ID: 1018208585

View in Genome Browser
Species Human (GRCh38)
Location 6:161458733-161458755
Sequence ACTACAGAATTCCACAGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 832
Summary {0: 1, 1: 0, 2: 4, 3: 70, 4: 757}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018208585_1018208586 -9 Left 1018208585 6:161458733-161458755 CCATGTCTGTGGAATTCTGTAGT 0: 1
1: 0
2: 4
3: 70
4: 757
Right 1018208586 6:161458747-161458769 TTCTGTAGTCTGCATGTGTTAGG 0: 1
1: 0
2: 0
3: 18
4: 349
1018208585_1018208588 -2 Left 1018208585 6:161458733-161458755 CCATGTCTGTGGAATTCTGTAGT 0: 1
1: 0
2: 4
3: 70
4: 757
Right 1018208588 6:161458754-161458776 GTCTGCATGTGTTAGGCTGTGGG 0: 1
1: 0
2: 0
3: 9
4: 165
1018208585_1018208587 -3 Left 1018208585 6:161458733-161458755 CCATGTCTGTGGAATTCTGTAGT 0: 1
1: 0
2: 4
3: 70
4: 757
Right 1018208587 6:161458753-161458775 AGTCTGCATGTGTTAGGCTGTGG No data
1018208585_1018208590 17 Left 1018208585 6:161458733-161458755 CCATGTCTGTGGAATTCTGTAGT 0: 1
1: 0
2: 4
3: 70
4: 757
Right 1018208590 6:161458773-161458795 TGGGTAGGCAAGCTTGTCAATGG 0: 1
1: 0
2: 0
3: 5
4: 90
1018208585_1018208589 2 Left 1018208585 6:161458733-161458755 CCATGTCTGTGGAATTCTGTAGT 0: 1
1: 0
2: 4
3: 70
4: 757
Right 1018208589 6:161458758-161458780 GCATGTGTTAGGCTGTGGGTAGG 0: 1
1: 0
2: 0
3: 21
4: 239

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018208585 Original CRISPR ACTACAGAATTCCACAGACA TGG (reversed) Intronic
900085090 1:889303-889325 ATAACAGAATACCACAGACTAGG - Intergenic
900723904 1:4202170-4202192 ATAACAGAATACCACAGACTGGG + Intergenic
901233717 1:7656147-7656169 ACAACAGAATACCACAGACTGGG - Intronic
901360026 1:8690088-8690110 ATAACAGAATACCACAGACTGGG + Intronic
901692649 1:10983562-10983584 ACGACAGAGTACCACAGACTTGG - Intergenic
902087409 1:13874169-13874191 GTAACAGAATGCCACAGACAGGG + Intergenic
903550213 1:24152835-24152857 ACTACTGAATTCCAGGGAGAGGG + Intergenic
904365337 1:30007573-30007595 ACTTCTGAATTCCTCAGATAAGG + Intergenic
904729744 1:32580740-32580762 ATAACAGAATACCACAGACTGGG + Intronic
905967339 1:42109881-42109903 ATAACAGAATACCACAGACTGGG - Intergenic
906366397 1:45213730-45213752 ATAACAGAATACCACAGACTGGG + Intronic
906824378 1:48963053-48963075 ATCACAGAATACCACAGACTGGG + Intronic
906907611 1:49912706-49912728 ATAACAGAATACCACAGACTAGG + Intronic
907275929 1:53316654-53316676 ACAAAAGAATTCCACAGAATGGG + Intronic
908942832 1:69456004-69456026 ATAACAGAATACCACAGACTAGG - Intergenic
909353081 1:74676390-74676412 ATAACAGAATACCACAGATAAGG + Intergenic
909483249 1:76147944-76147966 ACAACAACATTCCAAAGACAGGG - Intronic
910194504 1:84626075-84626097 ATAACAGAATACCACAGACTGGG - Intergenic
910232589 1:85001516-85001538 ATTACAGAATACTACAGACCGGG - Intronic
910324158 1:85985391-85985413 ACTACAGAATTATACAGAGAGGG + Intronic
910410150 1:86934540-86934562 ACTACAGAAAACCACAGCTACGG - Intronic
910722955 1:90307569-90307591 ACAACAGAATACCACAGACTGGG - Intergenic
911002802 1:93183311-93183333 ACTACAGAATCTTTCAGACAAGG + Intronic
911547821 1:99241569-99241591 ACAACAAAATTCCACAAACTGGG + Intergenic
911860780 1:102945416-102945438 ATAACAGAATACCACAGACTGGG - Intronic
911931390 1:103908451-103908473 ATTACAGAATACCACAGACTAGG - Intergenic
912434207 1:109648395-109648417 ACTGCATGATTCCACTGACATGG + Intergenic
912864638 1:113246343-113246365 ATAACAGAATACCACAGACTGGG - Intergenic
914425892 1:147575513-147575535 ACTACAGAATCACACAGAGTTGG - Intronic
915114303 1:153586246-153586268 ATAACAGGATTCCCCAGACAGGG + Intergenic
915754781 1:158249259-158249281 ACAACAGAATACCACAGACTGGG + Intergenic
915852406 1:159339648-159339670 ATAACAGAATACCACAGACTGGG + Intergenic
916501227 1:165388995-165389017 AATAGAGAAATACACAGACATGG + Intergenic
916689410 1:167176260-167176282 ACAACAAAATGCCACAGACTGGG + Intergenic
916690673 1:167187062-167187084 ATAACAGAATACCACAGACTAGG - Intergenic
917833429 1:178918449-178918471 ACTGCATATTTCCACAGATATGG - Exonic
918156498 1:181851947-181851969 ACCACACAATTTCACAGAAATGG + Intergenic
918553579 1:185772719-185772741 ATAACAGAATGCCACAGACTGGG + Intronic
918656687 1:187035530-187035552 ATAACAAAATACCACAGACAGGG + Intergenic
918712514 1:187748821-187748843 ATAACAGAATTCCACAGACTGGG - Intergenic
919319539 1:196018159-196018181 ATAACAAAATTCCACAGACTGGG + Intergenic
919409872 1:197229190-197229212 ACGACAGAATATCACAGACTGGG - Intergenic
919527309 1:198669573-198669595 ACTGCTGAATCCCACCGACATGG + Intronic
920041046 1:203097549-203097571 ATAACAGAATACCACAGACTGGG + Intronic
920834354 1:209495061-209495083 ACAACAGAATACCATAGACTAGG + Intergenic
921316013 1:213891610-213891632 ATAACAGAATACCACAGACTGGG - Intergenic
921701302 1:218271788-218271810 ACAACAGAATGCCACAGACTAGG - Intergenic
921830542 1:219723548-219723570 ATAACAGAATACCACAGACTAGG - Intronic
921893274 1:220373637-220373659 ATTACAGAATGCCACAGACAGGG + Intergenic
922188722 1:223298291-223298313 GCTTATGAATTCCACAGACAAGG + Intronic
922374614 1:224949276-224949298 ACTGCAGAATGCCAAAGACAAGG - Intronic
922506614 1:226129817-226129839 CATACAGAATTCCACAGAGTGGG - Intergenic
922562815 1:226581370-226581392 ATAACAGAATACCACAGACTCGG + Intronic
922671311 1:227510344-227510366 ACTTCAGAACTGTACAGACAGGG + Intergenic
923016432 1:230130107-230130129 ACTACAAAGTTCCACAGTGATGG - Intronic
923714209 1:236411233-236411255 GCAACAGAATACCACAGACTGGG + Intronic
924637784 1:245804894-245804916 ACAACAAAATACCACAGACTGGG - Intronic
1062763463 10:44943-44965 ACTTCAGAACTGTACAGACAGGG - Intergenic
1063551662 10:7039591-7039613 ATCACAGAATACCACAGACTAGG - Intergenic
1063796328 10:9517477-9517499 ATAGCAAAATTCCACAGACAAGG - Intergenic
1063802246 10:9593542-9593564 ACTACAGAAAACCAAAGACAAGG + Intergenic
1064653197 10:17530204-17530226 ATAACAGAATACCACAGACTGGG - Intergenic
1064685627 10:17858365-17858387 ACTGCAGAATGCCAAAGACAAGG - Intronic
1064878609 10:20023675-20023697 ATAACAGAATACCACAGACTGGG - Intronic
1064950971 10:20849721-20849743 ATAACAGAATACCACAGACGGGG - Intronic
1065064523 10:21947091-21947113 ATGACAGAATACCACAGACTGGG - Intronic
1065314224 10:24446556-24446578 ACAAAAGAATCCCACAGAAATGG + Intronic
1065619443 10:27565558-27565580 AAAACAGAATACCACAGACTGGG + Intergenic
1065678641 10:28206098-28206120 ATAACAGAATACCACAGACTAGG - Intronic
1065783918 10:29195410-29195432 ATAACAGAATACCACAGACTAGG - Intergenic
1065835112 10:29650100-29650122 ATAACAGAATACCACAGACTGGG - Intronic
1066113358 10:32217471-32217493 AATACTGATTTCCAAAGACAAGG + Intergenic
1066179737 10:32948802-32948824 ATAACAGAATGCCACAGACTGGG - Intronic
1066233287 10:33459336-33459358 ATAACAGAATACCACAGACTGGG - Intergenic
1066701289 10:38131690-38131712 GCTACAAAATTCAACAGAAAAGG - Intergenic
1067221917 10:44350353-44350375 ATAACAGAATACCACAGACCGGG + Intergenic
1068011631 10:51458852-51458874 ACTACAGAAACCCACACATAAGG + Intronic
1069632756 10:69907325-69907347 ATAACAGAATACCACAGACTGGG + Intronic
1071036643 10:81255534-81255556 ATAACAGAATACCACAGACTGGG + Intergenic
1071183047 10:83009068-83009090 ACCACAGAGTGCCACAGAAAAGG + Intergenic
1071980762 10:91002562-91002584 ACAACAGAATGCTACAGACTGGG - Intergenic
1072441149 10:95456547-95456569 ATAACAGAATACCACAGACTGGG - Intronic
1073026624 10:100492041-100492063 ATAACAGAATACCACAGACTGGG - Intronic
1073750969 10:106526757-106526779 ATAACAGAATTCCAAAGACGTGG - Intergenic
1073919174 10:108439442-108439464 ACAACAAAATACCACAGACTGGG + Intergenic
1073977689 10:109119318-109119340 ACTCCAGAGTTACACAGACCAGG + Intergenic
1074492525 10:113951905-113951927 ATAACAAAATACCACAGACAGGG + Intergenic
1074590677 10:114810050-114810072 ACAACAGAATACCACAGACTGGG + Intergenic
1074817472 10:117153495-117153517 ACAACAAAATACCACAGACTAGG + Intergenic
1074969746 10:118526334-118526356 ACAATAGAATACCACAGACTGGG - Intergenic
1075056450 10:119222447-119222469 GCTACAGAATTCCACAGAGGAGG - Intronic
1076104440 10:127809499-127809521 ATTACAGAACACCACAGACTGGG - Intergenic
1076251547 10:128987944-128987966 ATAACAGAATACCACAGACTGGG + Intergenic
1078087101 11:8240476-8240498 ATAACAGAATACCACAGACTGGG + Intronic
1078320918 11:10333773-10333795 ATAACAAAATTCCACAGACTGGG - Intronic
1078622707 11:12923622-12923644 ACAACAGAATGCCACAGCCTGGG + Intronic
1078837901 11:15049310-15049332 ATAACAGAATACCACAGACTGGG + Intronic
1079139217 11:17796657-17796679 ATAACAGAATACCACAGACTGGG - Intronic
1079197147 11:18339048-18339070 ATTCCATAATTCCACAGATAAGG - Intronic
1079492643 11:21006446-21006468 ATAACAGAATACCACAGACTGGG - Intronic
1079879216 11:25903554-25903576 ATAACAGAATACCACAGACTGGG - Intergenic
1080030230 11:27652571-27652593 CCTACAGAGTGCCACAGAAATGG + Intergenic
1080104461 11:28497549-28497571 ATAACAGAATACCACAGACTGGG + Intergenic
1080206382 11:29734440-29734462 ACTACAGTATTACAAAGGCAGGG - Intergenic
1080307798 11:30855134-30855156 ATCACAGAATACCACAGACTGGG - Intronic
1080438841 11:32271578-32271600 ATAACAGAATACCACAGACTGGG - Intergenic
1081480869 11:43487704-43487726 AGAACAAAATGCCACAGACAGGG + Intronic
1082867607 11:57914028-57914050 ATAACAGAATACCACATACAGGG + Intergenic
1082867674 11:57914551-57914573 ATTACAAAATACCACAGACTGGG + Intergenic
1082874537 11:57974697-57974719 CATACAGACATCCACAGACAGGG + Intergenic
1083225772 11:61283565-61283587 AATACAGAATTACCCAGGCATGG - Intronic
1083492810 11:63025561-63025583 ATAACAGAATACCACAGACTGGG + Intergenic
1083516842 11:63267723-63267745 ATAACAGAATACCACAGACTGGG + Intronic
1084887725 11:72221948-72221970 CCAAAACAATTCCACAGACATGG - Intronic
1085105127 11:73835740-73835762 AATACAAAATTACCCAGACATGG + Intronic
1086530264 11:87777061-87777083 ATAACAGAATACCACAGACTAGG + Intergenic
1087085577 11:94214930-94214952 AGTACACAATTGCACAGCCATGG + Intergenic
1087205762 11:95392240-95392262 ATAACAGAATACCACAGACTGGG + Intergenic
1087530549 11:99375650-99375672 ATTCCAGAATTCCAGATACATGG - Intronic
1087775488 11:102253019-102253041 ATAACAGAATACCACAGACTGGG + Intergenic
1088501690 11:110489828-110489850 ACTCAAGAATTCCCCAGACTTGG + Intergenic
1088987563 11:114923352-114923374 ACTGCAGAATACCACAGACTGGG + Intergenic
1089917281 11:122170276-122170298 ATGACAGAATACCACAGACTGGG - Intergenic
1090762372 11:129848723-129848745 ACAACAAAATACCACAGACTGGG + Intronic
1091197298 11:133742720-133742742 ATAACAGAATACCACAGACTGGG + Intergenic
1091243926 11:134075516-134075538 ATGACAGAATACCACAAACAGGG + Intronic
1091247571 11:134111618-134111640 TCTACAGAATTTCAAAAACAGGG - Intronic
1092038770 12:5364681-5364703 GATACAGAAATGCACAGACACGG + Intergenic
1093335179 12:17896511-17896533 ACTACACAATTCCAAAAACATGG - Intergenic
1093763830 12:22939785-22939807 ATAACAGAATACCACAGACTGGG - Intergenic
1094368868 12:29714139-29714161 ATAACAGAATACCACAGACTGGG - Intronic
1094390804 12:29948529-29948551 ATAACAGAATATCACAGACAGGG + Intergenic
1094620730 12:32078075-32078097 ATAACAGAATACCACAGACTGGG + Intergenic
1094813337 12:34162718-34162740 ACTTCAGAACTGTACAGACAAGG - Intergenic
1095103577 12:38205807-38205829 ACTTCAGAACTGTACAGACAGGG + Intergenic
1095578820 12:43771136-43771158 ATAATAGAATACCACAGACAGGG - Intronic
1097670591 12:62532488-62532510 ACAATGGAATGCCACAGACATGG - Exonic
1098755338 12:74355336-74355358 AGGACAAAATTCCACAGAGAAGG + Intergenic
1098984513 12:76997242-76997264 ATAACAGAATGCCACAGACTGGG - Intergenic
1099771295 12:87061338-87061360 ATCACAGAATACCACAGACTTGG + Intergenic
1099783519 12:87231353-87231375 ATAACAGAATACCACAGACTTGG + Intergenic
1099809964 12:87568476-87568498 ACAACAAAATTCCATAGACTGGG + Intergenic
1099987637 12:89686017-89686039 ATAACAGAATGCTACAGACAAGG - Intronic
1100164726 12:91903404-91903426 ATGACAGAATACCACAGACTGGG + Intergenic
1100333688 12:93609796-93609818 ACAACAGAATACCACAAACTAGG + Intergenic
1100455526 12:94748072-94748094 ATAACAGAATACCACAGACTGGG - Intergenic
1100602144 12:96121033-96121055 ACTTAAGAGTTCCCCAGACAAGG - Intergenic
1100969812 12:100056352-100056374 ATCACAGAATACCACAGACTGGG - Intronic
1101012510 12:100465781-100465803 ATAACAAAATACCACAGACAGGG + Intergenic
1101539002 12:105647107-105647129 ACAACAGAATACCACAAACTGGG - Intergenic
1101703118 12:107193888-107193910 ATAACAGAATACCACAGACTGGG + Intergenic
1102558408 12:113744651-113744673 ATAACAGAATACCACAGACTGGG + Intergenic
1102831221 12:116002067-116002089 ACTGCAGAATTTCACAAACATGG - Intronic
1103895974 12:124273418-124273440 AATATAGAATACCACAGACTGGG - Intronic
1104097632 12:125572542-125572564 ATAACAGAATGCCACAGACTGGG - Intronic
1104734147 12:131126421-131126443 ATAACAGAATACCACAGACTGGG - Intronic
1104739046 12:131159258-131159280 AAAACAGAATACCACAGACTGGG - Intergenic
1104797670 12:131530820-131530842 ATAACAGAATACCACAGACTGGG + Intergenic
1105073521 12:133253249-133253271 ATAACAGAATACCACAGACTGGG + Intergenic
1105341736 13:19532580-19532602 ATAACAGAATACCACAGACTGGG - Intronic
1105670165 13:22604503-22604525 ACAACAGAATGCCACAGACTGGG - Intergenic
1106394964 13:29370711-29370733 ATAACAGAATACCACAGACTGGG - Intronic
1106461248 13:29972146-29972168 ACTGCAGAAAACCAAAGACAAGG - Intergenic
1106641150 13:31585748-31585770 ATAACAGAATACCACAGACTGGG - Intergenic
1106832910 13:33604376-33604398 ATTACAGAACACCAAAGACAAGG + Intergenic
1107019265 13:35734968-35734990 ATAACAGAATACCACAGACTGGG + Intergenic
1107474077 13:40717964-40717986 ATAACAGAATACCACAGACTGGG - Intergenic
1107491757 13:40886710-40886732 ATAACAGAATACCACAGACTGGG - Intergenic
1107785433 13:43952033-43952055 ATAACAGAATACCACAGACTCGG + Intergenic
1108582079 13:51836341-51836363 ATAACAGAATACCACAGACTAGG - Intergenic
1108677616 13:52750833-52750855 ATAACAAAATTCCACAGACTGGG - Intergenic
1109290795 13:60473029-60473051 ATAACAGAATACCACAGACTGGG + Intronic
1110138024 13:72092155-72092177 AAAACAGAATACCACAGACTGGG - Intergenic
1110186994 13:72686570-72686592 ACAACAGAATACCACAGACTTGG - Intergenic
1110727557 13:78842984-78843006 ATAACAAAATACCACAGACAAGG + Intergenic
1111016899 13:82393300-82393322 ACTTCTGAATTCCTCAGATAAGG - Intergenic
1111085271 13:83368455-83368477 ATAAGAGAATACCACAGACAAGG + Intergenic
1111127660 13:83932525-83932547 ACTGCAGAAAACCAAAGACAAGG + Intergenic
1111128276 13:83940744-83940766 ACTTCTGAATTCCTCAGATAAGG - Intergenic
1111384592 13:87507935-87507957 AATACAGATTTCCACAGGCGTGG - Intergenic
1111385939 13:87527670-87527692 ATAACAGAATGCCACAGACTGGG + Intergenic
1111436265 13:88212480-88212502 ACTGCAAAATCCCACTGACAAGG + Intergenic
1111483288 13:88860909-88860931 ATAACAGAATACCACAGACTGGG + Intergenic
1111773932 13:92635302-92635324 ATAACAGAATACCACAGACTGGG + Intronic
1112394667 13:99018464-99018486 ATAACAGAATACCACAAACAGGG - Intronic
1113446445 13:110371910-110371932 ACTCCAGAAATGAACAGACAGGG + Intronic
1113754150 13:112797871-112797893 ACAACAGAATACCACAGACTGGG + Intronic
1114347204 14:21808507-21808529 ACTTCTGAATTCCTCAGACAAGG - Intergenic
1114732791 14:25011846-25011868 ATTAACGAATTCCACAGGCAAGG + Intronic
1114814189 14:25937100-25937122 ATAACAGAATACCACAGACTGGG - Intergenic
1115264896 14:31491188-31491210 ACTTCTGAATTCCTCAGATAAGG + Intronic
1115405944 14:33016659-33016681 GCTACAGGATCCCACAGAGAAGG - Intronic
1116054957 14:39852299-39852321 AATACAGAATACCACAGACTAGG + Intergenic
1116195102 14:41715575-41715597 ATAACAGAATACCACAGACTGGG + Intronic
1116600226 14:46912060-46912082 ACCAGAGAAATCCACAGACGAGG + Intronic
1116863896 14:50016041-50016063 ACGACAAAATACCACAGACTAGG - Intergenic
1116994596 14:51309330-51309352 AACACAGAATAACACAGACATGG - Intergenic
1117684889 14:58242595-58242617 ATAACAGAATACCACAGACTAGG + Intronic
1118067545 14:62208197-62208219 ATAACAGAATACCACAGACAAGG + Intergenic
1118164591 14:63323816-63323838 AATACAGAATCCCAGAGAGAAGG - Intergenic
1118673682 14:68159240-68159262 AATACAAAATTTCAAAGACAAGG - Intronic
1119533492 14:75380318-75380340 ATAACAGAATACCACAGACTAGG - Intergenic
1119561591 14:75594482-75594504 ATCACAGAATACCACAGACTGGG + Intronic
1119628042 14:76199466-76199488 ACAATAGAATACCACATACATGG - Intronic
1119976291 14:79027888-79027910 ACTACCCAACTCCAAAGACAAGG - Intronic
1120079189 14:80196320-80196342 ATAACAGAATACCACAGACTGGG + Intergenic
1120241224 14:81952178-81952200 ACAACAAAATGCCACAGACTGGG + Intergenic
1120634059 14:86929381-86929403 ATAACAGAATACCACAGACTGGG + Intergenic
1121579802 14:95020960-95020982 ATAACAGAATGCCACAGACTGGG + Intergenic
1121613365 14:95296081-95296103 ATAACAGAATGCCACAGACTGGG + Intronic
1121820659 14:96963335-96963357 ATAACAGAATACCACAGACTGGG - Intergenic
1122045892 14:99023129-99023151 ATGAAAGAATTCCACAGACTGGG - Intergenic
1122670500 14:103368082-103368104 ATAACAGAATGCCACAGACTGGG - Intergenic
1123487869 15:20756982-20757004 CCTGCAGAATTCCACAAACCAGG + Intergenic
1123544368 15:21326058-21326080 CCTGCAGAATTCCACAAACCAGG + Intergenic
1124096027 15:26649486-26649508 ATAACAGAATACCACAGACCAGG - Intronic
1124393285 15:29278832-29278854 ACAGCAGAATACCACAGACTTGG + Intronic
1124967130 15:34442507-34442529 ATAACAGAATACCACAGACTGGG + Intergenic
1125275753 15:37989680-37989702 ATAACAGAATACCACAGACTGGG + Intergenic
1125339142 15:38657329-38657351 ATTACAAAATGCCACAGACCAGG - Intergenic
1125772620 15:42180125-42180147 ATAACAGAATACCACAGACTAGG - Intronic
1126275140 15:46869182-46869204 ACAACAGAATTCCACAAACTGGG - Intergenic
1126487777 15:49201882-49201904 ATAACAGAATTCCACAGATGGGG + Intronic
1126812143 15:52417869-52417891 ATAACAGAATACCACAGACTGGG - Intronic
1127590409 15:60416519-60416541 ATAACAGAATACCACAGACAGGG + Intergenic
1128011192 15:64297826-64297848 ACTACAAAATTCCAAAGTCAAGG - Intronic
1128064900 15:64758534-64758556 CATACAGAATACCACAGACATGG + Intronic
1128230995 15:66035072-66035094 ATAACAGAATGCCACAGACCGGG - Intronic
1128672256 15:69582654-69582676 ATGACAGAATACCACAGACTGGG + Intergenic
1128718082 15:69924471-69924493 ACTGCAGAACACCAAAGACAAGG - Intergenic
1128808427 15:70552327-70552349 ATAACAGAATACCACAGACTGGG + Intergenic
1128836617 15:70813968-70813990 ACAACAGAATACCATAGACTGGG + Intergenic
1129118576 15:73380788-73380810 ATGACAGAATACCACAGACTGGG + Intergenic
1130864845 15:87924007-87924029 ACAACAGAATACCACAGAATGGG - Intronic
1131546105 15:93316818-93316840 ACTTCAGAAGTCCAGAGACAAGG + Intergenic
1131902585 15:97104477-97104499 ATAACAGAATACCACAGACTGGG - Intergenic
1132097091 15:98994979-98995001 GCTACAGAATACCAAAAACAAGG - Intronic
1202952712 15_KI270727v1_random:53330-53352 CCTGCAGAATTCCACAAACCAGG + Intergenic
1133538462 16:6724628-6724650 ATAACAAAATTCCACAGACTGGG - Intronic
1133827334 16:9290093-9290115 ATAACAGAATACCACAGACTAGG + Intergenic
1134571936 16:15298515-15298537 ATAACAGAATACCACAGACCAGG - Intergenic
1134730446 16:16457528-16457550 ATAACAGAATACCACAGACCAGG + Intergenic
1134936985 16:18254368-18254390 ATAACAGAATACCACAGACCAGG - Intergenic
1135578613 16:23605988-23606010 ACAACAAAATACCACAGACTGGG - Intronic
1135806161 16:25544783-25544805 ACTTCTGAATTCCACAGCTAAGG - Intergenic
1136035893 16:27539892-27539914 ACAACAGAATACCACAAACTGGG - Intronic
1136252548 16:29015365-29015387 ATAACAGAACTCCACAGACAGGG - Intergenic
1137431733 16:48423665-48423687 ACTACAGAATTAGCCAGGCACGG - Intronic
1137595866 16:49723267-49723289 ACTACAGAAATGGACAGAAATGG - Intronic
1138695710 16:58811310-58811332 ATAACAGAATACCACAGACTAGG + Intergenic
1138785969 16:59847147-59847169 ACAACAAAATACCACAGACTGGG + Intergenic
1139032637 16:62904536-62904558 AATACAGAATTATACAGACCAGG - Intergenic
1139285422 16:65809188-65809210 ACAACAAAATACCACAGACTGGG - Intergenic
1140128907 16:72140632-72140654 ACTTCAGAATTCCATGAACATGG + Intronic
1141716341 16:85729213-85729235 ACTGCTGAACTCTACAGACAGGG - Intronic
1141931869 16:87210577-87210599 ACAACAAAATACCATAGACAGGG + Intronic
1142559557 17:802081-802103 AACACAGAAATCCAAAGACAAGG + Intronic
1143203146 17:5125929-5125951 AATACAGAATTACCCAGGCATGG - Exonic
1143274855 17:5702909-5702931 ATAACAGAATACCACAGACTGGG - Intergenic
1144124417 17:12189384-12189406 ATAACAGAATACCACAGACTGGG + Intergenic
1146530006 17:33600408-33600430 ATAACAGAATGCCACAGACCAGG - Intronic
1146833664 17:36092122-36092144 AGGACAGAATTCCAAAGGCATGG - Intergenic
1150239144 17:63618086-63618108 TCTTCTGAACTCCACAGACATGG - Intergenic
1151072637 17:71233441-71233463 ATAACAGAATACCACAGACTGGG - Intergenic
1151514483 17:74583525-74583547 ACAACAAAATACCACAGACTGGG - Intronic
1152297378 17:79475956-79475978 ATCACAGAATGCCACAGACTGGG - Intronic
1152877747 17:82796993-82797015 AAAACAGAATTTCACAGTCAAGG - Intronic
1152956372 18:45274-45296 ACTTCAGAACTGTACAGACAGGG - Intergenic
1153029982 18:704576-704598 AAGACAGAATCCCACATACAAGG - Intronic
1153222378 18:2873252-2873274 AATACAAAATTACCCAGACATGG + Intronic
1153478942 18:5527902-5527924 ACTACAGATATCAACATACACGG + Intronic
1153986427 18:10354826-10354848 ACTACATTATTCCAAAGTCATGG - Intergenic
1155107892 18:22685942-22685964 AGTACAGAAGTCCAAACACATGG + Intergenic
1155320891 18:24617875-24617897 ATCACAGAATACCACAGGCATGG + Intergenic
1155559640 18:27061841-27061863 ACTTCTGAATTCCTCAGATAAGG - Intronic
1155935908 18:31753934-31753956 ATAACAGAATTCCACAGACTGGG + Intergenic
1156534329 18:37848246-37848268 ATAACAGAATACCACAGACTAGG + Intergenic
1157151958 18:45227368-45227390 ATAACAGAATACCACAGACTTGG + Intronic
1157340742 18:46776118-46776140 ATAACAGAATACCACAGACGGGG - Intergenic
1157571987 18:48718784-48718806 TCTCCAGGATTCCTCAGACATGG + Intronic
1157691669 18:49687433-49687455 ATAACAGAATACCACAGACTGGG + Intergenic
1159060866 18:63512593-63512615 TCCACAGACTGCCACAGACATGG + Intergenic
1159466978 18:68796419-68796441 ACTAGAAAATTACACAGATATGG - Intronic
1159545601 18:69837157-69837179 ATAACAGAATACCACAGACTAGG + Intronic
1159637698 18:70825567-70825589 ATAACAGAATACCACAGACTGGG - Intergenic
1160098658 18:75900534-75900556 ACTAAAGATATCCAAAGACAGGG + Intergenic
1160115501 18:76075261-76075283 ATAACAGAATACCACAGACTGGG - Intergenic
1160164648 18:76499783-76499805 GATACAGAATTCCACAGATGTGG + Intergenic
1160802515 19:976903-976925 ACCACAGATGTCCCCAGACATGG - Intergenic
1161028424 19:2047212-2047234 ACCACAGATGTCCCCAGACATGG - Intronic
1161155184 19:2728856-2728878 ACCACAGATGTCCCCAGACATGG + Intronic
1161323154 19:3650456-3650478 ACCACAGATGTCCCCAGACATGG - Intronic
1161480310 19:4507062-4507084 ACCACAGATGTCCCCAGACATGG + Intronic
1162148182 19:8626344-8626366 ATCACAGAATTCCATAGACTGGG - Intergenic
1162260270 19:9527717-9527739 ACAACAAAATACCACAGACTGGG + Intergenic
1163263826 19:16206566-16206588 GCTATAGAATTCCACAGGCGTGG - Intronic
1163999010 19:21080071-21080093 ATTACAGTAATGCACAGACACGG + Intergenic
1164529194 19:29035051-29035073 ATTACAAAATACCACAGACTGGG + Intergenic
1164585392 19:29468154-29468176 ACTACAGAATTTTACAGAGGAGG + Intergenic
1164605230 19:29593206-29593228 ACAATAAAATACCACAGACAGGG + Intergenic
1164731147 19:30505627-30505649 ACTACAGACTTCCACAGTAAAGG - Intronic
1164740483 19:30572124-30572146 ACTACACAAATCCAAAGGCATGG - Intronic
1165521319 19:36316549-36316571 ATAACAGAATACCACAGACTGGG + Intergenic
1165622742 19:37262039-37262061 ATAACAGAATACCACAGACTGGG - Intergenic
1165634443 19:37328670-37328692 ATAACAGAATACCACAGACTGGG - Intronic
1167330160 19:48850659-48850681 ACTACAAAATTAGCCAGACATGG + Intronic
1167736653 19:51298520-51298542 ACAACAAAATACCACAGACTGGG - Intergenic
925055024 2:850733-850755 ATAACAGAAACCCACAGACAAGG + Intergenic
925473845 2:4191472-4191494 ATAACAGAATTCTACAGACTGGG - Intergenic
926051581 2:9748403-9748425 ACAACAGAATATCACAGACTGGG - Intergenic
926437123 2:12849494-12849516 ATAACAGAATACCACAGACTGGG - Intergenic
926549535 2:14284926-14284948 ACTTCAGATATCCCCAGACAAGG - Intergenic
926587135 2:14699192-14699214 ATGACAGAATACCACAGACTGGG - Intergenic
926691166 2:15734868-15734890 ACTACACAACTCTACAGACCAGG + Intronic
927063279 2:19444187-19444209 ATAACAGAATACCACAGACTGGG + Intergenic
927359920 2:22221262-22221284 ATAACAGAATACCACAGACTGGG + Intergenic
927776382 2:25907098-25907120 ACATCAGAATACCACAGACTGGG - Intergenic
927822638 2:26281879-26281901 ACTTCAGAATTCCAAAGAAAAGG - Intronic
927828514 2:26327525-26327547 ATAACAGAATACCACAGACTGGG + Intronic
928051599 2:28002629-28002651 ATTACAGAAAACCAAAGACAAGG + Intronic
929023720 2:37578924-37578946 ACAACAGAATACCACAGACTGGG + Intergenic
929164831 2:38871515-38871537 ATAACAGAATGCCACAGACTAGG + Intronic
929257011 2:39823020-39823042 ACAACAGAATTACACATACTGGG + Intergenic
929493857 2:42422455-42422477 ATAACAGAATACCACGGACAGGG - Intronic
929699484 2:44149568-44149590 ATAACAGAATACCACAGACTGGG - Intergenic
929703538 2:44187162-44187184 ACTACATGATTCCACTTACATGG - Intronic
930029968 2:47052373-47052395 GCTCCAGAGTTCCACAGACCTGG + Intronic
930496387 2:52149696-52149718 ACAACAGAATACCACAGAATGGG - Intergenic
930538852 2:52679601-52679623 ATGACAGAATGCCACAGACTAGG + Intergenic
930572218 2:53101711-53101733 ATAACAGAATCCCACAGACTTGG + Intergenic
930709834 2:54540169-54540191 AAAACAGAATACCACAGACTGGG - Intronic
930886789 2:56335438-56335460 ATAACAGAATACCACAGACTGGG + Intronic
931534872 2:63263595-63263617 ACAACAGCATACCACAGACTGGG - Intronic
931633385 2:64321125-64321147 ATAACAGAATTCCACAGACTGGG - Intergenic
931889445 2:66655031-66655053 ACTACAAAATGCCATAGACTGGG + Intergenic
932007010 2:67937296-67937318 ATAACAGAATACCACAGTCAGGG - Intergenic
932221630 2:70004003-70004025 ATTACAGAATACCACAGACTGGG - Intergenic
933914534 2:86975447-86975469 ACTACAAAATTAGCCAGACATGG + Intronic
934008459 2:87794452-87794474 ACTACAAAATTAGCCAGACATGG - Intronic
934146358 2:89098551-89098573 ACTACAGCCTTTCAAAGACAAGG - Intergenic
934222909 2:90102023-90102045 ACTACAGCCTTTCAAAGACAAGG + Intergenic
935045444 2:99477890-99477912 ATTACAGATTTCCATAGAAAGGG + Intronic
935430832 2:102974035-102974057 ATAACAGAATACCACAGACTGGG + Intergenic
935772104 2:106435461-106435483 ACTACAAAATTAGCCAGACATGG - Intronic
935907966 2:107860485-107860507 ACTACAAAATTAGCCAGACATGG + Intronic
936129755 2:109825595-109825617 ACTACAAAATTAGCCAGACATGG + Intronic
936214942 2:110545890-110545912 ACTACAAAATTAGCCAGACATGG - Intronic
936341233 2:111634193-111634215 ACAACAAAATACCACAGACTGGG + Intergenic
936405623 2:112200009-112200031 ATAACAGAATACCACAGACTGGG - Intergenic
936424079 2:112400453-112400475 ACTACAAAATTAGCCAGACATGG - Intronic
937060447 2:118976889-118976911 ACTACAGAATACCTGAGACTGGG + Intronic
937838799 2:126503643-126503665 ACTTCTGAATTCCTCAGATAAGG - Intergenic
937964371 2:127491052-127491074 ACTGAAGAATTTCACAAACATGG + Intronic
938060012 2:128246400-128246422 ATTATAGAATACCACAGACTGGG + Intronic
938095369 2:128457889-128457911 ATAACAAAATTCCACAGACCAGG - Intergenic
938260322 2:129891327-129891349 ATCACAAAATTCCACAGACCAGG + Intergenic
938962231 2:136354249-136354271 ATAACAGAATACCACAGACTCGG - Intergenic
939354669 2:141085655-141085677 ATAACAGAATACCACAGACTTGG - Intronic
939688914 2:145233745-145233767 ATGACAGAATACCACAGACCAGG + Intergenic
939891548 2:147742852-147742874 ATAACAGAATTCCACAGACTGGG - Intergenic
940209191 2:151239017-151239039 AGGAAAGAATTCCTCAGACAGGG + Intergenic
940383392 2:153042594-153042616 ATAACAGAATACCACAGACTGGG - Intergenic
940468065 2:154058323-154058345 ACAACAAAATACCACAGACTTGG - Intronic
940700058 2:157029311-157029333 ATAACAGAATACCACAGACTGGG - Intergenic
941409633 2:165137900-165137922 ACTACTGAATTGCTCAGTCATGG + Exonic
941497206 2:166220609-166220631 ATAACAGAATACCACAGACTGGG - Intronic
941652594 2:168108608-168108630 GTTCCAGAATTTCACAGACATGG + Intronic
941717446 2:168778996-168779018 ATTACAAAATACCACAGACTGGG + Intergenic
942174377 2:173317777-173317799 ATCACAGAATACCACAGACTGGG + Intergenic
942205552 2:173617027-173617049 ATAACAGAATACCACAGACCAGG + Intergenic
942432420 2:175926510-175926532 ATAACAGAATACCACAGACTGGG - Exonic
942472250 2:176272941-176272963 ATAACAGAATACCACAGACTAGG + Intronic
942614613 2:177777244-177777266 ACAACAAAATACCACAGACTGGG - Intronic
943165759 2:184323674-184323696 CTAACAGAATTCCACAGACAGGG + Intergenic
943631461 2:190257629-190257651 ATGACAGAATACCACAGACCGGG + Intronic
943839622 2:192562128-192562150 ACCACAGAAAACCAAAGACAAGG + Intergenic
944226393 2:197352723-197352745 ACAACAGAATACCATAGACTGGG - Intergenic
944441139 2:199744622-199744644 ATAACAGAATACCACAGACTGGG - Intergenic
944445714 2:199786190-199786212 ACTACACAACTCCACAATCAGGG - Intronic
944518687 2:200540846-200540868 ATAACAGAATACCACATACAGGG + Intronic
945900264 2:215529399-215529421 ATAACAAAATACCACAGACAGGG - Intergenic
946184864 2:217974852-217974874 ACTACAGATGCCCAGAGACAGGG - Intronic
946293405 2:218763604-218763626 ACAACAGAATACCACAGACTGGG + Intergenic
946379864 2:219339868-219339890 ATAACAGAATACCACAGACTGGG - Intergenic
947012827 2:225584333-225584355 ACTACTGAATTTCAAAGACCAGG + Intronic
947437905 2:230088860-230088882 ATAACAGAATCCCACAGACTGGG + Intergenic
947539004 2:230961679-230961701 ATAACAGAATACCACAGACCAGG + Intergenic
948119310 2:235517039-235517061 ACGACAAAATACCACAGACTGGG + Intronic
948199853 2:236121750-236121772 ATAACAAAATACCACAGACAGGG + Intronic
948246673 2:236492169-236492191 ATAACAGAATACCACAGACTGGG - Intronic
948673435 2:239583385-239583407 ACTGCAGAACTCCACAGTCATGG - Exonic
1169262017 20:4146182-4146204 ATTACAAAATGCCACAGACTAGG - Intronic
1170147426 20:13192001-13192023 ATAACAGAATACCACAGACTGGG - Intergenic
1170180675 20:13526412-13526434 ACTACAATTTTCCATAGACACGG + Intronic
1171437811 20:25136641-25136663 ATAACAGAATTCCATAGACTGGG - Intergenic
1172333528 20:34094044-34094066 ACTAAAGAATTAGACAGGCATGG - Intronic
1172381866 20:34500958-34500980 AATACAGTATTTCCCAGACATGG - Intronic
1173262431 20:41448670-41448692 ATAACAGAATACCACAGACTGGG - Intronic
1175057401 20:56210715-56210737 ACTTCTGAATTCCTCAGACAGGG - Intergenic
1175548453 20:59798030-59798052 ATAACAAAATACCACAGACAAGG + Intronic
1176887162 21:14270448-14270470 ACAACAGAATACCACAAACTTGG - Intergenic
1177478505 21:21655009-21655031 ATAACAGAATACCACAGACTGGG + Intergenic
1177560449 21:22744127-22744149 ATAACAAAATTCCACAGACTGGG - Intergenic
1177563153 21:22783095-22783117 ATAACAAAATTCCACAGACTGGG - Intergenic
1178073137 21:28991330-28991352 ACTACAGAAGTCTAAATACAAGG + Intronic
1178256371 21:31056129-31056151 ATTACAAAATGCCACAGACTGGG + Intergenic
1178519937 21:33280937-33280959 ACAACAAAATACCACAGACTAGG + Intronic
1178608756 21:34061627-34061649 ATAACAGAATGCCACAGACTAGG - Intergenic
1179013042 21:37571182-37571204 ACAACAGAATGCCACAGACAGGG - Intergenic
1179227896 21:39472162-39472184 AAAACAGAATACCACAGACTGGG + Intronic
1179446583 21:41436069-41436091 ATAACAAAATACCACAGACAGGG + Intronic
1179458881 21:41520269-41520291 GTTACAGAATACCACAGACTGGG + Intronic
1179536987 21:42059213-42059235 ACGACACAAGGCCACAGACAGGG - Intergenic
1179989166 21:44937685-44937707 ATAACAGAATACCACAGACTAGG + Intronic
1181296463 22:21843932-21843954 ATAACAGAATACCACAGACTGGG + Intronic
1182380272 22:29882256-29882278 CCTGCAGAATTCCACAAACCAGG - Intergenic
1182678895 22:32062876-32062898 ACAACAAAATACCACAGACTAGG + Intronic
1183006697 22:34908897-34908919 ACAACAAAATATCACAGACATGG + Intergenic
1184435537 22:44472526-44472548 ACAACAGAATACCATAGACTGGG - Intergenic
1184626081 22:45731255-45731277 GCTACAGAATCCCACGGAAATGG - Intronic
1185241055 22:49747738-49747760 ACTAGAGAATGCCACTGAAAGGG - Intergenic
949740267 3:7224504-7224526 AGAACACAATTCCACAGTCATGG + Intronic
949821643 3:8122642-8122664 ATAACAGAATACCACAGACTTGG + Intergenic
951287824 3:20836697-20836719 ATAACAGAATACCACAGACTGGG - Intergenic
951940683 3:28075602-28075624 ACAACAGAATACCCCAGACTGGG - Intergenic
952476451 3:33715967-33715989 GCTATAGAATTCAACAGAAAGGG + Intronic
953718796 3:45337449-45337471 AAAACAGAATTCAACAGTCATGG + Intergenic
953747924 3:45589224-45589246 ATAACAGAATACCACAGACTAGG - Intronic
953808461 3:46091848-46091870 ATAACAGAATACCACAGACTGGG + Intergenic
953892903 3:46767842-46767864 ATAACAGAATACCACAGACTGGG + Intronic
954001579 3:47561543-47561565 ACGACAAAATACCACAGACTGGG - Intergenic
954722167 3:52574097-52574119 ATAACAGAATACCACAGACTGGG + Intronic
955151180 3:56368941-56368963 AATGCAGAATTCCACAGAACTGG + Intronic
955258522 3:57360191-57360213 ACTACAGAATATCTCAGCCATGG + Intronic
955722777 3:61901222-61901244 ACTACAGATATATACAGACATGG - Intronic
955984667 3:64560199-64560221 ACTATAAAATTCTACAGACTTGG - Intronic
956158345 3:66321845-66321867 ATGACAGAATACCACAGACTGGG + Intronic
957709311 3:83834520-83834542 AAAACAGAATACCACAGACTGGG - Intergenic
957958892 3:87224968-87224990 ACAACAAAATACCACAGACTGGG - Intergenic
958461257 3:94399407-94399429 ACAACACAATGCCACAGACTGGG + Intergenic
958537062 3:95417972-95417994 ACTACATGATTCCACTTACATGG + Intergenic
958820805 3:98971521-98971543 CATACATCATTCCACAGACAGGG - Intergenic
959167511 3:102799087-102799109 ATGACAGAGTTCCACAGACTGGG + Intergenic
959633947 3:108540403-108540425 AGTATGGAATTCCACTGACATGG + Intergenic
959709681 3:109372763-109372785 AAGACAAAAGTCCACAGACATGG + Intergenic
959776518 3:110170996-110171018 ATAACAGAATACCACAGACTGGG + Intergenic
960214141 3:115009902-115009924 ATAACAGAATACCACAGACTGGG - Intronic
960358071 3:116678014-116678036 ATAACAGAATACCACAGACTGGG - Intronic
960442833 3:117710336-117710358 ATAACAGAATACCACAGACTGGG + Intergenic
961015606 3:123465895-123465917 ACAACAAAATACCACAGACTGGG - Intergenic
961543109 3:127613762-127613784 ACAACAGAATACCATAGACTGGG + Intronic
961598364 3:128038283-128038305 AGTACAAACTTCAACAGACATGG - Intergenic
961641405 3:128366899-128366921 ATAACAGAATACCACAGACGCGG + Intronic
962361027 3:134742905-134742927 ATAACAGAATACCACAGACTGGG - Intronic
962439912 3:135403903-135403925 AGTAAAGAAGTCAACAGACAGGG + Intergenic
962567311 3:136674418-136674440 TCTACAGAATTTCACATAGATGG - Intronic
962615555 3:137122779-137122801 ATAACAGAATACCACAGACTAGG + Intergenic
962682085 3:137810801-137810823 ATAACAAAATTCCACAGACTGGG - Intergenic
963347754 3:144116137-144116159 ACAACAGAATACAACACACAGGG - Intergenic
963840329 3:150098183-150098205 ATAACAAAATTCCACAGACTGGG - Intergenic
964809964 3:160652766-160652788 ACAACAGAATACCAGAGACTAGG - Intergenic
965553885 3:169999876-169999898 ATAACAGAATACCACAGACTGGG + Intergenic
965756491 3:172032948-172032970 ACAACAGAATACCACAGACTGGG + Intergenic
966227838 3:177617048-177617070 ATAACAGAATACCACAGACTGGG - Intergenic
967385603 3:188907879-188907901 ATAGCAGAATTCCACAGACTGGG + Intergenic
967618393 3:191601715-191601737 ATAACAGAATACCACAGACCGGG + Intergenic
968357963 3:198122972-198122994 ACTTCAGAACTGTACAGACAGGG + Intergenic
969147230 4:5134540-5134562 ATCACAGAATGCCACAGACTGGG - Intronic
969203994 4:5628480-5628502 ATGACAGAATACCACAGACTGGG - Intronic
969233481 4:5848648-5848670 ATTACAGAATACCATAGACTTGG + Intronic
969579153 4:8053949-8053971 ATCACAGAATACCACAGGCAAGG - Intronic
970391061 4:15614369-15614391 ACTAAAGAAAACCACAAACAAGG - Intronic
970719101 4:18965352-18965374 AAAACAAAATACCACAGACAAGG - Intergenic
970976104 4:22044824-22044846 ATAACAGAAGGCCACAGACAGGG - Intergenic
971078766 4:23182671-23182693 ATAACAGAATACCACAGACTGGG + Intergenic
971117227 4:23662642-23662664 ATAACAGAATACCACAGACCGGG - Intergenic
971194144 4:24455891-24455913 ATAACAGAATACCACAGACTGGG - Intergenic
971214673 4:24652086-24652108 ACAACAGAATACCACAAACTGGG + Intergenic
971241464 4:24892803-24892825 ATTACAGAATACCAGAGACAGGG + Intronic
971336282 4:25726827-25726849 ACAACAAAATACCACAGACTGGG + Intergenic
971495426 4:27259193-27259215 ACTCCAGACTTCCAAAGGCATGG + Intergenic
971500746 4:27315605-27315627 CCTACAGAATTACACATCCAAGG - Intergenic
971981532 4:33757625-33757647 ACAACAGAATAACACAGACTGGG + Intergenic
972444059 4:39126767-39126789 ACTTCTGAATTCCTCAGATAAGG - Intronic
973555348 4:52076652-52076674 ACTTCTGAATTCCTCAGATAAGG + Intronic
973607002 4:52597880-52597902 AATGGAGAATTCCACAGACTTGG + Intronic
973716164 4:53678565-53678587 ATAACAGAATGCCACAGACTTGG - Intronic
973787606 4:54348178-54348200 ACTACAGAATGAGAGAGACATGG - Intergenic
973933583 4:55818699-55818721 ATTACAAAATACCACAGACTGGG + Intergenic
974155860 4:58071192-58071214 ATAACAGAATACCACAGACTGGG - Intergenic
974277966 4:59751226-59751248 ACTTCTGAATTCCTCAGATATGG - Intergenic
974736649 4:65943883-65943905 AATAAACAATTCCACAGTCAAGG + Intergenic
974953760 4:68614425-68614447 ACTTCACAATTCCAAAGATATGG + Intronic
975178961 4:71321517-71321539 ACCACAGAATACCACAGACTTGG + Intronic
975312721 4:72920438-72920460 ACAACAGAATGCCACACACTGGG - Intergenic
976104707 4:81604282-81604304 ATAACAGAATACCACAGACTGGG - Intronic
976273453 4:83252523-83252545 ACAACAAAATACCACAGACTGGG + Intergenic
976417769 4:84798876-84798898 ACTACAGAAATGGACAGCCATGG - Intronic
976446445 4:85135432-85135454 ATAACAGAATACCACAGACTGGG + Intergenic
976633040 4:87259061-87259083 ATTACAGAATACCACAGATTGGG - Intergenic
976663830 4:87568921-87568943 ATTACAAAATACCACAGACTGGG + Intergenic
976687565 4:87831918-87831940 ACTACAGAATACCACAGACTGGG + Intronic
976960329 4:90963772-90963794 ACAACAAAATACCACAGACTGGG - Intronic
977568905 4:98610085-98610107 ATGACAGAATACCACAGACTGGG + Intronic
977582280 4:98738581-98738603 ACAACAGAATACCACAGACTGGG - Intergenic
977877594 4:102167049-102167071 ATAACAGAATACCACAGACTGGG - Intergenic
978395129 4:108270726-108270748 ATAACAGAATACCACAGACTGGG - Intergenic
978414186 4:108458413-108458435 ATAACAGAATACCACAGACTGGG + Intergenic
979169228 4:117578844-117578866 ACAACAGAATAGCACAGACTGGG - Intergenic
979210366 4:118093795-118093817 ACAACAAAATGCCACAGACTGGG + Intronic
979616953 4:122753679-122753701 ATAACAGAATACCACAGACTGGG + Intergenic
979728874 4:123997733-123997755 ACAACAAAATACCACAGACTAGG + Intergenic
979778627 4:124622204-124622226 ATAACAGAATACCACAGACTGGG + Intergenic
980123641 4:128752498-128752520 ATAACAGAATACCACAGACTGGG - Intergenic
980278468 4:130686358-130686380 ATAACAGAATACCACAGACTAGG + Intergenic
980281225 4:130722800-130722822 ATAACAGAATACCACAGACTGGG - Intergenic
980598275 4:134985027-134985049 ATTACAAAATACCACAGACTGGG - Intergenic
980902454 4:138917845-138917867 ATAACAAAATTCCACAGACTGGG + Intergenic
981016696 4:139981054-139981076 ACAACAAAATACCACAGACTGGG + Intronic
981083316 4:140656999-140657021 ATAACAGAATACCACAGACTGGG - Intronic
981161406 4:141503377-141503399 ATTACAAAATACCACAGACTGGG - Intergenic
981353888 4:143764967-143764989 ACAACAAAATACCACAGACTAGG - Intergenic
981516051 4:145611251-145611273 ATAACAGAATGCCACAGACTAGG - Intergenic
981573906 4:146183692-146183714 ATAACAGAATACCACAGACTGGG + Intronic
981740573 4:147996986-147997008 ATGACAGAATACCACAGACAGGG - Intronic
981856166 4:149295490-149295512 ACAACAAAATTCCACAGACTGGG - Intergenic
981921061 4:150085280-150085302 ATAACAGAATACCACAGACTAGG + Intronic
982211542 4:153040780-153040802 ATAACAGAATACCACAGACTGGG + Intergenic
982287201 4:153747848-153747870 ATAACAGAATACCACAGACTGGG + Intronic
983216883 4:165010360-165010382 ACGACTGACTTCAACAGACAGGG + Intergenic
984163998 4:176286294-176286316 ACAACAGAATACCACAAACTGGG - Intergenic
984273097 4:177572444-177572466 ACAATAGAATACCACAGACTGGG + Intergenic
985235624 4:187870916-187870938 ACAACGAAATTCCACAGACTAGG + Intergenic
985440491 4:189980119-189980141 ACTCCAGAACTGTACAGACAGGG - Intergenic
985520467 5:371846-371868 GGGACAGAACTCCACAGACAGGG - Intronic
985571297 5:646907-646929 ACTACAGCATCCCAGAGACAAGG - Intronic
987082186 5:14435771-14435793 ACGTCAGAAGTTCACAGACAGGG - Intronic
987101676 5:14596695-14596717 ATAACAGAATACCACAGACTGGG + Intronic
987700371 5:21390320-21390342 ACTACAGAATACCATAGACAGGG - Intergenic
987824335 5:23008848-23008870 ACAACAGAATACCACAAACTGGG - Intergenic
988180424 5:27784871-27784893 ATAAAAGAATTCCACAGACTAGG + Intergenic
988223159 5:28375604-28375626 ATAACAGAATTTCACAGACTGGG + Intergenic
988239360 5:28589713-28589735 ATAACAGAATACCACAGACTGGG + Intergenic
988414118 5:30924321-30924343 ATAACAGAATACCACAGACTGGG + Intergenic
988422956 5:31028830-31028852 ATAACAGAATGCCACAGACTGGG + Intergenic
988752038 5:34197745-34197767 GCTATAGAATACCATAGACAGGG + Intergenic
988790590 5:34604032-34604054 ATTACAAAATACCATAGACAGGG + Intergenic
989034332 5:37154181-37154203 ACAACAAAGTTCCACAAACAAGG + Intronic
989289397 5:39745763-39745785 ATAACAGAATACCACAGACTAGG + Intergenic
989398830 5:40987341-40987363 ATAACAGAATACCACAGACTGGG + Intergenic
989407979 5:41083059-41083081 ATAACAGAATGCCACAGACTGGG - Intergenic
989512074 5:42299813-42299835 ATAACAGAATACCACAGACTGGG - Intergenic
989565044 5:42893823-42893845 ACTACAAAAACCCACAGTCAGGG + Intergenic
989794962 5:45457611-45457633 ACAACAAAATACCACAGACTGGG + Intronic
991130924 5:63121528-63121550 ACTACAAAATTCAAGAGACATGG - Intergenic
991219052 5:64190901-64190923 ATAACAGAATACCACAGACTAGG - Intronic
991518381 5:67465814-67465836 ATAACAGAATACCACAGACTAGG - Intergenic
991547243 5:67796063-67796085 ATAACAGAATGCCACAGACTGGG - Intergenic
991739803 5:69658561-69658583 GCTACAGAATACCATAGACAGGG + Intergenic
991757696 5:69894616-69894638 GCTACAGAATACCATAGACAGGG - Intergenic
991791378 5:70238302-70238324 GCTACAGAATACCATAGACAGGG + Intergenic
991819266 5:70534686-70534708 GCTACAGAATACCATAGACAGGG + Intergenic
991837099 5:70770498-70770520 GCTACAGAATACCATAGACAGGG - Intergenic
991883827 5:71238644-71238666 GCTACAGAATACCATAGACAGGG + Intergenic
992011333 5:72530751-72530773 ATTGCAGAATACCACAGACTGGG + Intergenic
992092598 5:73331577-73331599 ATAACAGAATGCCACAGACTAGG - Intergenic
992113646 5:73519201-73519223 ATAACAGAATACCACAGACTGGG + Intergenic
992393714 5:76352653-76352675 ATAACAGAATACCACAGACTGGG - Intronic
992620942 5:78592208-78592230 ACTTCAGAAGTACTCAGACACGG + Intronic
992709565 5:79437229-79437251 GCTACAGTATTCCACACAGATGG + Intronic
992949694 5:81846376-81846398 ATAACAGAATACCACAGACTGGG - Intergenic
993153324 5:84188888-84188910 ATTACAAAATACCACAGACTGGG - Intronic
993183640 5:84587473-84587495 AATGCAGAATGCCACAGAGATGG - Intergenic
993311098 5:86332965-86332987 ATAACAGAATACCACAGACTGGG + Intergenic
993938815 5:94034158-94034180 ATAACAGAATTCCAGAGACTAGG - Intronic
993971366 5:94423509-94423531 ACTAAAGATTTACACATACATGG + Intronic
994510058 5:100691021-100691043 ATCACAGAATACCACATACAAGG + Intergenic
994596431 5:101843421-101843443 ATAACAGAATTCCATAGACTGGG + Intergenic
994876579 5:105430831-105430853 AATACAAAATACCACAGACTGGG - Intergenic
994999325 5:107106963-107106985 ACAACAAAATACCACAGACTGGG - Intergenic
995410070 5:111847152-111847174 ATTACAAAATACCACAGACTGGG + Intronic
995485059 5:112631997-112632019 ATAACAGAATACCACAGACTGGG + Intergenic
997020009 5:129989085-129989107 ATAACAGAATACCACAGACTGGG + Intronic
997653355 5:135537780-135537802 ACAACAAAATTCCACAAACTAGG + Intergenic
998656208 5:144182345-144182367 ATAACAGAATGCCACAGACTGGG - Intronic
999274679 5:150321625-150321647 ATTACAGATATCAACAGACATGG - Intronic
999896957 5:156044921-156044943 ATAACAGAATACCACAGACTGGG + Intronic
999902595 5:156101188-156101210 ACTACAGAATACCATAGATTGGG - Intronic
1000089434 5:157917466-157917488 ATAACAGAATACCACAGACTGGG - Intergenic
1000238851 5:159390267-159390289 ATTACAAAATACCACAGACTGGG - Intergenic
1000425438 5:161085032-161085054 ATAACAGAATACCACAGACTGGG + Intergenic
1000794312 5:165646153-165646175 ACTACAGAGTTACAGAGTCAAGG + Intergenic
1000881688 5:166705190-166705212 ATAACAGAATACCACAGACTGGG - Intergenic
1001198867 5:169698065-169698087 ATTGCTGAATTCCACAGCCACGG + Intronic
1001578608 5:172782540-172782562 ATAACAGAATACCACAGACTGGG - Intergenic
1001584972 5:172827651-172827673 TATACAGAATACCACAGACTGGG - Intergenic
1002317420 5:178352046-178352068 ACAACAAAATCCCACAGACCGGG - Intronic
1002993323 6:2258043-2258065 ATAACAGAATACCACAGACTAGG - Intergenic
1003061011 6:2862417-2862439 ATAACAGAATACCACAGACTAGG - Intergenic
1003159730 6:3624770-3624792 CCTACAAAATACCACAGACTGGG + Intergenic
1003263124 6:4541271-4541293 ATAACAGAATACCACAGACTAGG - Intergenic
1003819123 6:9876242-9876264 ATAACAAAATTCCACAGACTGGG - Intronic
1004039867 6:11964992-11965014 ACAACAGAATACCACAGACTGGG + Intergenic
1004564939 6:16787441-16787463 ACAACAAAATACCACAGACTGGG - Intergenic
1004729131 6:18340696-18340718 ATTACAGAATACCATAGACCGGG - Intergenic
1004994898 6:21180897-21180919 ATAACAGAATACCACAGACTGGG + Intronic
1005550199 6:26904459-26904481 GCTACAGAATACCATAGACAGGG + Intergenic
1005660632 6:27995558-27995580 ACAACAAAATACCACAGACTGGG + Intergenic
1005922036 6:30410609-30410631 AGTAGAGAATTCTACAAACATGG - Intergenic
1006270734 6:32965021-32965043 ATCACAGAATACCACAGACTGGG - Intronic
1006274890 6:32995881-32995903 ATAACAGAATACCACAGACTAGG - Intergenic
1006401817 6:33822191-33822213 ATAACAGAATACCACAGACAGGG - Intergenic
1006843039 6:37043169-37043191 ATAACAGAATACCACAGACTGGG + Intergenic
1006902135 6:37510037-37510059 ATAACAGAATACCACAGACTGGG + Intergenic
1007281724 6:40717648-40717670 ATAACAGAATACCACAGACTGGG - Intergenic
1007551078 6:42729955-42729977 ATGACAGAATTCCATAGACTGGG - Intergenic
1008141842 6:47840723-47840745 ATAACAGAATGCCACAGACTGGG - Intergenic
1009026206 6:58003236-58003258 ATAACAGAATACCATAGACAAGG - Intergenic
1009201757 6:60754708-60754730 ACAACAGAATACCATAGACAAGG - Intergenic
1009460808 6:63910461-63910483 AGTACACAATTCCAAAGACTTGG - Intronic
1009485923 6:64221525-64221547 ATAACAGAATACCACAGACTAGG - Intronic
1009851494 6:69205502-69205524 ACATCAGAATACCACAGACTGGG + Intronic
1010082743 6:71883269-71883291 ATTACAAAATACCACAGACCGGG - Intergenic
1010636709 6:78268518-78268540 TCTTCATAATTCCACAGAAACGG + Intergenic
1011017983 6:82780193-82780215 ATAACAGAATAGCACAGACAGGG - Intergenic
1011079175 6:83470843-83470865 ATAACAGAATACCACAGACTGGG - Intergenic
1011330320 6:86197654-86197676 ATAACAGAATACCACAGACTGGG - Intergenic
1011780705 6:90786297-90786319 TATACAGAATACCACAGACTAGG + Intergenic
1012127318 6:95446881-95446903 ACCAAAGAATTCCAGAGACTAGG + Intergenic
1012612788 6:101236195-101236217 AAAACAGAATGCCACAGACAGGG - Intergenic
1012723110 6:102773117-102773139 ATAACAGAATACCACAGGCAGGG - Intergenic
1012729672 6:102866415-102866437 AATTCACAATTCCAAAGACATGG + Intergenic
1013427577 6:110027781-110027803 ATAACAGAATACCACAGACTGGG + Intergenic
1013429453 6:110042732-110042754 ACTAGCTAATTCCACAGACTTGG - Intergenic
1013865892 6:114695519-114695541 ATAACAGAATACCACAGACTGGG - Intergenic
1013981043 6:116129693-116129715 ATAACAGAATGCCACAGACGGGG - Intronic
1014268362 6:119308192-119308214 ACCACATTTTTCCACAGACAAGG + Intronic
1014340110 6:120194269-120194291 GCCACAGAGTTCAACAGACAGGG - Intergenic
1014376509 6:120681497-120681519 ACTTCTGAATTCCTCAGATAAGG + Intergenic
1014606743 6:123483595-123483617 TCTACAAAATTCCAGAGAGAGGG - Intronic
1014728656 6:125004887-125004909 ATAACAGAATACCACAGACTGGG + Intronic
1015333597 6:132009433-132009455 ATAACAGAATACCACAGACTGGG - Intergenic
1015522355 6:134144313-134144335 ATAACAGAATACCACAGACGGGG - Intergenic
1015755241 6:136599783-136599805 ACTTCAGAATTACACAGAAGTGG - Intronic
1016085647 6:139911124-139911146 ATAACAGAATACCACAGACTGGG + Intergenic
1016149098 6:140716485-140716507 ACTACTGAAAGCCAAAGACAAGG - Intergenic
1016318344 6:142814902-142814924 ATAACAGAATACCACAGACTGGG + Intronic
1016341832 6:143070494-143070516 ATCACAGAATACCACAGACTGGG + Intronic
1016372556 6:143390407-143390429 ATTACAAAATACCACAGACTAGG - Intergenic
1016465939 6:144325518-144325540 GCAACAGAATGCCACAGACTGGG - Intronic
1016724334 6:147344454-147344476 ACCACAAAATACCACAGACTGGG + Intronic
1016879178 6:148894168-148894190 ACTACACAATTACGTAGACATGG - Intronic
1016954562 6:149614079-149614101 ATCACAGAATACCACAGACTGGG - Intronic
1017115702 6:150974615-150974637 ACTACATGATTCCACTCACATGG - Intronic
1017918076 6:158848142-158848164 ATAACACAATTCCACAGACTGGG - Intergenic
1018043513 6:159945843-159945865 ATAACAGAATACCACAGACTGGG - Intergenic
1018069103 6:160146004-160146026 ACGACAGGATTCCTCAAACATGG - Intronic
1018208585 6:161458733-161458755 ACTACAGAATTCCACAGACATGG - Intronic
1018234917 6:161714563-161714585 ACAACAAAATGCCACAGACTGGG - Intronic
1018296134 6:162346132-162346154 ACAACAGAATACCACAGCCTGGG - Intronic
1018791411 6:167151066-167151088 GCAACTGAATACCACAGACAGGG + Intronic
1018873680 6:167802293-167802315 ATGACAGAATTCCACAGACTGGG - Intergenic
1018906735 6:168080000-168080022 AGGACAGAATTCCACAGCCCAGG - Intronic
1019939882 7:4281495-4281517 ACCACAGAATACCATAGACTGGG - Intergenic
1020390062 7:7648524-7648546 ATTACAGAATACCACAGACTGGG + Intronic
1020468190 7:8504944-8504966 ACAACAGAATACCATAGACAAGG - Intronic
1021007093 7:15411276-15411298 ATAACAGAATACCACAGACTGGG - Intronic
1021694947 7:23267467-23267489 ATAACAGAATTCCATAGACTGGG + Intronic
1021773733 7:24030896-24030918 ACAACAAAATACCACAGACCGGG - Intergenic
1021817714 7:24464447-24464469 ATAACAGAATACCACAGACTAGG + Intergenic
1022783414 7:33610308-33610330 ATAACAGAATACCACAGACTGGG + Intergenic
1022904554 7:34843183-34843205 ATAACAGAATACCACAGACTGGG + Intronic
1023599050 7:41863766-41863788 ATAACAGAATACCACAGACTGGG + Intergenic
1023641008 7:42258023-42258045 ATTACAGAGTGCCATAGACAAGG - Intergenic
1023859189 7:44207081-44207103 ACTACAGATTTCCAGAAAAAAGG - Intronic
1023884255 7:44341173-44341195 ATAACAAAATACCACAGACAGGG + Intergenic
1024528910 7:50374243-50374265 AATACAGTATTCAAGAGACATGG + Intronic
1024767446 7:52676600-52676622 ATAACAGAATACCACAGACCAGG + Intergenic
1024968995 7:55051609-55051631 ATAACAGAATACCACAGACTGGG - Intronic
1025596431 7:62933038-62933060 TCCACAGAATTCCACAAAAACGG + Intergenic
1025997715 7:66538583-66538605 GCTAGAGAATCCCACGGACAAGG + Intergenic
1026661631 7:72308060-72308082 ACGACAGAAATCCACAAACTAGG + Intronic
1026883681 7:73923312-73923334 ATAACAGAATACCACAGACTGGG + Intergenic
1026990591 7:74583099-74583121 GCTAGAGAATCCCACAGACAAGG + Intronic
1027154881 7:75759829-75759851 ACAACAGACTGCCACAGACTAGG - Intergenic
1028509493 7:91608205-91608227 ACCACAGAATTTAACAGACTTGG + Intergenic
1028623746 7:92853675-92853697 ACTTCGGAATTCCATAGACCAGG - Intergenic
1028666645 7:93351441-93351463 ACAACAAAGTTCCACAGACTAGG + Intronic
1028845811 7:95478700-95478722 ACTTCAGCATTCCAAAGAGAGGG + Intronic
1028865946 7:95711920-95711942 ACTACAGGAAACCAAAGACAAGG + Intergenic
1028976271 7:96917785-96917807 GCTACAGAATACCACAGACTGGG - Intergenic
1030172049 7:106612742-106612764 ATAACAGAATGCCACAGACTGGG - Intergenic
1030240850 7:107322441-107322463 ACAACAAAATACCACAGACTGGG - Intronic
1030407406 7:109131670-109131692 AGAACAGAATTTCACAGACTTGG + Intergenic
1031149821 7:118040555-118040577 AATACATAAATCCTCAGACAAGG - Intergenic
1031332474 7:120482776-120482798 ATAACAGAATGCCACAGACTAGG - Intronic
1031349092 7:120706314-120706336 ACAACAGAATATCACAGACTGGG + Intronic
1031650424 7:124282328-124282350 ATAACAGAATACCACAGACTGGG - Intergenic
1031979990 7:128118633-128118655 ACAACAGAATACCACAGACGCGG + Intergenic
1032371715 7:131361060-131361082 ACTGCAGAAAACCAAAGACAAGG - Intronic
1034499918 7:151443161-151443183 ATAACAGAATACCACAGACTGGG - Intergenic
1034504905 7:151480838-151480860 ACTACAAAATTAGCCAGACATGG - Intronic
1034526431 7:151666474-151666496 ATAACAGAATACCACAGACTGGG - Intronic
1034739825 7:153463443-153463465 GTTACAGAATACCACAGACTAGG + Intergenic
1035494095 7:159306678-159306700 ATAACAGAATACCACAGACTGGG + Intergenic
1036117248 8:5971818-5971840 ATTATAGAATTCCTCACACATGG + Intergenic
1038003664 8:23411879-23411901 ATAACAGAATACCACAGACTTGG + Intronic
1038093439 8:24280633-24280655 GCTACAGAATTACTCAGATAAGG - Intergenic
1038689532 8:29748612-29748634 ACAAAAAAATTCCACAGACTGGG - Intergenic
1038697240 8:29817509-29817531 ATAACAGAATGCCACAGACGGGG - Intergenic
1038861965 8:31397503-31397525 ATAACAGAATACCACAGACCAGG + Intergenic
1038999737 8:32966594-32966616 ATAACAGAATACCACAGACTGGG - Intergenic
1039517617 8:38146617-38146639 ACTACAAAATTAGCCAGACATGG + Intronic
1039700056 8:39952922-39952944 ACTACAGAATTAGCCAGGCATGG - Intronic
1040783914 8:51142615-51142637 AAAACAGAATACCACAGACTGGG - Intergenic
1040828170 8:51646379-51646401 ACAACAAAATGCCACAGACCAGG - Intronic
1040892233 8:52329433-52329455 ACTTCAGGATTTCACAAACAAGG - Intronic
1041828339 8:62123875-62123897 ACAACAGAATTCCAGAGTCAAGG + Intergenic
1042056894 8:64773647-64773669 ATAACAGAATACCACAGACTGGG + Intronic
1042832863 8:73050892-73050914 ACTCTAGAATTCCACAGCAAAGG - Intergenic
1043460442 8:80454972-80454994 AATACAAAATTACTCAGACATGG - Intergenic
1043545698 8:81313197-81313219 ATAACAGAATACCACAGACTGGG + Intergenic
1043587716 8:81788710-81788732 ACAACAGAATACCACAGACTGGG + Intergenic
1044756970 8:95473656-95473678 ATAACAGAATTCCACAGACTGGG - Intergenic
1044972498 8:97633686-97633708 ATAACAGAATACCACAGACTGGG - Intergenic
1046556235 8:115776696-115776718 ACTATAAAATTCCTAAGACAAGG + Intronic
1047172785 8:122510216-122510238 ACAACACAATACCACAGACTGGG - Intergenic
1047491936 8:125382334-125382356 ATAACAGAATACCACAGACCAGG + Intergenic
1047843451 8:128779713-128779735 ATAACAGAATACCACAGACTGGG + Intergenic
1047855014 8:128900014-128900036 ACTCCAGAAAACCACAGAGATGG + Intergenic
1047867190 8:129038890-129038912 ATTAAAGAATTACACACACAAGG - Intergenic
1048264781 8:132976182-132976204 ATAACAGAATACCACAGACTAGG + Intronic
1048285770 8:133140484-133140506 ATAACAGAATACCACAGACTAGG + Intergenic
1048431386 8:134374758-134374780 ACAACAGAATACCATAGACTAGG - Intergenic
1048915217 8:139176212-139176234 AGAACAAAATTCCATAGACAGGG - Intergenic
1049185862 8:141252857-141252879 AAAACAGAAATTCACAGACACGG - Intronic
1050018556 9:1260721-1260743 AATCCACAATACCACAGACATGG - Intergenic
1050033870 9:1414571-1414593 ACTGCACAATATCACAGACAGGG - Intergenic
1050318150 9:4424311-4424333 ACTGCATAATTTCACAGATAGGG - Intergenic
1050458989 9:5861044-5861066 ATAACAGAATACCACAGACTGGG - Intergenic
1050487407 9:6148700-6148722 ATAACAGAATGCCACAGACTAGG - Intergenic
1050664887 9:7924703-7924725 ATAACAGAATTCCAGAGACTAGG + Intergenic
1051455738 9:17256180-17256202 ACAACAGAATAGCAAAGACATGG - Intronic
1052195736 9:25712528-25712550 ATAACAGAATACCACAGACTGGG + Intergenic
1052584637 9:30410990-30411012 ACTACCGAATTCTACTGAAAAGG - Intergenic
1052838214 9:33267193-33267215 TCTACAGAATTCTATAGAAAAGG + Intronic
1052937951 9:34109215-34109237 AGTACAGGATACCACAGCCAAGG - Intronic
1052973172 9:34391804-34391826 ACTACAGATTTAAACATACAAGG - Intronic
1053000188 9:34573676-34573698 ACTCCAGAATCCCACAGTGAGGG + Intronic
1053382739 9:37662058-37662080 ATAACAGAATACCACAGACTGGG + Intronic
1054777950 9:69139616-69139638 ACAACAAAATACCACAGACTGGG - Intronic
1055507311 9:76961564-76961586 ATAACAGAATACCACAGACTGGG - Intergenic
1055528950 9:77164152-77164174 ATAACAGAATACCACAGACTGGG + Intergenic
1055545719 9:77371268-77371290 ACCACATAATACCACAGACTGGG + Intronic
1055840098 9:80493406-80493428 AAAACAGAATACCACAGACTGGG + Intergenic
1056218359 9:84426831-84426853 ACTACTGTTTTCCAGAGACAGGG - Intergenic
1056853986 9:90109177-90109199 ATAACAGAATACCACACACAGGG + Intergenic
1056943666 9:90976051-90976073 GCTGCGGAATCCCACAGACAGGG - Intergenic
1057370548 9:94468885-94468907 ACTACAGAATTAGCCAGGCATGG - Intergenic
1057688741 9:97263454-97263476 ATAACAGAATACCACAGACTGGG + Intergenic
1058027084 9:100153627-100153649 ATAACAGAATACCACAGACTGGG + Intronic
1058045866 9:100355854-100355876 ATAACAGAATACCACAGACTGGG + Intergenic
1060167303 9:121429035-121429057 ATAACAGAATACCACAGACTGGG - Intergenic
1060444226 9:123672815-123672837 ATAACAGAATACCACAGACTGGG - Intronic
1061776303 9:132967274-132967296 ATAACAGAATGCCACAGACTGGG - Intronic
1062741831 9:138179505-138179527 ACTTCAGAACTGTACAGACAGGG + Intergenic
1185631227 X:1517173-1517195 ACCACAGAATACCATAGACTGGG - Intronic
1185720601 X:2378226-2378248 ACACCAGAAGTCCACAGCCAAGG - Intronic
1185853478 X:3510660-3510682 ATCACAGAATACCACAGACTGGG - Intergenic
1186165826 X:6825021-6825043 ACAACAGAATCCCATAGACTTGG - Intergenic
1186170110 X:6867757-6867779 ATTACAGAATACCACAGACTGGG + Intergenic
1186236813 X:7520986-7521008 ATAACAGAATACCACAGACTGGG + Intergenic
1186467932 X:9798518-9798540 AGCAAAGAATTCCACAGAGATGG - Intronic
1186835479 X:13433252-13433274 ATAACAGAATACCATAGACAGGG + Intergenic
1187251839 X:17605821-17605843 AGGACAGATTTCCACAGAGAAGG - Intronic
1187255627 X:17639352-17639374 ATAACAGAATACCACAGACTGGG + Intronic
1187296315 X:18004347-18004369 ATGTCAGAATTCCACAGACAAGG + Intergenic
1187532036 X:20105871-20105893 ATAACAGAATACCACAGACTGGG + Intronic
1188082056 X:25855218-25855240 ATAACAGAATACCACAGACTAGG - Intergenic
1188122904 X:26332147-26332169 ATAACAGAATACCACAGACTAGG - Intergenic
1188380354 X:29484158-29484180 ATAACAAAATACCACAGACAGGG + Intronic
1188425555 X:30043144-30043166 ATAACAGAATACCACAGACGGGG + Intergenic
1188459333 X:30405315-30405337 ACTACAGAGTTCCACGGGCTTGG + Intergenic
1188696215 X:33194767-33194789 ATTACAGAAATCCACAGATCTGG - Intronic
1188760381 X:34021046-34021068 CTTACAGAATACCACAGACTGGG + Intergenic
1189420899 X:40856834-40856856 ATAACAGAATACCACAGACTAGG - Intergenic
1189692901 X:43635550-43635572 ACTTCTGAATTCCTCAGATAAGG + Intergenic
1189747403 X:44183778-44183800 ACCAAGGAATTCCACAGAAAAGG + Intronic
1189901740 X:45713433-45713455 ATAACAGAATACCACAGACTGGG - Intergenic
1189973562 X:46441079-46441101 ATAACAGAATACCACAGACTAGG + Intergenic
1190223580 X:48528933-48528955 ATAACAGAATGCCACAGACTAGG + Intergenic
1190240903 X:48657333-48657355 ATAACAGAATACCACAGACCAGG + Intergenic
1190253436 X:48744882-48744904 ATTACAGAATACCACAGGCTGGG + Intergenic
1190372443 X:49755587-49755609 ATAACAGAATACCACAGACTAGG - Intergenic
1190413524 X:50160029-50160051 ATAACAGAATACCACAGACTAGG + Intergenic
1190514472 X:51208222-51208244 ATAACAGAATACCACAGACTAGG - Intergenic
1190746457 X:53325855-53325877 ATAACAAAATACCACAGACAGGG - Intergenic
1191980621 X:66920487-66920509 ACTACAGCATTCCACATGAATGG + Intergenic
1192102000 X:68274551-68274573 ATAACAGAATGCCATAGACAGGG + Intronic
1192246501 X:69377411-69377433 ACAACAAAATACCACAGACTGGG + Intergenic
1192286090 X:69737892-69737914 ACTACACTATTCAAAAGACAGGG - Intronic
1192622306 X:72690661-72690683 ACAACAGAATACCACAGAATAGG - Intronic
1193847459 X:86492069-86492091 ACTGCAGGATTCCACATACATGG - Intronic
1194234681 X:91367567-91367589 ACAACAGAATACCATAGACTGGG - Intergenic
1194653167 X:96539685-96539707 ACTACATAATACTACATACATGG + Intergenic
1195096527 X:101506349-101506371 ACAACAAAATACCACAGACTGGG + Intronic
1195430337 X:104782133-104782155 ATAACAAAATACCACAGACAGGG - Intronic
1195872740 X:109502901-109502923 ATAACAGAATACCACAGACTGGG + Intergenic
1196328673 X:114440557-114440579 ATAACAGAATACCACAGACTAGG + Intergenic
1196902211 X:120396043-120396065 ACCACAGATTACCACAGACTGGG - Intergenic
1196960478 X:120994663-120994685 ACAACAGAATACCACATACTGGG - Intergenic
1197063349 X:122209125-122209147 TCTAGAGAATTTCAAAGACAAGG + Intergenic
1197166585 X:123384127-123384149 ACTACACAATAGCAAAGACATGG - Intronic
1197294481 X:124701330-124701352 GCTACAGAATCTCACATACATGG - Intronic
1197387299 X:125816852-125816874 ACAACAAAATACCACAGACCAGG - Intergenic
1198009265 X:132534126-132534148 ATAACAGAATACCACAGACAGGG + Intergenic
1198197495 X:134379596-134379618 AATACAAAATTCGCCAGACATGG - Intronic
1198330488 X:135618179-135618201 ATCACAGAATACCACAGACTGGG - Intergenic
1198336440 X:135670817-135670839 ATCACAGAATACCACAGACTGGG + Intergenic
1198363190 X:135915809-135915831 ATCACAGAATACCACAGACTGGG - Intergenic
1198678623 X:139157658-139157680 AAAACAGAATACCACAGACTGGG - Intronic
1198747340 X:139903805-139903827 ATAACAGAATACCACAGACTGGG - Intronic
1198935712 X:141901226-141901248 ATAACAGAATACCACAGACGGGG + Intergenic
1199102908 X:143826281-143826303 GCTACTGAATTCCCCAGAAAAGG + Intergenic
1199156942 X:144561110-144561132 ATAACAGAATACCACAGACTGGG + Intergenic
1199736080 X:150687941-150687963 ACAACAAAATACCACAGACTGGG - Intergenic
1200243432 X:154509558-154509580 ATAACAGAATACCACAGACTGGG + Intronic
1201232459 Y:11878500-11878522 ACAACAGAATACCATAGACTGGG - Intergenic
1201256614 Y:12113830-12113852 ATCACAGAATGCCATAGACAGGG - Intergenic
1201456478 Y:14172671-14172693 ATAACAGAATACCACAGACTGGG + Intergenic
1201650853 Y:16284242-16284264 ATTACAAAGTTCCACAGACCAGG + Intergenic
1201983355 Y:19931781-19931803 ACAACAGAATACCACTGACTGGG - Intergenic