1081099382 11:38982998-38983020 AGCACTCTGCTTTCCACCAAAGG + Intergenic
1081124325 11:39304148-39304170 AGAACACTTTTTTCCCCCAAAGG - Intergenic
1085153450 11:74271153-74271175 AGTTCACTTGCATCTACCAAGGG - Intronic
1085850920 11:80118814-80118836 AGCACATTTGTTTTTATCTATGG - Intergenic
1086661171 11:89420422-89420444 AGCAGTCTTTTATCTACCAAGGG + Intronic
1090447065 11:126773632-126773654 AGCACACTAGCTTCTGCCATAGG + Intronic
1092468228 12:8754449-8754471 AGCAATCTTGTTTGGACCAATGG - Intronic
1094695136 12:32810456-32810478 TGCACACCTGTTTCAAGCAATGG + Intronic
1095339587 12:41073754-41073776 AGCAGACTTATTTCTAGTAATGG - Intergenic
1096418054 12:51430831-51430853 AGTAAACTTGTTACTACCTATGG - Intronic
1097611616 12:61830098-61830120 AACCCACCTGTATCTACCAATGG + Intronic
1097931310 12:65190005-65190027 ACCACACTAGTTTTTTCCAAGGG + Intronic
1099042769 12:77676479-77676501 AGCCCACTTGTTTCTAACCCTGG - Intergenic
1099596037 12:84667682-84667704 CCAAAACTTGTTTCTACCAAAGG + Intergenic
1100113101 12:91269581-91269603 AGCACACCTGATACTACCCAAGG - Intergenic
1100649024 12:96564488-96564510 AGCAAAGATATTTCTACCAAGGG + Exonic
1106062882 13:26312106-26312128 AGCACTCTTGTGTCTAGCTACGG + Intronic
1107659390 13:42623623-42623645 CCCACACATGCTTCTACCAAAGG + Intergenic
1111742084 13:92217219-92217241 AGCATACTTTTAACTACCAATGG + Intronic
1112128609 13:96497186-96497208 AGCACACATATATCTACCACTGG - Intronic
1115041339 14:28932781-28932803 AGCACACTGGTTCCTACAACTGG - Intergenic
1121075213 14:91062016-91062038 AGCACACTTTTTTCTATTAAGGG + Intronic
1128580435 15:68806212-68806234 ACCAGACTTGTATCGACCAATGG - Intronic
1129816320 15:78557579-78557601 AGCAAGCTCTTTTCTACCAAAGG + Intergenic
1132217635 15:100078386-100078408 AGGACAGTCGTTTCTAACAATGG + Intronic
1134544898 16:15100678-15100700 AGCTGACTTGTTTATACCAGTGG - Intronic
1135362529 16:21827395-21827417 AGCTGACTTGTTTATACCAGTGG - Intergenic
1135664559 16:24325029-24325051 AGCACTCTTGGTTCTTCAAAGGG - Intronic
1137784449 16:51126321-51126343 AGCACATTTGTTCCCTCCAAAGG + Intergenic
1138815908 16:60202371-60202393 CACACATTTGTTTCTGCCAAAGG - Intergenic
1141775948 16:86122628-86122650 AGCACCCTTGATTCTGCCAATGG + Intergenic
1144289860 17:13816012-13816034 ATCACACTTCTTTCTGCCACTGG - Intergenic
1146405865 17:32537067-32537089 AGCAGACTTGTTTCCTCCTAGGG + Intronic
1151234083 17:72705918-72705940 AGCACATTTCTTCCTCCCAATGG + Intronic
1151411158 17:73930730-73930752 GGCACAGTTGTTGCTACGAATGG - Intergenic
1153939038 18:9961132-9961154 AGCACACCAGTCTCTAGCAAAGG + Intergenic
1157832264 18:50867365-50867387 AGCAGACTTGTTTCTAGATAGGG - Intergenic
1158245335 18:55426037-55426059 AGCAGACTTGTTTCTAAAGAAGG + Intronic
1158254752 18:55533281-55533303 AGCACTCTGGCTTCTATCAAAGG + Intronic
1160080085 18:75718046-75718068 AGCAAACTTGCTCCTACCCAGGG + Intergenic
1164089747 19:21938493-21938515 TGCAAACTTGTTTCTACACATGG + Intronic
1164194062 19:22938412-22938434 TGCAAACTTGTTTCTACACATGG + Intergenic
1164405494 19:27941820-27941842 AGCAAACTTGGTTTGACCAAAGG + Intergenic
926794720 2:16609461-16609483 AGACCACATGTTTCTACCACGGG + Intronic
927506287 2:23617041-23617063 AACACACTTTTATTTACCAAAGG + Intronic
930728169 2:54702305-54702327 AGCAAACTTGTTTTCAACAAAGG + Intergenic
931669319 2:64632511-64632533 GGCACCCTTGTTCATACCAAAGG - Exonic
933040932 2:77465704-77465726 AACACATATGTTTCTGCCAAAGG + Intronic
933413560 2:81955055-81955077 AACACACTTGTTTATACAGATGG - Intergenic
935430720 2:102973027-102973049 AGAGCACTTGTGTCTTCCAAAGG - Intergenic
936550612 2:113436009-113436031 AGTTCACTTTATTCTACCAAAGG - Intergenic
940269993 2:151880204-151880226 AGCATTCTTCTTTCTATCAAAGG + Intronic
942375385 2:175331276-175331298 AAGACACTAGTTTCCACCAAGGG - Intergenic
944255843 2:197622870-197622892 AGCACATCTGTTTATAGCAAGGG + Intronic
946008813 2:216548377-216548399 AGCCCACTTTTTTCCATCAAAGG - Intronic
1169704793 20:8490408-8490430 AGCTGAGTTGTTTCTACCAATGG - Intronic
1170520626 20:17180830-17180852 ACCACACTTGTTCCCAGCAATGG + Intergenic
1180366929 22:11948652-11948674 AGCACACTTTCTTCAACAAATGG + Intergenic
1183414775 22:37675940-37675962 AGCACAGTTATTTCTGCCCAGGG + Intronic
951658457 3:25035639-25035661 AGCAGACTTTTTTCTACAAAAGG + Intergenic
951746211 3:25980557-25980579 AGGAAACCTGTTTCCACCAACGG - Intergenic
960088195 3:113613090-113613112 AGAACACTTTTTTCTACCTCTGG + Intronic
960536147 3:118816389-118816411 AGGACAATTGTTTGTCCCAATGG - Intergenic
960545684 3:118912286-118912308 AGCACAGTTGTTTCTCACAATGG - Intronic
961625413 3:128259121-128259143 AGCACAATTGCTTGTACCATTGG + Intronic
965219336 3:165906318-165906340 AGCACAGTTTTTTCAACAAATGG + Intergenic
965585564 3:170314817-170314839 ACCACGCTTGTTTCCACCTAAGG + Intergenic
970053543 4:11945178-11945200 AGAGCACTTGTTTTTACCAGCGG - Intergenic
970198742 4:13579795-13579817 AGGACAATTATTTTTACCAAGGG + Intronic
970224095 4:13839172-13839194 AGCACACTTGTGACTATCATGGG + Intergenic
970920286 4:21386011-21386033 ATCACACTTGTCTCTTTCAAAGG + Intronic
971144339 4:23960721-23960743 AGCTCTCTTATTTCTACCTAAGG + Intergenic
976315864 4:83658148-83658170 AGCATACTTGGTACTAGCAACGG - Intergenic
978915085 4:114115443-114115465 AGCACATTTGTTTCTAATAATGG + Intergenic
983248696 4:165320042-165320064 AGAACACTTCTGTCAACCAAGGG + Intronic
984304960 4:177977114-177977136 AGATTACTTCTTTCTACCAATGG + Intronic
986100558 5:4606100-4606122 AGCTCATTTGTTTCTCCAAAAGG + Intergenic
991899977 5:71451029-71451051 TCTACACGTGTTTCTACCAATGG - Intergenic
992186568 5:74250249-74250271 AGCACCCTTGTGTCTCCCCATGG - Intergenic
993476135 5:88366877-88366899 AGTACCCTTATTACTACCAATGG + Intergenic
996692493 5:126355520-126355542 ACCACACTTGTTTCTACCCCTGG - Intergenic
996861545 5:128072634-128072656 AAAACACAGGTTTCTACCAATGG + Intergenic
997012845 5:129899335-129899357 AGCAGATTTGATGCTACCAAAGG - Intergenic
997628772 5:135350349-135350371 AGCACACTTGTTCCTGAAAATGG - Intronic
997753390 5:136371681-136371703 AGGACACATCTTTTTACCAAAGG + Intronic
999498462 5:152123666-152123688 AGAACCCTTGTTTCTTCCGAGGG + Intergenic
1000977248 5:167778708-167778730 AGCACAATTTTTCCTACAAAAGG + Intronic
1003996006 6:11539537-11539559 AGGACACTGGTTTCTTCGAATGG + Intronic
1005251467 6:23950993-23951015 AACACCCTTGGTTCTACCTAAGG - Intergenic
1008448480 6:51621416-51621438 AGCACTATTGGTTTTACCAAGGG - Intronic
1008458883 6:51744339-51744361 AGCACCCTTGCCTCTACCACAGG + Intronic
1009321019 6:62288073-62288095 AGCACAGTTCTTTCCACCACAGG - Intergenic
1009460081 6:63902406-63902428 AGTACACTTGTTTCTTCCTGAGG - Intronic
1011429806 6:87273389-87273411 CTCACACTGGTTTCTACTAAGGG - Intergenic
1013545270 6:111150685-111150707 TGCTCAGTTCTTTCTACCAAAGG + Intronic
1016080940 6:139855031-139855053 AATACATTTGTTTCTACAAAAGG - Intergenic
1016679050 6:146807137-146807159 AACATACTTTTTTTTACCAAAGG - Intronic
1018058606 6:160072451-160072473 AGCACACCTCTTGCTGCCAATGG - Intronic
1018206752 6:161443739-161443761 AGCACACTTGTTTCTACCAAAGG - Intronic
1018611672 6:165653616-165653638 ACCACACGTGTCTCTACCAGCGG + Intronic
1021515812 7:21485205-21485227 AGCATAGTTGTTGCTACGAATGG - Intronic
1022330960 7:29378618-29378640 GGCAAACTTTTTTCTAGCAAGGG - Intronic
1024729863 7:52242332-52242354 AGCAGACTTCTTTCTACCTTGGG + Intergenic
1027929540 7:84513819-84513841 AGCACACTTGTTCTTCCCCAAGG - Intergenic
1030133007 7:106219128-106219150 ACCACATCTGTTTGTACCAATGG + Intergenic
1032269643 7:130392783-130392805 AGCAGCAGTGTTTCTACCAAAGG + Intergenic
1032779365 7:135151299-135151321 TGGACTCATGTTTCTACCAAAGG + Intronic
1033374894 7:140749847-140749869 AGAAAAGTTGTTTGTACCAATGG - Intronic
1034309973 7:150078919-150078941 AGCTCACTTGTCTCTACTGAAGG + Intergenic
1034796872 7:154021702-154021724 AGCTCACTTGTCTCTACTGAAGG - Intronic
1035322446 7:158041854-158041876 ATCACACTTCTTCCTACCCACGG + Intronic
1041142390 8:54836475-54836497 AGCAAACATTTTTCTCCCAATGG + Intergenic
1042456400 8:69009122-69009144 ACCAGAATTGTTTCTATCAAAGG - Intergenic
1047261932 8:123270878-123270900 ATCACATTTGTTTAGACCAAAGG + Intronic
1047332099 8:123899741-123899763 AGGACACTTTTTTCAACAAATGG - Intronic
1047577841 8:126177782-126177804 AGCAAACTTTTTTCTACAAAGGG + Intergenic
1049902322 9:180814-180836 AGTTCACTTTATTCTACCAAAGG + Intergenic
1051218231 9:14821709-14821731 ACCACACTTATTTCTATCACTGG - Intronic
1052029650 9:23613797-23613819 ACTACACTGGTTTCAACCAATGG + Intergenic
1053111448 9:35463724-35463746 AGCAAACTTGTTCCTACCCTAGG + Intergenic
1054481922 9:65674110-65674132 AGTTCACTTTATTCTACCAAAGG - Intronic
1055516422 9:77038146-77038168 TGTTCACTTGTTTCTACCAAAGG - Intergenic
1056255355 9:84793960-84793982 AGCACAGTTTTTTCTGCAAAGGG - Intronic
1056378790 9:86038641-86038663 AGCACACTGATTTCTGACAAAGG + Intronic
1060459950 9:123842129-123842151 AACATACTTGTTTCTTTCAAAGG - Intronic
1061884067 9:133582805-133582827 AGCACTCATGTCTCTACCCAAGG - Intronic
1187988401 X:24840869-24840891 GGCACACATGTTTTGACCAAGGG + Intronic
1193843283 X:86436332-86436354 GGCACATTTTTTTCTACCTAAGG + Intronic
1195173912 X:102296573-102296595 AGCATTCATATTTCTACCAACGG - Intergenic
1195184953 X:102390520-102390542 AGCATTCATATTTCTACCAACGG + Intronic
1197508365 X:127337643-127337665 AGCATAGTTGTTTCAACAAATGG - Intergenic
1199133489 X:144223169-144223191 ATAACACTTGGTTCTACAAAAGG + Intergenic
1201492222 Y:14554789-14554811 AGGACACCTGTTTCTACCACTGG - Intronic