ID: 1018209786

View in Genome Browser
Species Human (GRCh38)
Location 6:161469711-161469733
Sequence CATTCCTTCTGGAGGCTGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1851
Summary {0: 1, 1: 14, 2: 92, 3: 446, 4: 1298}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018209786_1018209792 3 Left 1018209786 6:161469711-161469733 CCCCACAGCCTCCAGAAGGAATG 0: 1
1: 14
2: 92
3: 446
4: 1298
Right 1018209792 6:161469737-161469759 CCCTGCGACACCTTAACTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018209786 Original CRISPR CATTCCTTCTGGAGGCTGTG GGG (reversed) Intronic
900115534 1:1026374-1026396 CCCGCCTTCTGCAGGCTGTGGGG - Intronic
900203444 1:1421226-1421248 AATCCCTTCTGCAGGCTTTGGGG + Exonic
900685422 1:3945061-3945083 CATTCCCTCTGGAGTCCCTGGGG + Intergenic
900693319 1:3994903-3994925 GGTTCCTTCTGGATGCTCTGAGG - Intergenic
900783757 1:4634469-4634491 CACACCTTCTGGAAGCTGAGAGG - Intergenic
900941263 1:5800089-5800111 CCTTCTTCCTGGGGGCTGTGTGG - Intergenic
901127320 1:6938695-6938717 CAAGCTTCCTGGAGGCTGTGTGG - Intronic
901195416 1:7437331-7437353 CATTCCTCCTGAGGGCGGTGAGG + Intronic
901305805 1:8232002-8232024 CATTCCTTAGTGATGCTGTGAGG - Intergenic
901455837 1:9362242-9362264 CAGAACTTCTGGAGGGTGTGGGG - Intronic
901498627 1:9637602-9637624 CACTCTCTCTGGAGGCTGTAGGG + Intergenic
901568703 1:10141450-10141472 GGTTCCTTCTGGAGGCTCTAGGG - Intronic
901826043 1:11862022-11862044 TATTCCTTCTGGAAGCTCTAGGG - Intergenic
901889667 1:12251939-12251961 AGTCCCTTCTGGAGGCTCTGAGG + Intronic
902087642 1:13875501-13875523 GGTTCTTTCTGAAGGCTGTGAGG + Intergenic
902096055 1:13946956-13946978 CATTCTCTCTGGAGGCTTGGGGG + Intergenic
902187485 1:14736105-14736127 TCTTCTCTCTGGAGGCTGTGGGG - Intronic
902221343 1:14967786-14967808 CCTTTCTTCTGGAGGCTCTGGGG - Intronic
902577353 1:17386695-17386717 CAGTCCTGCTGCTGGCTGTGAGG - Intronic
902656858 1:17875047-17875069 CCTTCCTCCTGCTGGCTGTGGGG + Intergenic
902666165 1:17940112-17940134 GGTTCCTTCTGAAGGCTCTGAGG + Intergenic
902697523 1:18150339-18150361 CCTTCCTTACGGAGGCTGGGAGG + Intronic
902963532 1:19981301-19981323 GATTCCTTCTGAGGGCTGTGAGG - Intergenic
903041236 1:20532363-20532385 TGTTCCTTCTGGAGGCTCTAAGG - Intergenic
903316936 1:22515491-22515513 AGTTCCTTCTGGAGGCTCTAGGG + Intronic
903607071 1:24582651-24582673 TGTTCCTTCTGGAGGCTCTAGGG - Intronic
903805246 1:26000586-26000608 TGTTCCTTCTGGAGGATGGGTGG - Intergenic
904294917 1:29513905-29513927 AGTTCCTTCTGAGGGCTGTGAGG + Intergenic
904386399 1:30145269-30145291 GATTCCTTCTCTAGGCTCTGAGG - Intergenic
904648334 1:31985513-31985535 CATTCTTTTTGGTGGCTGTGTGG - Intergenic
904715405 1:32464232-32464254 CTTTCCTTCTGAGCGCTGTGAGG - Intergenic
904850337 1:33454595-33454617 GGTTCCTTCTGGGGGCTGTGCGG - Intergenic
904916260 1:33972673-33972695 GATTCCTTCTGGAGGCTCTAGGG - Intronic
904982802 1:34521145-34521167 AATTCCTTCTGGAGGCTCCAGGG + Intergenic
905255467 1:36679280-36679302 CATTCCTTCTGGAGTCTCCTTGG + Intergenic
905336130 1:37245768-37245790 TGTTCCTTCTGGAGGCTCTAGGG - Intergenic
905478123 1:38243153-38243175 GGTTCCTTCTGAGGGCTGTGAGG - Intergenic
905526368 1:38643028-38643050 CATTCCTTTTGGAGGCTCTTTGG - Intergenic
905541214 1:38762012-38762034 CATTCCCTCTAGAGGCTCCGGGG + Intergenic
905586783 1:39126201-39126223 GATTCCTTGTGAAGGCTGTGAGG + Intronic
905675880 1:39824734-39824756 CAGTTCCTCTGGAGGCTCTGGGG - Intergenic
905738627 1:40350015-40350037 CAGGCCTCCCGGAGGCTGTGGGG + Intronic
905855384 1:41308134-41308156 CATTCCTTCTGGGGGCTCTAGGG + Intergenic
905930074 1:41780575-41780597 CATCCCTGCAGGAGGCTCTGGGG + Intronic
905956020 1:41996814-41996836 CATTCCTTCTGAAGACTCAGGGG + Intronic
905993760 1:42363170-42363192 TGTTCCTTCTGGAGGCTCTAGGG - Intergenic
906356580 1:45111580-45111602 CATTCCTTCTGGAGGCTCTAGGG + Intronic
906656731 1:47553751-47553773 GGTTCCTTCTGAGGGCTGTGAGG - Intergenic
906832204 1:49044850-49044872 CATTTCTTTTGGAGGCTTTAAGG - Intronic
906925017 1:50106232-50106254 CAGTCCATCTGGACTCTGTGTGG + Intronic
907183395 1:52590293-52590315 CAATCCTTCTTGCAGCTGTGGGG + Intergenic
907493990 1:54829985-54830007 AAATCCTTCTGAAGGCTCTGGGG + Intronic
908179668 1:61591446-61591468 GATTCCTTCTGCGGGCTGTGAGG + Intergenic
908187939 1:61670592-61670614 CTGTCCTTCCGGAGGCTGTAGGG - Intergenic
908259496 1:62328242-62328264 GGTTCCTTCTGAGGGCTGTGAGG - Intergenic
908557866 1:65275578-65275600 CAGTCCTTCTTGAATCTGTGCGG + Intronic
908572312 1:65422390-65422412 CACTCCCTCTGAAGGCTGTAGGG - Intronic
908769085 1:67580272-67580294 GATTCCCTCTGATGGCTGTGAGG + Intergenic
909154755 1:72059381-72059403 TATTCTTTCTGGGGGGTGTGGGG + Intronic
909600677 1:77458150-77458172 GGTTCCTTCTGGAGGCTCTAGGG + Intronic
909602250 1:77472789-77472811 CAATTCTTCTGGAGGCTCTAGGG + Intronic
909686374 1:78353877-78353899 CATTCTTTCTGGAAGCTGTAGGG + Intronic
910240894 1:85085177-85085199 GTTTCCTTCTGAAGGCTCTGAGG - Intronic
910365475 1:86460441-86460463 CATTCCTGGTGGAGGGTGGGGGG + Intergenic
910393419 1:86767870-86767892 CATTCTTTCTAGAGGCTCTGAGG + Intergenic
910621266 1:89257900-89257922 CATTCCATCTGCAGGCTCTAGGG + Intergenic
910671296 1:89775354-89775376 GATTCCTTCTAGGGGCTCTGTGG - Intronic
910961655 1:92770110-92770132 GGTTTCTTCTGGAGGCTCTGGGG - Intronic
911236209 1:95415165-95415187 CATTCCTTCTGGAGGCTCCAGGG + Intergenic
911252963 1:95599431-95599453 CATTGCTTCTGGAGGCTTTAGGG - Intergenic
911258863 1:95663509-95663531 TATTCCTTCTGGTGGGTTTGTGG + Intergenic
911365645 1:96934441-96934463 CATTCCTTCTGCAGGCTCTAGGG + Intergenic
911367318 1:96954287-96954309 CATTCCCTCTGAAGGCTCTGGGG + Intergenic
911462339 1:98206478-98206500 GATTCCTTCTGGAGGCTCTAGGG + Intergenic
911740299 1:101379702-101379724 CATTTCTTCTGGAAGCTCTTTGG + Intergenic
911807816 1:102234204-102234226 CATTCCTCCTGGTGGGTTTGAGG + Intergenic
912109024 1:106317228-106317250 CATTCCTTCTGAAGGCTTTAGGG - Intergenic
912214260 1:107589484-107589506 AATTCTTCCTGGAGGCTCTGAGG - Intronic
912254960 1:108048910-108048932 CATTCCTTCTGGAGGCTCTAGGG - Intergenic
912881403 1:113419812-113419834 CATTCCTTCTGGAGGCGCTAGGG + Intronic
912959413 1:114181807-114181829 GATTCCTTCTGGGGCCTGTGAGG + Intergenic
913071689 1:115304675-115304697 GCCTCCTTCTGGAGGCTGAGAGG - Intronic
913124627 1:115773492-115773514 CATTCCTCCTGGAGGCTTTCAGG - Intergenic
913983439 1:143544220-143544242 CATGGCTGCTGGAGGGTGTGAGG - Intergenic
914348495 1:146820008-146820030 CTTCCCTTCTGGAAGCTCTGGGG + Intergenic
914456881 1:147844641-147844663 TGTTCCTTCTGTGGGCTGTGAGG - Intergenic
914579839 1:149009637-149009659 CATGGCTGCTGGAGGGTGTGAGG - Exonic
914749448 1:150524008-150524030 GGTTCCTTCCGGAGGCTCTGGGG - Intergenic
914991958 1:152506551-152506573 TATTCCTTCTGGAGGCTCTAGGG + Intergenic
915144750 1:153789897-153789919 GTTTCCTTCTGGAGGCTCTAGGG + Intergenic
915183394 1:154082954-154082976 CATTCCTCCTGGTGGGTTTGTGG + Intronic
915441157 1:155946267-155946289 CATCCCTGTTGGAGCCTGTGGGG - Intergenic
915881988 1:159682169-159682191 TATTCTTTCTGGAGGCTTTAGGG - Intergenic
916199967 1:162261678-162261700 CGTTCCTTCTGGAGGCTATGGGG - Intronic
916206871 1:162323306-162323328 GATTCCTTCTAGAGGCTCTCAGG - Intronic
916292772 1:163184802-163184824 CATTCCTCCTGGAGGTTCTGGGG - Intronic
916303883 1:163306867-163306889 GATGCCTTCTGAGGGCTGTGAGG - Intronic
916328235 1:163587714-163587736 TATTCCTTCTGGAGGCTCTAGGG + Intergenic
916743446 1:167666153-167666175 TTTTCCTGCTGGAGGCAGTGTGG + Intronic
916820078 1:168389559-168389581 CTTTCCCTCTGGAGGCTCTAGGG - Intergenic
916930769 1:169576099-169576121 CATTCCTTCTGGAGGCTCTGGGG - Intronic
917202967 1:172536755-172536777 CGTTCTTTTTGGAGGCTCTGAGG + Intronic
917386523 1:174482204-174482226 CATTCCTTTTGGAGGCTCTGGGG - Intronic
917493017 1:175514356-175514378 CATTCTTTCTGGAGGCTCTCGGG - Intronic
917637845 1:176954435-176954457 AATTCTTTCTGGAGGCTCTAGGG - Intronic
917794591 1:178523805-178523827 CATTCCTTCTGGAAGCTCTAGGG + Intronic
917839764 1:178968223-178968245 CCTTCCTTCTGGAGGCTCTAAGG - Intergenic
918057247 1:181032677-181032699 TGTTCCTTCTGGAGGCTCTAAGG + Intergenic
918083395 1:181224529-181224551 CACTCCCTCTGGAGGCTCTAAGG - Intergenic
918162664 1:181915693-181915715 GACTCCTTCTGGAGACTATGAGG + Intergenic
918220092 1:182428820-182428842 GGTTCCTTCTGAAGGCTATGAGG + Intergenic
918295498 1:183152377-183152399 CATTCTATCTGGAGGCTCTGGGG - Intergenic
918658384 1:187057653-187057675 CATTGCTTCTGGAGGAAATGTGG - Intergenic
918679715 1:187337624-187337646 CATTCTTTATGTAGGCTGTTAGG - Intergenic
918770012 1:188545140-188545162 TGTTCCTTCTGGAAGCTGAGAGG + Intergenic
918901577 1:190427651-190427673 CACTCCTTCTTGAGGCTCTAAGG - Intronic
918905361 1:190485288-190485310 CATTTCTTCTGGAAGCTCTAGGG - Intergenic
919086957 1:192931950-192931972 CATTCCTTCTGGAAGCTTCAGGG + Intergenic
919500849 1:198336682-198336704 GATTCCTTCTGGAGGCTCTAGGG + Intergenic
919770946 1:201158196-201158218 CATTCCTTCTAGAAGCTCTAGGG - Intronic
920136243 1:203771538-203771560 AATTGCTTCTGGAGGGTGAGAGG - Intronic
920172327 1:204079835-204079857 CAGACCTCCTAGAGGCTGTGAGG + Intronic
920543766 1:206798788-206798810 CCCTCCTTCTGGTGGCTTTGAGG - Intergenic
920665707 1:207961382-207961404 TGTTCCTTCTGGAGGCTCTGGGG + Intergenic
920702127 1:208225819-208225841 GATTCCTTCTGATGGCTGTGAGG - Intronic
920843025 1:209570746-209570768 GGTTCCTTCTGAGGGCTGTGAGG + Intergenic
920957091 1:210629628-210629650 GGTTCCTTCTGGAGGCTATAGGG + Intronic
921123614 1:212157872-212157894 TGTTCCTTCTGGAGGCTCTAGGG + Intergenic
921268257 1:213444046-213444068 GGTTCCTTCTGAGGGCTGTGAGG + Intergenic
921537076 1:216364715-216364737 GGTTCCTTCTGGAGGCTCTGAGG - Intronic
921811218 1:219516509-219516531 TGTTCCTTCTGGAGGCTCTAAGG - Intergenic
922575171 1:226656293-226656315 CCCTCCTCCTGGATGCTGTGAGG - Intronic
922871505 1:228905667-228905689 CATTCCTTTTGGAGGCTCTAGGG - Intergenic
922936368 1:229426116-229426138 GGTTCCTTCTGAAGGCTCTGAGG - Intergenic
923073276 1:230585422-230585444 CATTCCCTCTGGAGAGTCTGGGG - Intergenic
923144711 1:231189942-231189964 GGTTCCTTCTGGAGGCTCTAAGG - Intronic
923330632 1:232920781-232920803 GAGTCCTTCTGAGGGCTGTGGGG - Intergenic
923717579 1:236438017-236438039 GGTTCCTTCTGAGGGCTGTGAGG + Intronic
924036886 1:239946618-239946640 GGTTCCTTCTGGGGGCTGTGAGG - Intergenic
924038350 1:239958214-239958236 CATTGCTGGAGGAGGCTGTGTGG - Intergenic
924041854 1:239991823-239991845 GGTTCCTTCTGGGGGCTGTGAGG + Intergenic
924198060 1:241629992-241630014 CATTCCAACTGGTTGCTGTGTGG - Exonic
924322061 1:242860297-242860319 AGTTCCTTCTGGAGGCTCTGGGG - Intergenic
1063102435 10:2962465-2962487 AGTTCCTTCTGGAAGCTCTGGGG + Intergenic
1063650933 10:7936007-7936029 AAGTCCTGATGGAGGCTGTGGGG + Intronic
1063960812 10:11304163-11304185 TGTTCCTTCTGGAGGCTCTCGGG + Intronic
1064018488 10:11791102-11791124 CATTCCTTCTGGAAGCTCGAGGG + Intergenic
1064442305 10:15364701-15364723 CATTCCTTCTGGAGGCTCTAGGG + Intronic
1064462034 10:15544390-15544412 GGTTCCTCCTGGAGGCTCTGAGG - Intronic
1064477577 10:15707441-15707463 CATTCCTTCTGGAAGCTCTTGGG - Intronic
1064618296 10:17186545-17186567 CATTCCTTCTGGAGGTTCTAGGG - Intronic
1064824961 10:19388027-19388049 GATTCCTTCTGAGGGTTGTGAGG + Intronic
1065054239 10:21827509-21827531 AGTTCCTTTTGGAGGCTCTGAGG + Intronic
1065694944 10:28371118-28371140 CATTGCTTCTGGAAGCTCAGTGG + Intergenic
1066360636 10:34727097-34727119 CATTCCCTCTGCACCCTGTGTGG + Intronic
1066515875 10:36159949-36159971 CATTCCTTCTGGAGATTCTAGGG - Intergenic
1066554180 10:36593074-36593096 CCTTCTTTTTGGAGGCTCTGGGG - Intergenic
1066665013 10:37774133-37774155 CATTTCTTCTGGTGGCTGTCAGG - Intergenic
1067433754 10:46263395-46263417 CATTCCCTGTGGACCCTGTGGGG - Intergenic
1067439932 10:46302913-46302935 CATTCCCTGTGGACCCTGTGGGG + Intronic
1067665151 10:48271207-48271229 CTGTCCTTCTGCAGGCTCTGTGG + Intronic
1067894136 10:50161462-50161484 CATACCTTCTGGAGACTCTAAGG + Intergenic
1067899478 10:50223932-50223954 GGTTCCTTCTGGAGGCTCTAAGG - Intronic
1067954710 10:50778802-50778824 CATACCTTCTGGAGACTCTAAGG - Intronic
1067980688 10:51081116-51081138 CATTCCTTCTGGAGGCTCTAGGG + Intronic
1068105948 10:52616537-52616559 CCTTCCTTTTGGAGGCTGTAAGG + Intergenic
1068118747 10:52762726-52762748 GGTTCCTACTGGAGGCTCTGAGG + Intergenic
1068328384 10:55527294-55527316 GGTTCCTTCTGAAGGCTGTAAGG + Intronic
1068680206 10:59811062-59811084 CCATCCTTCTGGAGGTTGTTGGG - Intronic
1068859242 10:61830078-61830100 GATTCCTTCTGCAGGCTGTGAGG - Intergenic
1069344920 10:67457675-67457697 CGTTCCTTCTGGAGGCTTTAGGG + Intronic
1069577884 10:69543786-69543808 CCTTCTTTCTCCAGGCTGTGAGG - Intergenic
1069586083 10:69603463-69603485 AGTTCCTTCTGGAGGTTCTGAGG + Intergenic
1069600527 10:69703346-69703368 GGTTCCTTCTGGGGGCTCTGAGG + Intergenic
1069654087 10:70075069-70075091 AATTCCTTCTGATGGCTTTGAGG + Intronic
1069869548 10:71524860-71524882 CGTTCCTTCTGGAGGCTCCAAGG - Intronic
1070342854 10:75513617-75513639 TCTTCCCTCTGGAGGCTGTAGGG + Intronic
1070551610 10:77494813-77494835 AGTTCCTTCTGAGGGCTGTGAGG + Intronic
1070566555 10:77607709-77607731 GGTTCCTTCTGGAGGCTCTGAGG - Intronic
1070655459 10:78268089-78268111 CGCTCCTTCTGGAGGCTCTAGGG - Intergenic
1070950060 10:80423871-80423893 CATTCCTTCTGAAGACTATAGGG + Intronic
1071437863 10:85663416-85663438 GATTTCTTCTGAGGGCTGTGAGG - Intronic
1071482460 10:86075466-86075488 GGTTCCTTCTGAGGGCTGTGAGG - Intronic
1071482635 10:86076752-86076774 GGTTCCTTCTGAGGGCTGTGAGG + Intronic
1071683664 10:87733101-87733123 AATTACTTTTGGAAGCTGTGGGG - Intronic
1071791429 10:88958390-88958412 TATTCCTTATGGCTGCTGTGAGG - Intronic
1071885888 10:89950674-89950696 CTTTTCATCTGTAGGCTGTGGGG + Intergenic
1071927588 10:90428497-90428519 ATTTCCTTCTGGAGGCTCTAGGG + Intergenic
1071927889 10:90432121-90432143 CATTCCATCTGGAGGCACTAGGG + Intergenic
1072000713 10:91193243-91193265 TATTCCTTTTGGAGGCTCTAGGG - Intronic
1072200012 10:93149883-93149905 CATTCCTTCTGGAGGCTCTAAGG + Intergenic
1072257279 10:93631997-93632019 CTTGCTTTCTGGAGGCTCTGGGG + Intronic
1072292249 10:93974938-93974960 GGTTCCTTCAGGAGGCTCTGGGG - Intergenic
1072372043 10:94773574-94773596 CATTCCTCCTGGTGGGTTTGTGG + Intronic
1072489881 10:95894604-95894626 CATTCCTTGTTGTGGCTGAGTGG - Intronic
1072540259 10:96393118-96393140 CATTCCTTCTTGAGGTTCTAAGG - Intronic
1072669936 10:97421971-97421993 GATTCCTTCTGGAGGCAGAGGGG + Intronic
1073298516 10:102456184-102456206 CATCCCTTCTGGAGGCTCCAGGG - Intergenic
1073395525 10:103214214-103214236 CATTCCTTCTGGAGACTCTGGGG - Intergenic
1073396298 10:103220948-103220970 CAGTACTTCAGGAGGCTGAGTGG + Intergenic
1073598580 10:104824055-104824077 CATTCCTTGTGGGGGCTCTAGGG - Intronic
1073615494 10:104990825-104990847 CATTCCTTCTGGAGGCTCCAGGG - Intronic
1073920584 10:108453643-108453665 CTCGCCTTCTGTAGGCTGTGGGG + Intergenic
1074153164 10:110776442-110776464 AGTTCCTTCTGGAGGCTCTAAGG + Intronic
1074194966 10:111175647-111175669 CATTCTTTCTGGACCCTGTTTGG - Intergenic
1074389109 10:113042184-113042206 CATTCCTTCCAGAGCCTGTGTGG + Intronic
1074426196 10:113353659-113353681 GGTTCCTTCTGAGGGCTGTGAGG - Intergenic
1074501923 10:114033365-114033387 GTTTCCTTCTGAGGGCTGTGAGG - Intergenic
1074540878 10:114364383-114364405 CACTCCCTCTGGAGTCTCTGGGG + Intronic
1074576610 10:114675798-114675820 GGTTCCTTCTGAGGGCTGTGAGG + Intronic
1074771373 10:116736738-116736760 TATTCCTTCTGGAGGCTCTAGGG - Intronic
1075022629 10:118962915-118962937 GGCTCCTTCTGAAGGCTGTGGGG + Intergenic
1075223494 10:120604217-120604239 GGTTCCTTCTGAGGGCTGTGAGG - Intergenic
1075245895 10:120821951-120821973 AGTTCCTTCTGAGGGCTGTGAGG - Intergenic
1075262335 10:120973999-120974021 CATTCCTTCTGTAGGCTCTAGGG + Intergenic
1075283161 10:121158754-121158776 AATTCCCTCTTGAAGCTGTGTGG + Intergenic
1075699421 10:124459537-124459559 CATTCCTTCTGGAGGCTCTAGGG + Intergenic
1075887229 10:125911322-125911344 GGTTCCTTCTGGAGGCTCTAGGG - Intronic
1075903436 10:126061774-126061796 CATTGCTTTGGGAGGCTCTGGGG - Intronic
1076052947 10:127349704-127349726 GGTTCCTTCTGGAGGTTCTGAGG + Intronic
1076273743 10:129178688-129178710 GGTTCCTTCTGGAGGCTCAGAGG + Intergenic
1076849506 10:133086172-133086194 CTTTCCCTTTGGAGCCTGTGGGG + Intronic
1077546293 11:3171615-3171637 GGTTCCTTCTGGAGGCTCTGGGG + Intergenic
1078023724 11:7674653-7674675 GGTTCCTTCTGAGGGCTGTGAGG + Intronic
1078024375 11:7680656-7680678 GATTCTTTCTGGAGGCTCTGAGG - Intergenic
1078274022 11:9825346-9825368 GGTTCCTTCTGAGGGCTGTGAGG - Intronic
1078424934 11:11241824-11241846 AGTTCCTTCTGGAGGCTTAGAGG - Intergenic
1078467674 11:11562205-11562227 GGTTCCTTCTGTGGGCTGTGAGG + Intronic
1078477508 11:11643884-11643906 TCTTCTTTCTGGAGGCTGTAGGG - Intergenic
1078684927 11:13520481-13520503 CATTCCTTTTTATGGCTGTGTGG - Intergenic
1078801684 11:14651117-14651139 GGTTCCTTTTGAAGGCTGTGAGG + Intronic
1078874060 11:15376286-15376308 CATTCCCTCTGGAGTCTGAGGGG + Intergenic
1078923978 11:15857762-15857784 CATTTCATAAGGAGGCTGTGGGG + Intergenic
1079464907 11:20720644-20720666 GGTTCCTTCTGAGGGCTGTGAGG + Intronic
1079781381 11:24610232-24610254 CATCAGTTCTGGAGGTTGTGGGG + Intronic
1079946683 11:26751626-26751648 CATTCCTTCTAGAGGCTCCAGGG - Intergenic
1079981258 11:27153752-27153774 CATTCCTTCTGGAGATTCTAGGG - Intergenic
1080228410 11:29987093-29987115 TATTCCTTCTGGAGGCTCTAGGG - Intergenic
1080308847 11:30866634-30866656 GATTCCTTCTGAGGGCTATGAGG - Intronic
1080688281 11:34534066-34534088 GGTTCCTCCTGAAGGCTGTGAGG - Intergenic
1080799198 11:35593809-35593831 GCTTCCTTCTGGAGGCTCTGGGG + Intergenic
1080841761 11:35990303-35990325 GGTTCCATCTGGAGGCTCTGAGG + Intronic
1080868724 11:36217698-36217720 TGTTCTTTCTGGAGGCTCTGAGG + Intronic
1080939610 11:36900726-36900748 TTTTTTTTCTGGAGGCTGTGGGG + Intergenic
1081532727 11:43974257-43974279 GGTTCCTTCTGGAGCCTTTGAGG + Intergenic
1081895552 11:46582979-46583001 TATTCCTTCAGTAGGCAGTGAGG - Intronic
1082011239 11:47450911-47450933 CAATACTTCGGGAGGCTCTGAGG - Intergenic
1082865480 11:57896361-57896383 TGTTCCTTCTAAAGGCTGTGAGG + Intergenic
1082868938 11:57925687-57925709 CATTCCTTTTTATGGCTGTGTGG + Intergenic
1082984534 11:59157153-59157175 GGTTCCTTCTGGAGGTTTTGAGG - Intergenic
1083362055 11:62116603-62116625 CACTCCCTCTGGAGGCTGGGAGG + Intergenic
1083785098 11:64940369-64940391 CACTCCTTCTGGGAGCTGGGGGG + Intronic
1083830333 11:65227839-65227861 CCTCCTTTCTGGAGGCTCTGGGG + Intergenic
1084413550 11:69017513-69017535 GGTTCCTTCTGGAGGCTCTAGGG - Intergenic
1084514540 11:69629359-69629381 AAGCCCTTCAGGAGGCTGTGGGG - Intergenic
1084618034 11:70249558-70249580 GGTTCCTTCCGGAGGCTCTGAGG + Intergenic
1084724143 11:70929463-70929485 CATTCCTCCTGGAGGCAGTAAGG + Intronic
1084725649 11:70940074-70940096 CCTTCCTTCTGGAAGCCCTGGGG - Intronic
1085455002 11:76660668-76660690 CATTCCCGCTGGGGGCTGAGAGG + Exonic
1085622609 11:78048844-78048866 CCTCCTTTCTGGAGGCTCTGGGG - Intronic
1085643219 11:78206301-78206323 CTTTTCTTCTAGAGTCTGTGGGG + Intronic
1085807638 11:79650919-79650941 CATACATTCTGGAGGCCTTGTGG + Intergenic
1085899328 11:80679198-80679220 GATTCCTTCTGGAGACTCTAGGG - Intergenic
1085979783 11:81710354-81710376 CATTTCTTCTGGAGGCTCTAAGG + Intergenic
1086311167 11:85537639-85537661 CATTCCTTCTGGTGGGTTCGTGG - Intronic
1086318068 11:85613923-85613945 CATTCCTCCTGGTGGGTTTGTGG - Intronic
1086332647 11:85769459-85769481 AATTCCTTCAGGAGGCTCTAGGG - Intronic
1086535040 11:87834293-87834315 GTTTTCTTCTGGAGGCTTTGGGG - Intergenic
1086952296 11:92903704-92903726 GGTTCCTTCTGGAGGGTCTGAGG - Intergenic
1087157775 11:94921712-94921734 CCTTCCTTCTGGAGGCTCTAGGG + Intergenic
1087240411 11:95768786-95768808 GCTTCTTTCTGGAGGCTGTAGGG - Intergenic
1087271780 11:96119441-96119463 CCTTCCTTCTGGAGGCTCTAGGG - Intronic
1087629812 11:100636892-100636914 CATTTCTCCTGGTGGCTGAGAGG - Intergenic
1087662367 11:101002488-101002510 CCTTCCTTCTGGAAGCTCTAAGG + Intergenic
1087666953 11:101060856-101060878 CATTCCTTTTTGTGGTTGTGTGG + Intronic
1087730489 11:101772963-101772985 GGTTCCTTCTGAGGGCTGTGAGG - Intronic
1088254138 11:107887078-107887100 GATTCCTTCTGGATGCTCTGTGG - Intronic
1088502335 11:110494951-110494973 AATTCCTTCTGGAGGCTCTGAGG + Intergenic
1088504530 11:110515198-110515220 CATTTGTTCTGGTGCCTGTGTGG + Intergenic
1088743684 11:112786900-112786922 CATGGCTTCTGGAGCCAGTGAGG - Intergenic
1088966551 11:114727992-114728014 GATTCCTTCTGGAGACTGTACGG + Intergenic
1088981997 11:114872222-114872244 CATTCCTTCTGGAGGCTTCAGGG - Intergenic
1089260928 11:117223517-117223539 CATTCTTTCAGTAGGCTCTGGGG + Intronic
1089336773 11:117730366-117730388 CATTCTTTCTGGAGGCTGTAGGG - Intronic
1089571837 11:119416356-119416378 CAGGCCTTGTGGAGGCTGTGGGG - Intergenic
1089592679 11:119554627-119554649 CATTACTTCTGACGGCTGCGTGG - Intergenic
1089912872 11:122120346-122120368 GATTCTTTCTGGAAGCTCTGAGG - Intergenic
1089944144 11:122450313-122450335 GGTTCTTTCTGGAGGCTCTGAGG - Intergenic
1091305007 11:134531235-134531257 AATTCCTCCTGGAGACTCTGGGG - Intergenic
1091363029 11:134993276-134993298 CACTCCTTCTGGAGGCTTTGGGG - Intergenic
1091702362 12:2672500-2672522 GGTTCTTTCTGGAGGCTCTGGGG + Intronic
1091891498 12:4058588-4058610 AATTCCTTCTGGGGGCTCTGAGG + Intergenic
1092096460 12:5846619-5846641 CACTCCCTCTGAAGGCTGTAAGG + Intronic
1092100230 12:5877331-5877353 GGTTCCTCCTGGAGGCTCTGAGG - Intronic
1092340092 12:7668246-7668268 CATTTCTTCTGGAGGCTCTGGGG - Intergenic
1092519990 12:9260739-9260761 CATTCCTGCTGGAGCTTGAGGGG - Intergenic
1092565913 12:9665277-9665299 CATTTCTTTTGGAGGCTCTAGGG + Intronic
1092850700 12:12623999-12624021 CATTCCCTCTGGAGGTCATGGGG - Intronic
1092920720 12:13229438-13229460 CCTTCTGTCTGGGGGCTGTGAGG + Intergenic
1093421230 12:18977273-18977295 GGTTCCTTCTGGAGGCTCGGAGG + Intergenic
1093516347 12:19990962-19990984 CATTTCTTCTGGAGGCTTGAGGG - Intergenic
1093786631 12:23199302-23199324 GATTCCTTCTGGAGGTTTAGGGG - Intergenic
1093827595 12:23713266-23713288 TATTCCTTCTGGAGGCTCTGAGG - Intronic
1094110652 12:26858775-26858797 CGTTCCCTCTGGAGGCTCTGGGG - Intergenic
1094192157 12:27708908-27708930 GGTTCCTTCTGGAGGTTCTGAGG - Intergenic
1094238442 12:28194578-28194600 CATTCCTCCTGGTGGGTTTGTGG + Intronic
1094238452 12:28194641-28194663 CATTCCTCCTGGTGGGTTTGTGG + Intronic
1094295112 12:28897210-28897232 GCTTCCTTCTGAGGGCTGTGAGG + Intergenic
1094440281 12:30468075-30468097 GATTCTTTCTGGAGGCTCTGAGG + Intergenic
1094585316 12:31772352-31772374 AATTCCTTCTTGAGGCTCTAGGG + Intergenic
1094800468 12:34027766-34027788 GGTTCCTTCTGGAGGCTCTAAGG + Exonic
1095113264 12:38322065-38322087 GGTTCCTTCTGGAGGCTCTAAGG + Exonic
1095135119 12:38591599-38591621 TATTCCTTCTGGAAGCTCTAAGG + Intergenic
1095168630 12:39006181-39006203 CTTTCTTTCTGGAAGCTCTGGGG - Intergenic
1095339608 12:41074054-41074076 CCTGCCTTCTGGAGACTCTGAGG + Intergenic
1095393877 12:41741319-41741341 GGTTCCTTTTGGAGGCTGTAGGG + Intergenic
1095403589 12:41842678-41842700 GGTTCCTTCTGGAAGCTCTGAGG - Intergenic
1095508565 12:42924749-42924771 GGTTCCTCCTGGAGGCTCTGAGG - Intergenic
1095626720 12:44323158-44323180 TGTTCCTTCTGGAGGCTCTAAGG - Intronic
1095642548 12:44501658-44501680 CATTCCTCCTGGTGGGTTTGTGG - Intergenic
1096225638 12:49865297-49865319 GGTTCCTGCTGGAGGCTCTGAGG - Intergenic
1096356699 12:50947356-50947378 TGTTTCTTCTGGAGGCTCTGGGG + Intergenic
1096460425 12:51819038-51819060 CATCTCTGCTGGAGGCTCTGAGG - Intergenic
1096521973 12:52189607-52189629 GCCTCCTTGTGGAGGCTGTGAGG - Intronic
1096641624 12:52999167-52999189 TGTTCCTTCTGGAGGCTTTAGGG - Intergenic
1096759988 12:53833224-53833246 GATTCCTTCTGAGGGCTGTGAGG - Intergenic
1097228187 12:57491605-57491627 CAGTCACTCTGGAGGCAGTGTGG - Intronic
1097610574 12:61814915-61814937 TGTTCCTTCTGGAGGCTCTAGGG - Intronic
1097976616 12:65693330-65693352 CATACCTTCTGGAGGCTGGAGGG + Intergenic
1098023424 12:66178328-66178350 TATTCCTTCTAAAGGCTCTGAGG + Intergenic
1098030602 12:66249597-66249619 CATTCTTTCTGGAGGCTGTTGGG + Exonic
1098516830 12:71387257-71387279 CATTTCTTCTGGAGGCTCTAAGG - Intronic
1098518173 12:71402942-71402964 CATGCCTTCTGCTGGCTCTGTGG - Intronic
1098879975 12:75907190-75907212 GATTCCTTCTGAGGGCTGTGAGG + Intergenic
1098999008 12:77154995-77155017 CATTCTTTCTGGAGGCTGTAGGG + Intergenic
1099004841 12:77223960-77223982 GATTCCTTCTGAGGACTGTGAGG - Intergenic
1099046355 12:77725816-77725838 CATTCCTTCTGGAAGATCTGTGG + Intergenic
1099257517 12:80332065-80332087 CATTCCTTCTGGAGGCTCTAAGG - Intronic
1099453509 12:82836564-82836586 TATTCCTTCCGGAGGCTCTAGGG - Intronic
1099855717 12:88163548-88163570 GGTTCCTTCTGGAGGCTCTAAGG + Intronic
1099916343 12:88898898-88898920 CATTCCTTCTGGAGACTTCAGGG + Intergenic
1100295712 12:93258964-93258986 GGTTCCTTCTGGGGGCTTTGAGG - Intergenic
1100431380 12:94534422-94534444 AGTTCCTCCTGGAGGCTCTGGGG - Intergenic
1100580068 12:95930357-95930379 GGTTCCTTCTGGAGGCTCTGAGG + Intronic
1100673730 12:96844436-96844458 GGTTCCTTCTGGAGGCTCTAAGG - Intronic
1100921858 12:99497475-99497497 GGTTCCTTCTGTGGGCTGTGAGG + Intronic
1101031211 12:100662070-100662092 CAGGACTTCTGGAGGCTGTGTGG + Intergenic
1101229471 12:102725210-102725232 GATTCCTTCTGGAGGTTCTCAGG - Intergenic
1101430354 12:104621705-104621727 CGTTCCTTCTGGAGGCTCCAAGG - Intronic
1101571105 12:105954516-105954538 GGTTCCTTCTGGAGGCTCAGAGG + Intergenic
1101783939 12:107865133-107865155 CGTTCCTTCTGGTGGGTTTGTGG - Intergenic
1101964867 12:109275553-109275575 CGGTCCTTCTGGAGGCTCTAGGG + Intergenic
1101998467 12:109541736-109541758 CACTCCCTCTGGAGGCTCTGGGG + Intergenic
1102014175 12:109636929-109636951 GGTTCCTTCTGGAGGCTCTGAGG + Intergenic
1102185890 12:110948442-110948464 GATTCCCTCTGGAGGCTCTCAGG + Intergenic
1102386742 12:112516396-112516418 CTTTCCTTCTGGGGGCTCTAGGG + Intergenic
1102418684 12:112786912-112786934 TGTTCCTTCTGGAGGCTCTCAGG + Intronic
1102447796 12:113016969-113016991 CTTCCTTTCTGGAGGCTCTGGGG - Intergenic
1102525300 12:113508389-113508411 CATTCATTCTGGAGGCTCTAGGG - Intergenic
1102591966 12:113963107-113963129 CAGTCCTTCTGGAAGCTCTGTGG - Intronic
1102784381 12:115592387-115592409 CATTTCTTCTGAAGGCTGGCAGG + Intergenic
1102879013 12:116470035-116470057 GGTTCCTTCTGGAGGCACTGAGG - Intergenic
1103036401 12:117660344-117660366 GGTTCTTTCTGGAGGCTCTGAGG + Intronic
1103139522 12:118536333-118536355 CTTTCCTCCTGGGGGATGTGGGG + Intergenic
1103887792 12:124215897-124215919 GTTTCCCTCTGGAGGCTCTGAGG + Intronic
1103896301 12:124275516-124275538 GGTTCCTTCTGGAGGCTCTGGGG - Intronic
1103920065 12:124394708-124394730 CATTCCCTCCAGAGGCTCTGGGG - Intronic
1103952183 12:124557340-124557362 GGTTCCTTCTGGAGGCTCTGCGG + Intronic
1104006456 12:124896214-124896236 CATCCCTTCTGGAAGCTCTAGGG + Intergenic
1104011093 12:124930723-124930745 TGTTCCTTCTGGAGGCTCTGGGG + Intergenic
1104053971 12:125215353-125215375 CATTCCTTCTGGAGTTTCTACGG + Intronic
1104099301 12:125591257-125591279 CATTCCTTCTGGAAGCTCTAGGG + Intronic
1104424968 12:128668719-128668741 CACTCCTTCTGGAAGCTCTCAGG + Intronic
1104671448 12:130683316-130683338 CCTTCCCCCTGGAGGCTCTGTGG - Intronic
1104743740 12:131197110-131197132 GATACCTTCTAGAGGTTGTGAGG + Intergenic
1104859976 12:131918709-131918731 CATTCTGGCTGGAGGGTGTGTGG + Intronic
1106223265 13:27765383-27765405 GGTTCCTCCTGGAGGCTCTGGGG + Intergenic
1106475233 13:30092747-30092769 GGTTCCTTCTGGATGCTCTGAGG - Intergenic
1106528864 13:30568754-30568776 CAGAAGTTCTGGAGGCTGTGAGG - Intronic
1106951613 13:34890724-34890746 GGTTCCTTCTGAAGGCTGTGAGG - Intergenic
1107201206 13:37720117-37720139 CATTCCTTCTGGAAGCTCAGAGG - Intronic
1107630364 13:42336433-42336455 CTTTCCTTCTGGAGGCTCTGAGG - Intergenic
1107884172 13:44860677-44860699 CATTCCTCCTGGAGGCTCTAAGG + Intergenic
1107884917 13:44867265-44867287 CATTCCTTCTGGAGGCTCCGGGG + Intergenic
1108286879 13:48917616-48917638 CATTCCTTCATGAGGCTCTCTGG + Intergenic
1108605665 13:52036080-52036102 TGTTCCTTCTGGAGGCTCTAGGG + Intronic
1108845848 13:54677809-54677831 TATTCCTTCTGGTGGGTTTGTGG - Intergenic
1108862249 13:54875947-54875969 CACTGCTTCTGGATGCTATGAGG - Intergenic
1108883730 13:55154135-55154157 GATTCCTTCTGGAGGCTCAGGGG - Intergenic
1108970970 13:56376249-56376271 CATTTCTTCTGGAGGCTTCAGGG - Intergenic
1109103657 13:58220498-58220520 CATTCCTTCTGAAGGCTCTAAGG - Intergenic
1109124567 13:58503647-58503669 CATTCCTCCTGGTGGGTTTGTGG + Intergenic
1109147330 13:58795950-58795972 CATTCCTTCTGCAGGCTGTAGGG - Intergenic
1109242424 13:59905851-59905873 CATTCCTTCTGAGGGCTCTAGGG - Intronic
1109289603 13:60457724-60457746 GGTTCCTTTTGGAGGCTCTGAGG + Intronic
1110079209 13:71289793-71289815 TCTTCCTTCTGGTGGGTGTGTGG + Intergenic
1110321190 13:74161550-74161572 TATTCTTTCTGGAGGTTCTGAGG - Intergenic
1110343929 13:74424409-74424431 GGTTCTTTCTGAAGGCTGTGAGG + Intergenic
1110409579 13:75189480-75189502 CATTCTCTCTGGAGGCTCTAGGG - Intergenic
1110508654 13:76321854-76321876 TATTCCTTCTTCAGGCTGTGAGG - Intergenic
1110550363 13:76805148-76805170 GGTTCCTTCTGGAGGCTCTGAGG + Intergenic
1110614580 13:77527188-77527210 ATTTCCTTCTGGAGGCTCTAAGG - Intergenic
1110865724 13:80393360-80393382 AATTCCTTCTGGAGGCTCAAGGG - Intergenic
1111117018 13:83792902-83792924 CACCCTTTCTGGAGGCTCTGGGG + Intergenic
1111281617 13:86032645-86032667 CATTCCATCTGGAGGCAGTTGGG + Intergenic
1111439963 13:88268615-88268637 CATTCCTTTTTATGGCTGTGTGG - Intergenic
1111454421 13:88461795-88461817 GATTCCTCCTGAAGGCTGTGAGG + Intergenic
1111477254 13:88767048-88767070 CCTTCCCTCTGGAGGCTCTTGGG + Intergenic
1111664339 13:91248517-91248539 CAGTCTCTCTGGAGGCTCTGGGG + Intergenic
1111691249 13:91565845-91565867 GGTTACTTCTGGAGGCTCTGAGG + Intronic
1111797491 13:92941433-92941455 CATTCCTTCTGGAAGCTCTGGGG - Intergenic
1111813071 13:93116315-93116337 GGTTTCTTCTGAAGGCTGTGAGG + Intergenic
1111820600 13:93209213-93209235 CATTCCTTCTGCAGATTCTGGGG + Intergenic
1111954758 13:94744077-94744099 CATTCCTTCTGAAGGTTCTAGGG - Intergenic
1112191349 13:97180931-97180953 CATTCCTTCTGGAGGCTCTAAGG + Intergenic
1112407200 13:99131575-99131597 CATTCCTCCTGGAGGCTCTCGGG - Intergenic
1112408699 13:99143541-99143563 GGTTCCTTCTGGAGGCTCTGGGG - Intergenic
1112436841 13:99396600-99396622 GGTTCCTTCTGGGGGCTGTTAGG - Intergenic
1112513513 13:100031654-100031676 TGTTCCTTCTGGAGACTGTAGGG + Intergenic
1112622228 13:101064703-101064725 GATTCCTTCTGAGGCCTGTGAGG - Intronic
1112839575 13:103559689-103559711 GATTTCATCTGGAGGCTCTGTGG - Intergenic
1112987385 13:105467970-105467992 CATGCCTTCTGGAGGCTCCAGGG + Intronic
1113685006 13:112277014-112277036 CATTCCTTCTGGATGCAGCCAGG + Intergenic
1113685194 13:112278169-112278191 CATTCCTTCAGGATGCAGTCAGG + Intergenic
1113687550 13:112291596-112291618 CATTCCTTCAGGATGCAGTCAGG + Intergenic
1113688814 13:112298702-112298724 CATTCCTTCAGGATGCAGTCAGG + Intergenic
1113689989 13:112305228-112305250 CATTCCTTCAGGATGCAGTCAGG + Intergenic
1113691516 13:112314302-112314324 CATTCCTTCAGGATGCAGTCAGG + Intergenic
1113691858 13:112316716-112316738 CATTCCTTCAGGATGGTGTGAGG + Intergenic
1114369969 14:22076032-22076054 GATTTCTTCTGGAGGCTCTCAGG + Intergenic
1114371178 14:22090193-22090215 AGTTCCTTCTGGTGGCTATGGGG - Intergenic
1114498228 14:23148774-23148796 AATTTCTTCAGGAGGCTCTGGGG - Intronic
1114566640 14:23638119-23638141 CATTCCTTCTGGAGGGTTTGTGG - Intronic
1115494876 14:33993266-33993288 CATTCCTCCTGGAAGCTCTAGGG - Intronic
1115935057 14:38543064-38543086 CATTGCTTCTGGGGGTAGTGAGG + Intergenic
1116001909 14:39252445-39252467 CATTCCTTCAGGAGGCTCTAGGG - Intronic
1116056600 14:39871798-39871820 CATTCCTCCTGCAGGCTCTAAGG - Intergenic
1116311152 14:43327654-43327676 CATTCCTCCTGGTGGGTTTGTGG - Intergenic
1116311459 14:43331985-43332007 GTTTCTTTCTGGAGGCTGTAGGG - Intergenic
1116402929 14:44531204-44531226 CATTACTTCTGGAGGTTCTATGG - Intergenic
1116552631 14:46261326-46261348 CATTCTTTCTGGAGGATGCCTGG - Intergenic
1116763335 14:49041180-49041202 AGTTCCTTCTGAGGGCTGTGAGG + Intergenic
1116870757 14:50067447-50067469 CGTTTCTTCTGAGGGCTGTGAGG + Intergenic
1117626845 14:57649323-57649345 CATTCCTTCTGGAGGTTCCAGGG + Intronic
1117627402 14:57653901-57653923 GGTTCCTTCTGAGGGCTGTGAGG + Intronic
1117838796 14:59835956-59835978 CATTCCTTCTGGAGGTTCTAGGG + Intronic
1118759636 14:68872212-68872234 CATTCTATCTGGAGGCTCTCAGG + Intergenic
1118879788 14:69816299-69816321 CATTCATTCTGGCTGCTTTGTGG + Intergenic
1119129938 14:72162859-72162881 CATTCCTTTTTATGGCTGTGTGG - Intronic
1119165324 14:72487699-72487721 TGTTCCTTCTGGAGGCTCTAGGG - Intronic
1119208362 14:72811439-72811461 GGTTCCTTCTGAGGGCTGTGAGG - Intronic
1119372610 14:74160280-74160302 CATTCCTTCTGAGGGCTGTGAGG - Intronic
1119639809 14:76306096-76306118 GGTTCCTTCTGAGGGCTGTGAGG - Intergenic
1119677690 14:76568145-76568167 CATTCCTTCTGAAGGCTCTAAGG - Intergenic
1119852520 14:77876176-77876198 TATTCCTTCTAGAGGCTCTAGGG + Intronic
1119919608 14:78434277-78434299 GATTCCTTCTGAGGGTTGTGAGG + Intronic
1120095835 14:80386614-80386636 CGTTCCTTTTGTAGGCTGTAAGG - Intronic
1120125361 14:80735740-80735762 CTTCCTTTCTGGAGGCTCTGGGG + Intronic
1120503620 14:85326746-85326768 CATTCCTTCTAAAGGCTCTGGGG - Intergenic
1120737160 14:88066018-88066040 CATTTTATCTGGAGGCTCTGAGG + Intergenic
1120777550 14:88454178-88454200 CATTCCTCTTGGAGGCTGTAGGG + Intronic
1120841547 14:89089757-89089779 GCTTCCTTCTGAGGGCTGTGAGG - Intergenic
1120865660 14:89293428-89293450 GGTTCCTTCAGCAGGCTGTGGGG + Intronic
1120872158 14:89347441-89347463 GGTTCCTTCTGTGGGCTGTGAGG - Intronic
1120916273 14:89713261-89713283 GGTTCCTTCTGGTGGCTATGAGG + Intergenic
1120927458 14:89811710-89811732 CATTCCTGCTGGAGGCTCAAGGG - Intronic
1121051309 14:90820583-90820605 CCTTCCTTCTGAAGGCAGTGAGG + Intergenic
1121168074 14:91827357-91827379 CATTACTTCTGGAGGCTCTATGG + Intronic
1121358591 14:93234864-93234886 GATTCTAGCTGGAGGCTGTGTGG - Intergenic
1121454377 14:94028916-94028938 CATTCCTTTTGGCGGGTGCGGGG + Intronic
1121476612 14:94213750-94213772 CATTCCATCTAGAGGCTCTGGGG - Intronic
1121519972 14:94579358-94579380 CACTCTTTCTGGAGGCTCTAGGG + Intronic
1121583733 14:95048853-95048875 GGTTCCTTCTGGAGGCTCCGAGG + Intergenic
1121683395 14:95813430-95813452 GGTTCCTTCTGAGGGCTGTGAGG + Intergenic
1121717026 14:96083680-96083702 CACTCCTTCTGGAGGCTCTAGGG - Intronic
1121742675 14:96265086-96265108 CATTCCTTCTGGAGGCTCCAGGG - Intronic
1121942191 14:98081719-98081741 CATTCCTTCTGGAAGCTCCGGGG - Intergenic
1122005662 14:98701504-98701526 CTTCCCTTCTGGAGGCTGGTGGG + Intergenic
1122227659 14:100289141-100289163 GGTTCCTTCTGGGGGCTCTGAGG - Intergenic
1122637353 14:103136351-103136373 CACTCCTTCTGGAGGCTCTAGGG + Exonic
1122738340 14:103856452-103856474 CCTTCCTTCTGGAATCTGTCTGG + Intergenic
1122924333 14:104892747-104892769 CATCCCTCCTTGTGGCTGTGGGG + Intronic
1124069651 15:26379604-26379626 CATTCCTTTTGGAAGCTCTGGGG + Intergenic
1124206990 15:27729535-27729557 ATTTCTTTCTGGAGGCTGTAAGG + Intergenic
1124636480 15:31367950-31367972 AATTCCTTCCAGAGGCTCTGAGG + Intronic
1124642749 15:31406684-31406706 CATTCCTTCTGGAGGCTCTAAGG + Intronic
1124667521 15:31605920-31605942 CATTTCTGCTGGAGCCTGTGGGG + Intronic
1124694674 15:31854132-31854154 CATTCCTTCTGGATGCTCCAGGG + Intronic
1125278018 15:38013882-38013904 CATTCCTTCTGCAGGCTCTAGGG + Intergenic
1125315347 15:38425596-38425618 ACTGCCTTCTGGAGGCTTTGAGG - Intergenic
1125459219 15:39892764-39892786 GGTTCCTTCTGAAGGCTCTGAGG - Intronic
1125935834 15:43634907-43634929 TATTCCCTCTGGAGGCTTTAGGG + Intronic
1125948602 15:43731364-43731386 TATTCCCTCTGGAGGCTTTAGGG + Intergenic
1126262838 15:46714461-46714483 TGTTCCTTCTGGAGGCTCTAGGG + Intergenic
1126405691 15:48320395-48320417 CCTCCCTTCTAGAGGCTCTGAGG - Intergenic
1126729561 15:51668826-51668848 CCTTCCTTCTGGAGACAGTAGGG - Intergenic
1127122198 15:55781306-55781328 GGTTCCTTCTGAGGGCTGTGAGG + Intergenic
1127269175 15:57385528-57385550 CATTCCTTCTTCACACTGTGGGG + Intronic
1127308480 15:57730455-57730477 GGCTCCTTCTGGAGGCTCTGAGG - Intronic
1127323327 15:57868368-57868390 CCTTCCTTCTGGTGGGTTTGTGG + Intergenic
1127362242 15:58254481-58254503 AGTTCCTTCTGGAGGCTCTGAGG + Intronic
1127529633 15:59830779-59830801 CATTTCATCTGGGGTCTGTGCGG + Intergenic
1127633567 15:60848509-60848531 CATTCCTTCTGAAGGCTTCAGGG - Intronic
1127791978 15:62406217-62406239 TATTCCTTCTGAGGACTGTGAGG + Intronic
1127799398 15:62464846-62464868 CATTCCTTCTGATGGCTGAGGGG + Intronic
1127818491 15:62633876-62633898 GGTTCCCTCTGAAGGCTGTGAGG + Intronic
1127875815 15:63110470-63110492 CATTCCTTCTGAAAGCTCTAGGG - Intergenic
1127892821 15:63270161-63270183 GGTTCCTTCTGGAGGCTGTAGGG - Intergenic
1127912212 15:63426670-63426692 CATTCCTTCTGGAGGCTCTAGGG + Intergenic
1127956591 15:63859178-63859200 CATTCTTTCTGGAGGCCCTAGGG + Intergenic
1128596319 15:68954056-68954078 CATTCCTTCTGCTTGCTTTGGGG + Intronic
1128618281 15:69127430-69127452 CATTTCCTCTGGAGGCTCTAGGG - Intergenic
1128878841 15:71224661-71224683 CACTCCTTCTGGGGGCTTTGAGG + Intronic
1129057415 15:72830858-72830880 GGATCCTTCTGGAGGTTGTGAGG + Intergenic
1129257260 15:74340755-74340777 TATTTCATCTGGAGGCTCTGGGG - Intronic
1129468171 15:75735647-75735669 CATTCTGTCTTGGGGCTGTGAGG + Intergenic
1129626821 15:77209804-77209826 CATTCCTTCAGAAGGCTCTAAGG - Intronic
1129719227 15:77869050-77869072 CATTCTGTCTTGGGGCTGTGAGG - Intergenic
1129789126 15:78328967-78328989 GATTCCTTCTGAGGGCTGTGAGG + Intergenic
1129792628 15:78351649-78351671 CTTTCCTGCTATAGGCTGTGGGG - Intergenic
1129941971 15:79506014-79506036 CCCTCCTTCTGGAGGCTCTAGGG + Intergenic
1130051281 15:80486020-80486042 AGTTATTTCTGGAGGCTGTGAGG + Intronic
1130067544 15:80617144-80617166 GGTTCCTTCTGGAGACTCTGAGG + Intergenic
1130459697 15:84151811-84151833 CATTCTGTCTTGGGGCTGTGAGG + Intergenic
1130697460 15:86144957-86144979 GGTTCCTTCTGGAGTCTCTGAGG + Intronic
1130712082 15:86293329-86293351 TGTTTCTTCTGGAGGCTCTGTGG + Intronic
1130851602 15:87800206-87800228 CATGCCTTCTGCAGGCTCTAGGG + Intergenic
1130925451 15:88382482-88382504 CCTTGCTGCTGGAGCCTGTGAGG - Intergenic
1130959659 15:88651429-88651451 GGTTCCTTCTGGATGCTCTGGGG + Intronic
1131472686 15:92710433-92710455 TATTCCTTCTGGCGGCTTCGTGG + Intronic
1131505874 15:93018649-93018671 GGTTCCTTCTGGAGGCTCCGAGG + Intronic
1131660594 15:94511608-94511630 CATTCCTTCTGGAGGCTCCAGGG + Intergenic
1131799638 15:96055626-96055648 GGTTCCTTCTGATGGCTGTGAGG - Intergenic
1132153063 15:99475889-99475911 CACTCCTTGTGGAGGTGGTGGGG - Intergenic
1132248042 15:100312397-100312419 CATTCCTTCTGGAGGTTCCAGGG - Intronic
1132613690 16:830029-830051 CCTTCCTTCTTGTGGCTGAGTGG + Intergenic
1132661787 16:1064893-1064915 CACTCCTTCCGGAGGCCCTGGGG + Intergenic
1132674593 16:1116465-1116487 CTTTCCTGCTGGAGGTTGTGAGG + Intergenic
1132773630 16:1579455-1579477 GGTGCCTTCTGGAGGCTCTGAGG - Intronic
1133037581 16:3042738-3042760 GGTTCCTTCTGGAGGCTCTGAGG + Intergenic
1133166082 16:3948430-3948452 CATTCCTTCTGGTGGCTGCCTGG + Intergenic
1133384304 16:5356250-5356272 GATTCCTTCTGGAGGCTCTGAGG - Intergenic
1133556280 16:6909161-6909183 CATTTCTTCTGGAGGTTCTTTGG + Intronic
1133677634 16:8089968-8089990 GCTTCCTTCTGAAGGCTCTGTGG - Intergenic
1133723215 16:8514311-8514333 CATTTCTTCTGGAGGCTCTAGGG + Intergenic
1133736214 16:8617761-8617783 GGGTCCTTCTGGAGGCTCTGAGG + Intergenic
1133782728 16:8952463-8952485 CATTCCTTCTGGAGGTTCTAGGG + Intronic
1133836223 16:9369869-9369891 GATTCCTTCTGAGGGCTATGGGG - Intergenic
1134109697 16:11507363-11507385 CATTCTTTGTGGAGTGTGTGGGG - Intronic
1134289498 16:12892370-12892392 GATTCCTTCTGGAGGCTCCAAGG + Intergenic
1134404673 16:13946016-13946038 CATTCCTCCTGGAGGCTCTAGGG + Intronic
1134414813 16:14034236-14034258 GGTTCCTTCTGGAAGCTGTGAGG + Intergenic
1134760606 16:16711101-16711123 CATTATTTCTGGAGGCTCTGGGG + Intergenic
1134764432 16:16744342-16744364 CATGTCTTCTGGAGGCTCTAGGG - Intergenic
1134783326 16:16918400-16918422 CATTCCATCTGGAGGCTTGAGGG + Intergenic
1134857260 16:17530594-17530616 CTTTCCCTCTGGAGGCTCTAGGG + Intergenic
1134905848 16:17978874-17978896 CGTTCCTTCTGGAGGCTGTAGGG - Intergenic
1134981626 16:18614872-18614894 CATGTCTTCTGGAGGCTCTAGGG + Intergenic
1134985453 16:18648072-18648094 CATTATTTCTGGAGGCTCTGGGG - Intergenic
1135178498 16:20252506-20252528 CATTCCCTCTGGAGGCTCCAGGG + Intergenic
1135463133 16:22662316-22662338 CATTCTTTCTGGAGGCTCTCAGG + Intergenic
1135467272 16:22697896-22697918 CATTCCTTCTGGGGGCTTTAAGG + Intergenic
1135532246 16:23264797-23264819 CATCTCTTCTGGAGGCTTTAGGG + Intergenic
1135624147 16:23981181-23981203 CCTTCCTTCTGGAGGCTCTAGGG + Intronic
1135630971 16:24035411-24035433 CATTCATCATGCAGGCTGTGAGG - Exonic
1135912515 16:26574252-26574274 CATGCCTTCTAGAGGCTTTGGGG - Intergenic
1136021893 16:27445804-27445826 TATCCCTTCAGGAGCCTGTGAGG + Intronic
1136102301 16:28005074-28005096 GATTCCTTCTGAGGGCTGTGGGG + Intronic
1136146964 16:28321502-28321524 CCTCCCTTCTGGAGGCTGGAGGG + Exonic
1136366203 16:29810333-29810355 CTTTCCTTCTGGAGGCTCCTTGG - Exonic
1136496468 16:30648107-30648129 CAGCCCCACTGGAGGCTGTGTGG + Intergenic
1136935746 16:34462247-34462269 CATTCTTTCTGTGGGCTATGTGG - Intergenic
1136964072 16:34886323-34886345 CATTCTTTCTGTGGGCTATGTGG + Intergenic
1137407560 16:48201858-48201880 CATCCCTCCTTGAGGCTCTGAGG + Intronic
1137474824 16:48798652-48798674 CATTCCTTCTGGAAGCTTCAGGG + Intergenic
1137941848 16:52695731-52695753 CATTCCCTCTGGAGCCTGCAAGG + Intergenic
1138211630 16:55167902-55167924 CATTCCCTTTGGAGGCTCTTGGG - Intergenic
1138430612 16:56966193-56966215 GATTCCTTCTGGGGGCTATAGGG + Intronic
1138487542 16:57356362-57356384 AGTTCTTTCTGGAGGCTCTGGGG + Intergenic
1138506983 16:57483250-57483272 CATTCCTTCTGGAGGATGGTGGG - Intronic
1138759907 16:59530932-59530954 CATTCATTCTGGTGCCTGTAGGG + Intergenic
1139246398 16:65448662-65448684 CATTCCTTCTGGAGGCATTTGGG - Intergenic
1139985540 16:70895540-70895562 CTTCCCTTCTGGAAGCTCTGGGG - Intronic
1140282376 16:73566435-73566457 GATTCCTTCTGGAGGCTCCGAGG + Intergenic
1140302326 16:73770343-73770365 GTTTCTTTCTGGAGGCTCTGTGG - Intergenic
1140338587 16:74135498-74135520 GGTTCCTTCTGAAGGCTGTGGGG + Intergenic
1140414924 16:74767700-74767722 CATTCCTTCTGGATGCTCTAGGG - Intronic
1140657166 16:77152576-77152598 TATTCCTCCTGGAGGCTCTAAGG - Intergenic
1140740163 16:77934483-77934505 TGTTCCTTCTGGAGGCTCTAGGG - Intronic
1140772336 16:78216493-78216515 ATTTCTTTCTGGAGGCTCTGGGG + Intronic
1140809650 16:78565336-78565358 TGTTCCTTCTGGAGGCTCTAGGG + Intronic
1140838906 16:78820792-78820814 CGTTCCTTCTGGAAGCTATGAGG + Intronic
1140861921 16:79025587-79025609 AGTTCCTTCTGGGGGCTCTGAGG - Intronic
1140865797 16:79061056-79061078 CGTCCCTTCGAGAGGCTGTGTGG - Intronic
1140889585 16:79273533-79273555 TGTTCCTTCTGGAGGCTGTGGGG + Intergenic
1140985461 16:80154299-80154321 TATTTCTTCTGGAGGCTCTAGGG + Intergenic
1141130357 16:81432336-81432358 GGTTCCTTCTGCGGGCTGTGGGG - Intergenic
1141159266 16:81618229-81618251 TGTTCCTTCTGGAGGCTCTCGGG + Intronic
1141195415 16:81856989-81857011 AATTCCTTCTGAAAGCTCTGGGG - Intronic
1141242666 16:82277522-82277544 GGTTCCTTCTGGAGCCTCTGAGG + Intergenic
1141268670 16:82519790-82519812 CACTCCCTCGGGAGGCTCTGGGG - Intergenic
1141374225 16:83514816-83514838 CCTTCCTTCTGGAAGTTCTGAGG - Intronic
1141417851 16:83890693-83890715 CGTTCCTTCCGGAGCCTCTGAGG + Intergenic
1141448752 16:84082178-84082200 CATGCCTTCTGCAGCCTATGTGG - Intronic
1141739186 16:85879272-85879294 ACTCCCATCTGGAGGCTGTGGGG + Intergenic
1141862736 16:86729116-86729138 TGTTCCTTCTGCAGGCTCTGGGG + Intergenic
1142302239 16:89265507-89265529 CTTCCCTTCCGGAGGCTCTGAGG - Intergenic
1142609796 17:1102648-1102670 CATTGCTTCTGGAAGCTCTAGGG - Intronic
1142738003 17:1913810-1913832 CGTTCCTTCTGGAGGCTCTCGGG - Intergenic
1142888286 17:2927044-2927066 CATTCCCTCTGTAGGCTCTAGGG + Intronic
1143666993 17:8368530-8368552 GGTTCTTTCTGGAGGCTCTGGGG - Intergenic
1143813143 17:9488693-9488715 TCTTCCTTCTGGAGGATGTAGGG - Intronic
1143981011 17:10869929-10869951 CATTCAATCTGGTGGCTGTGGGG - Intergenic
1144020029 17:11232716-11232738 GGTTCCTTCTGAAGGCTGTGAGG - Intergenic
1144028483 17:11299573-11299595 GGTTCCTTCTGGAGGCTCTAGGG + Intronic
1144047816 17:11469383-11469405 CATTCTTTCTGGAGGCTCTAGGG - Intronic
1144291790 17:13833613-13833635 CATTCCTTCTGGAGGCTCTGGGG - Intergenic
1144315428 17:14056275-14056297 TGTTCCTTCTGGAGGCTCTAGGG - Intergenic
1144395223 17:14836756-14836778 CATTCCTTCTGAAGGCTCTAGGG - Intergenic
1144520691 17:15950643-15950665 CATCCCGTCTGGCTGCTGTGTGG - Intronic
1144871581 17:18375446-18375468 CATTTATTCTGGAGGCTCTAGGG + Intergenic
1144993426 17:19249843-19249865 GGTTCCTGCTGGAGGCTCTGGGG + Intronic
1145023410 17:19449720-19449742 TATTTTTTCTAGAGGCTGTGAGG - Intergenic
1145182136 17:20762450-20762472 CATTGCCTCTGGAGGCTATAGGG - Intergenic
1146299533 17:31677452-31677474 GATTCCCTCTGGAGGCTCTGGGG + Intergenic
1147209671 17:38865105-38865127 CATTCCTTCTGTAGGCTTTAGGG - Intergenic
1147672158 17:42182784-42182806 GGTTCCTTCTGAAGGCTATGAGG + Intergenic
1147795191 17:43037163-43037185 CAGTCCCACTGAAGGCTGTGGGG - Intergenic
1148623646 17:49053148-49053170 CCCTCCTTCTGGAGGCAGTTGGG + Exonic
1148885646 17:50770517-50770539 GATTCCTTCTGGAGGCTCTGAGG + Intergenic
1148993190 17:51684240-51684262 CATTCTTTCTGGAGGCTGTAGGG - Intronic
1149324445 17:55515717-55515739 GTTTACTTCTGGAGGCTCTGAGG - Intergenic
1149624394 17:58069846-58069868 CCTTCCTGCTAGAGGCTGAGTGG + Intergenic
1149841938 17:59973002-59973024 CATTGCCTCTGGAGGCTGTAGGG - Exonic
1150375094 17:64674419-64674441 CCTTCCTTCTGGAGGTTCTAGGG - Intergenic
1150710892 17:67530027-67530049 GGTTCCTTCTGGAGGCTGTGGGG + Intronic
1150804992 17:68311730-68311752 GGTACCTTCTGGAGGCTCTGAGG - Intronic
1151011693 17:70505644-70505666 CACTCCCTCTGAAGGCTGTAGGG - Intergenic
1151178882 17:72311468-72311490 GGTTCCTTCTGAGGGCTGTGTGG - Intergenic
1151306454 17:73265713-73265735 GGTTCCTTCTGGAGGCTCTGAGG - Intergenic
1151434712 17:74087850-74087872 CGTTCCTTCTGGAGGCTTCGGGG + Intergenic
1151892703 17:76960076-76960098 CTTGCCTCCTGGAGGCTCTGTGG + Intergenic
1151991485 17:77577758-77577780 AGTTCCTTCTGGAGGCTGTAGGG + Intergenic
1152066249 17:78114139-78114161 CATTCCTCCCGGAGGCTTCGGGG + Intronic
1152137121 17:78511032-78511054 CACTCCTTCTAGAGGCTCCGGGG - Intronic
1152196725 17:78922938-78922960 AGTTCCTTCTGGGGGCTGTGAGG - Intronic
1152294985 17:79461923-79461945 GGTTCCTTCTGGAGGCTTTGAGG - Intronic
1152379245 17:79933953-79933975 CTTCCCCTCTGGAGCCTGTGCGG + Exonic
1152613076 17:81325025-81325047 GGTTCCTTCTGGAGGCTCGGAGG + Intronic
1152622369 17:81371864-81371886 GGATCCTTCTGGAGGCTCTGCGG - Intergenic
1152746004 17:82039603-82039625 CATTGCTTCCCGAGGCTTTGGGG + Intergenic
1152943996 17:83188999-83189021 TCTTCTTTCTGGAGGCTCTGGGG - Intergenic
1152970275 18:154783-154805 CATTCCTTCTAGAGGCTCTGAGG - Intergenic
1153175738 18:2371031-2371053 GGTTCCTTTTGGAGGCTCTGAGG - Intergenic
1153590983 18:6673989-6674011 CATTCTTTCTGGAGGCATTAGGG - Intergenic
1153711403 18:7803259-7803281 CATTGCTTCTGGAGGCTCTCAGG + Intronic
1153809947 18:8743547-8743569 TGTTCCTTCTGGAGGCTCTAGGG + Intronic
1154088113 18:11327234-11327256 CATTCCTTCAGGAGGCTGTAGGG - Intergenic
1154098120 18:11439840-11439862 CATTCCTTTTTGTGGCTGAGTGG - Intergenic
1154488805 18:14903061-14903083 CACTCCTTCTGGAGGCTCTTGGG + Intergenic
1155026607 18:21946312-21946334 CCTTCCTTCTGGAGGCTGCAGGG + Intergenic
1155109492 18:22699839-22699861 CATTCCTTCTGGAGGCTCCAGGG + Intergenic
1155172816 18:23279686-23279708 AATTCCTTCTGAGGTCTGTGAGG - Intronic
1155250001 18:23945256-23945278 CTTTGCTTGCGGAGGCTGTGGGG + Intronic
1155267940 18:24112086-24112108 CAAGCCCTCTGGAGGCTGTGGGG + Intronic
1155288680 18:24319151-24319173 CATTCCTTCTGGAGGCTCTAAGG + Intronic
1155361806 18:25010593-25010615 GATTCCTTCTGAAGGCTCTAGGG - Intergenic
1155498352 18:26464221-26464243 CCTTCCTTCTGGAGGCTCTGGGG + Intronic
1155927653 18:31674028-31674050 CAGTCCCTCTGGAGGCTCTGGGG - Intronic
1156093064 18:33494655-33494677 GATTCCTTCTGGAGGCTCCTAGG + Intergenic
1156834039 18:41530950-41530972 GATTCCTTCTGAACACTGTGAGG - Intergenic
1157445492 18:47743542-47743564 GATTCTTCTTGGAGGCTGTGAGG - Intergenic
1157502097 18:48198487-48198509 TATTCCTTCTGGAGACTCTCAGG + Intronic
1157717961 18:49902151-49902173 CATTCTTTCTGGACGCTCTAGGG + Intronic
1157846969 18:51013076-51013098 GGTTTCTTCTGGAGGCTCTGAGG + Intronic
1157884683 18:51355150-51355172 CGTTCATTCTGGAGGCTCTAGGG - Intergenic
1157974440 18:52310791-52310813 GATTCCTGCTGGAGGCTCTGAGG + Intergenic
1158222781 18:55167342-55167364 TGTTCCTTCTGGAGGCTCTGGGG + Intergenic
1158460568 18:57642839-57642861 CGTTCCTTCTGGTGGGTTTGTGG + Intergenic
1158483354 18:57842645-57842667 GGTTCCTTCTGGAGGCTGTTGGG + Intergenic
1158500595 18:57997277-57997299 CATTGCTTCTGCAGGCTCTCAGG + Intergenic
1158619819 18:59023270-59023292 GGTTCCTTCTGGAGGCTCTGAGG + Intergenic
1158948360 18:62467758-62467780 GTTTCCTTCTGGAAGCTCTGAGG + Intergenic
1159008949 18:63040308-63040330 GGTTCCTTCTGGGGACTGTGAGG + Intergenic
1159248096 18:65836106-65836128 CATTCTTTCTGGAGGCTTCGGGG - Intronic
1159373936 18:67566688-67566710 GGTTCCTTCTGGAGGCTCTAGGG - Intergenic
1159424872 18:68272220-68272242 TGTTCCTTCTGGAGGCTCTGAGG - Intergenic
1159462835 18:68742145-68742167 GATTCCTCCTGGAGGCTCTGAGG + Intronic
1159680268 18:71341604-71341626 GGTTCCTTCTGAAGGCTGAGAGG + Intergenic
1159776335 18:72607176-72607198 GGTTCCTTCTGAGGGCTGTGAGG - Intronic
1159801398 18:72904619-72904641 GATTCCTTCTGGAAGCGCTGAGG - Intergenic
1159846579 18:73468173-73468195 GGTTCCTTCTGGAAGCTCTGAGG - Intergenic
1159988785 18:74877320-74877342 CTTTCATTGCGGAGGCTGTGAGG - Exonic
1160139386 18:76307543-76307565 CCTTCCTTCTGGAGGCTCTAGGG + Intergenic
1160238656 18:77106404-77106426 CAATCCTTCCAGTGGCTGTGGGG - Intronic
1160245883 18:77159057-77159079 CCTTCCCTCTGAAGGCTCTGAGG - Intergenic
1160503363 18:79413380-79413402 CTGTTCTTTTGGAGGCTGTGAGG + Intronic
1160682816 19:419580-419602 GGTTCCTTCCGGAGGCTCTGAGG - Intronic
1160835672 19:1123432-1123454 CATTCCCTCTGTGGGCTGTGCGG + Intronic
1161018728 19:1997563-1997585 CATGCCTGCTGGAGGCTGGCAGG - Intronic
1161066734 19:2242323-2242345 CATTCCTTCTGGAGGCTCTGGGG + Intronic
1161096259 19:2393307-2393329 CATTCCTCCTGGTGGGTTTGTGG - Intronic
1161761927 19:6179993-6180015 CATTCCTTCTAGAGGCTCTTGGG + Intronic
1161763442 19:6191486-6191508 GGTTCCTTCTGAGGGCTGTGAGG + Intronic
1161874052 19:6893870-6893892 CGTTCCTTCTGGATGCTGTACGG + Intronic
1162263192 19:9548900-9548922 CATTCCTCCTGGTGGGTTTGTGG - Intergenic
1162567094 19:11450640-11450662 CATGCCTTCTTGAGGTTCTGGGG - Exonic
1163330814 19:16636273-16636295 GGTTCCTTCTGGAGGCTCTCAGG - Intronic
1163369047 19:16891925-16891947 GGTTCCCTCTGGAGGCTGTGAGG - Exonic
1163400301 19:17088122-17088144 CACTCCCTCTGGAGGCTCTACGG + Intronic
1163475289 19:17522411-17522433 GGTTCCCTCTGGAGGCTCTGAGG + Intergenic
1163623672 19:18375581-18375603 GGTTCCTTCTGGAGGCTGTCAGG + Intronic
1163749775 19:19069509-19069531 GGTTCCTTCTGGAGGCTCTGAGG + Intronic
1164754757 19:30681354-30681376 CACTCCTGCTGGAGCCAGTGTGG + Intronic
1164828768 19:31303927-31303949 AAGTCCTTGTGGAGGGTGTGTGG - Intronic
1165538274 19:36468663-36468685 CAGCCCTTCTGGAGCCTGAGTGG + Intronic
1165671862 19:37686768-37686790 GAATCCTTCTGGAAGCTCTGTGG - Intronic
1165882705 19:39054792-39054814 CCTGCCTTCTGGAGGCTCGGGGG + Intergenic
1165909340 19:39215187-39215209 CCTTCCTTCTGGAGGCTCCAGGG + Intergenic
1166032791 19:40145698-40145720 GATTCTTTCTGGAGGCACTGAGG + Intergenic
1166530326 19:43538939-43538961 CAATCCTTCTGGAGGCTCTAAGG - Intergenic
1166530716 19:43541701-43541723 CGTTCCTTCTGGAGGCTTGAGGG - Intergenic
1166534002 19:43560578-43560600 TGTTCCTTCTGGAGGCTCTAGGG - Intronic
1166864759 19:45829116-45829138 CCTTCATCCTGGAGGATGTGCGG - Exonic
1167012682 19:46819266-46819288 CATCCCTTCTGGAGACTCTAGGG - Intergenic
1167180738 19:47901532-47901554 CATTCCCTCTGGAGGCTCTGGGG - Intergenic
1167192468 19:48001016-48001038 CATTCCTTCTGGAGGCTGTAGGG + Intronic
1167529019 19:50003223-50003245 GATTCCTTCTGGAGGCCGGAGGG - Intronic
1167533500 19:50033702-50033724 CGTTCCTTCTGGAGGCCCTAGGG + Intronic
1167625945 19:50589335-50589357 CATTTCTTCTGGAGGCTCTAGGG - Intergenic
1167683611 19:50941658-50941680 GGTTCCTTCTGGAGGCTCTAGGG + Intergenic
1167709415 19:51100697-51100719 CCTTTCTCCTGGAGGCTCTGGGG - Intronic
1167751708 19:51384626-51384648 AGTTCCTTCTGAGGGCTGTGAGG - Intronic
1167850861 19:52200665-52200687 GGTTCCTTTTGGAGGCTCTGAGG + Intronic
1168180389 19:54658729-54658751 CCTCCCTTCTGGCTGCTGTGTGG + Intronic
1168235558 19:55060998-55061020 GGTTCCTTCTGGAGGCTCTAGGG + Intronic
1168276476 19:55281359-55281381 CATCACTTCTGGAGGCTCTCGGG + Intergenic
1168372057 19:55844132-55844154 AATTTCTTCTGAAGACTGTGAGG + Intronic
1168646895 19:58065147-58065169 CATTCCTTCTGGAGGCTCTAGGG + Intronic
925183202 2:1830330-1830352 CATTTCTTCAGGCTGCTGTGAGG + Intronic
925340081 2:3130171-3130193 CCTTCCTTCTAGAGGCCCTGGGG + Intergenic
925497244 2:4465832-4465854 CTTCCCTTCTGGAGGCTGTATGG - Intergenic
925601474 2:5612417-5612439 AATTCCTTCTGCAGGCTCTGAGG - Intergenic
925621329 2:5796058-5796080 CATTCCTTTTTATGGCTGTGTGG + Intergenic
925809455 2:7684969-7684991 GGTTCCTTCTGAGGGCTGTGAGG + Intergenic
926050848 2:9743836-9743858 CATTCCCTGTGGCTGCTGTGAGG - Intergenic
926420752 2:12694632-12694654 CATTCCTTCTCCTGGCTCTGTGG - Intergenic
926572543 2:14545097-14545119 CATCCCTTCTGGAGGCTCTAAGG - Intergenic
926580685 2:14631052-14631074 CACTGCATTTGGAGGCTGTGGGG + Intergenic
927294880 2:21442358-21442380 CATTATTTCTGGTGACTGTGTGG - Intergenic
927370248 2:22346260-22346282 CATTCCTGCAGGAAGCTGTTTGG - Intergenic
927433194 2:23044261-23044283 CACTCCTTCTGGGGGCTCTAGGG - Intergenic
927479706 2:23442570-23442592 TGTTCCTTCTGGAGGCTCCGGGG - Intronic
927520698 2:23696318-23696340 CATCCCACCTGGAGGCAGTGTGG - Exonic
927676759 2:25111862-25111884 CATTCCTTCTGGGGGTTCTGGGG - Intronic
928100309 2:28433248-28433270 CATTTCTTCTGGAGGCTCCAGGG - Intergenic
928416419 2:31095971-31095993 CGTTCCTTCTAGAGGCTCTTAGG + Intronic
928493294 2:31805351-31805373 GGTTCCTTCTGGAGGCTCTGAGG - Intergenic
928564735 2:32533784-32533806 CATTGCTTCTGGAGGCTCTTAGG - Intronic
928600260 2:32897517-32897539 CACTCCTTCTGGAGGCTTTTGGG - Intergenic
928984424 2:37166935-37166957 CATGCCTACTTGAGGCTCTGTGG + Intergenic
929136577 2:38629889-38629911 CATTCTTCCTGGAGGCTCTAGGG + Intergenic
929240647 2:39650001-39650023 TATTCCTTCTGGAGTCTCTTAGG + Intergenic
929397031 2:41534745-41534767 GATTCCTTCCGGAGGCACTGAGG - Intergenic
929953065 2:46431640-46431662 CTGCCCTGCTGGAGGCTGTGGGG - Intronic
930322479 2:49874024-49874046 CATTCTTTCTTGAGGCTCTAAGG - Intergenic
930331999 2:49996734-49996756 CATTCCTTCTGGAGGCTTTAGGG - Intronic
930776918 2:55182035-55182057 CATTCCTTCTGGAGGCTCTAAGG - Intronic
930800367 2:55437600-55437622 TATTCCTTCTGGAGGTTCTGAGG - Intergenic
930966552 2:57335623-57335645 CCTTCCTTCTGGTGGGTTTGTGG - Intergenic
930968207 2:57358601-57358623 TGTTCCTTCTGGAGGCTCTGAGG - Intergenic
931095766 2:58939004-58939026 CCTTTCTTCTGGAGGCTGTTGGG - Intergenic
931321590 2:61178138-61178160 CATCCCTTCCGGAGGTTCTGCGG - Exonic
931946452 2:67313778-67313800 CTTGCCATCTGGAGGTTGTGTGG - Intergenic
932263695 2:70347947-70347969 GATTCCTTCTGGAGGCTCTAGGG + Intergenic
932373044 2:71208887-71208909 CTTTCCTTCTGGAGGCTCTAGGG - Intronic
932416769 2:71578327-71578349 CATTCCTGCTGGGAGGTGTGTGG + Intronic
932449583 2:71800853-71800875 CATCCCCACTGGAGGCTTTGGGG - Intergenic
932602214 2:73135558-73135580 CGTTCCTTCTGGAGGCTCTGGGG + Intronic
933027584 2:77280269-77280291 CATTTCTTCGGGAGGCTCTAGGG - Intronic
933071978 2:77870671-77870693 TGTTTCTTCTGGAGGCTCTGGGG + Intergenic
933319511 2:80756121-80756143 CATTCTTTCTAGTGGCTGTGTGG + Intergenic
933605120 2:84374663-84374685 GGTTCCTTCTGAGGGCTGTGAGG - Intergenic
934732746 2:96669715-96669737 CTTCCCTGCTGGAGGCTGTGTGG - Intergenic
935012110 2:99145089-99145111 CATTCCTTCTGGAGGCTCTAGGG + Intronic
935072851 2:99711070-99711092 AATTGCATCTTGAGGCTGTGAGG - Intronic
935185190 2:100725385-100725407 CAGTCCTTCTGGACTCAGTGGGG + Intergenic
935374021 2:102377266-102377288 CTTTACTTCTGGAGGCTGTAGGG + Intronic
935391592 2:102558842-102558864 CAATCCTTCTGGAGGCTCTAAGG - Intergenic
935403099 2:102680957-102680979 TTTTCCTTCTGGAGGCTCTAGGG - Intronic
935679598 2:105624567-105624589 TGTTCCTTCTGGAGGCTCTAGGG + Intergenic
935795287 2:106635034-106635056 GGTTCCTTCTGAGGGCTGTGAGG - Intergenic
936593797 2:113828666-113828688 CATTCCTTCTGGAGGCTCTGGGG + Intergenic
936662652 2:114559407-114559429 CATTCCTTCTGGAATCTCTAAGG - Intronic
936865240 2:117070725-117070747 CATTCCTTCTGGCGGGTTCGTGG + Intergenic
937065995 2:119018139-119018161 CGTTCCTTCTGGAGGCTCTTGGG - Intergenic
937113317 2:119384375-119384397 TGTTCCTTCTGGAGGCTGTAGGG - Intergenic
937230394 2:120395200-120395222 CATTCCTTTTGGAGACAGTCAGG - Intergenic
937280402 2:120713656-120713678 GGCTCCTTCTGCAGGCTGTGAGG + Intergenic
937530654 2:122823310-122823332 CCTTCTTTCTGGAGGCTCTAGGG - Intergenic
937638486 2:124184869-124184891 CATTTCCTCTGAAGACTGTGGGG + Intronic
938121693 2:128638568-128638590 ATTTCTTTCTGGAGGCTCTGGGG - Intergenic
938722630 2:134079919-134079941 CATTTCTTCTGGAGGCCATAAGG + Intergenic
938801757 2:134770382-134770404 CATTCTTTCTGGAGGCTCTAAGG + Intergenic
938989907 2:136617057-136617079 GGTTCCTTCTGAGGGCTGTGAGG + Intergenic
939194631 2:138956675-138956697 GGTTCCTTCTGGAGGCTCTGAGG + Intergenic
939233762 2:139464976-139464998 CATTCCTTCTGAAGGCTCTAAGG - Intergenic
939778898 2:146419884-146419906 CATTCCTTCTGAAGGCTCTAGGG + Intergenic
940041130 2:149362046-149362068 CATTCCTTATGGAGGCTCTAAGG - Intronic
940129351 2:150363379-150363401 GGTTCCTTCTGAAGGCTATGAGG - Intergenic
940274126 2:151921549-151921571 TGTTCCTTCTGGAGGCTCTAAGG + Intronic
940411383 2:153367606-153367628 TTGTCCTTCTGGAGGCTCTGAGG - Intergenic
940649542 2:156427826-156427848 CACTCCTTCTGGAGACTCTAGGG + Intergenic
940699102 2:157019607-157019629 TTTTCTTTCTGGAGGCTGTGGGG - Intergenic
940897500 2:159094813-159094835 CTTTCCTCCTAGAGGCTGTGTGG - Intronic
941165763 2:162081481-162081503 TGTTCCTTCTGGAGGCTCTAGGG - Intergenic
941195789 2:162449716-162449738 GTTTCCTTCTGGAGGTTCTGAGG - Intronic
941348135 2:164395862-164395884 CATGCTTTTTGGAGGCCGTGTGG + Intergenic
941451301 2:165664008-165664030 CATCCCTCCTGGTGACTGTGTGG + Intronic
941468479 2:165857212-165857234 CCTTCCTTCTGCAAGCTGTAGGG - Intergenic
941589031 2:167395504-167395526 TATTCTTTCTGGAGGTTCTGGGG - Intergenic
941664650 2:168232274-168232296 CTTTCCTTCAGGGGGATGTGTGG - Intronic
941874272 2:170417592-170417614 GGTTCCTTCTGGAGGCTCTGAGG + Intronic
942073387 2:172335397-172335419 GGTTCCTTCTGGAGGCTCTGAGG + Intergenic
942323855 2:174759009-174759031 GGTTCCTTCTGAGGGCTGTGAGG - Intronic
942330725 2:174821210-174821232 CATTTCTTCTGGAGGCTTAGGGG + Intronic
942351899 2:175061454-175061476 TGTTCCTTCTGGAGGCTCTGGGG - Intergenic
942414039 2:175739575-175739597 CACTCCTTCTGGAGGCCCTAGGG - Intergenic
942540356 2:177008945-177008967 CCTTCCTTCTGGTGGGTTTGTGG - Intergenic
942770627 2:179514150-179514172 CATTCCTTCTGGAGGCTTTAAGG + Intronic
942791516 2:179766501-179766523 GGTTCCTTCTGAGGGCTGTGAGG + Intronic
943375923 2:187076422-187076444 CATTCCTTCTGCAGGCTCTAGGG - Intergenic
943474935 2:188342241-188342263 GGTTTCTTCTGGAGGCTCTGAGG + Intronic
943621623 2:190154838-190154860 CAGACCTACTGCAGGCTGTGAGG + Intronic
943778372 2:191793224-191793246 CATTCCTTCTGGAGCCTCCAGGG + Intergenic
943922342 2:193725139-193725161 TATTCCTTGTAGAGGCTCTGAGG + Intergenic
943942878 2:194021229-194021251 CATTCCTCCTGGTGGGTTTGTGG - Intergenic
944068687 2:195646524-195646546 CGTTTCTTCTGGAGGCTCTAAGG + Intronic
944150118 2:196548768-196548790 GGTTCCTTCTTGGGGCTGTGAGG + Intronic
944278877 2:197871592-197871614 GGTTCCTTCTGGAGGCTCTGAGG + Intronic
944463089 2:199972576-199972598 CGTTCCTTCTAGAGGCTCTGGGG - Intronic
944466699 2:200008536-200008558 TATTCCTTCTGGAGGCTCTGGGG - Intronic
944484645 2:200192299-200192321 TTTGCTTTCTGGAGGCTGTGGGG + Intergenic
944606128 2:201352964-201352986 CATTCCTTCCGGAGGCTCCAGGG - Intronic
944876876 2:203971420-203971442 CAGTCCTTCTGGAGGCTCCAGGG + Intergenic
945197369 2:207249924-207249946 GGTTCCTTCTGAGGGCTGTGAGG - Intergenic
945325535 2:208478345-208478367 CCTTCCTTCTGGAGGTGCTGGGG + Intronic
945547066 2:211168660-211168682 AATTTCTTCTGGAGGATTTGGGG - Intergenic
945831838 2:214796561-214796583 GGTTCCTTCTGTGGGCTGTGAGG - Intronic
945892777 2:215447805-215447827 GGTTCCTTCTGAAGGTTGTGAGG - Intergenic
945974714 2:216261252-216261274 GGTTCTTTCTGGAGGCTTTGAGG + Intronic
945990979 2:216395118-216395140 GGTTCCTTCTGAGGGCTGTGAGG - Intergenic
946493769 2:220175233-220175255 CATTTCTTCTTTAGGCTCTGGGG + Intergenic
946636171 2:221730108-221730130 CATTCTTTGTTGTGGCTGTGTGG - Intergenic
946707539 2:222473268-222473290 TATTTCTTCTGGAGGCTGGAGGG + Intronic
946807020 2:223481164-223481186 ATTCCTTTCTGGAGGCTGTGGGG - Intergenic
947032029 2:225807180-225807202 GGTTCTTTCTGGAGGCTCTGAGG - Intergenic
947432698 2:230044638-230044660 AATTCCTTCTTGAGGCTTTAGGG - Intronic
947923936 2:233904594-233904616 CGTTCCTTCTGCAGGCTCTAAGG + Intergenic
947932195 2:233973338-233973360 GACTCCCTCTGGAGGCTGTGCGG + Intronic
947979031 2:234393140-234393162 CACTCCCTCTGGAGGCTTTAGGG + Intergenic
947989812 2:234477750-234477772 GGTTCCTTCTGGAGGTTCTGGGG - Intergenic
948002841 2:234582299-234582321 GGTTCCTTCTGGAGGCTCTGAGG + Intergenic
948024168 2:234763842-234763864 CATTCATTCTGAGGGCTGGGAGG + Intergenic
948095052 2:235326910-235326932 CGTTCCTTCTGGAGGCTTTCAGG - Intergenic
948121018 2:235530498-235530520 CGTTCCTTCTGCAGGCTCTAGGG + Intronic
948128834 2:235585237-235585259 TGCTCCTTTTGGAGGCTGTGGGG + Intronic
948254571 2:236556600-236556622 CCTTCCTTCTGGAGGCTTTGGGG - Intergenic
948273532 2:236691655-236691677 GGTTCCCTCTGGAGGCTCTGGGG - Intergenic
948371902 2:237494984-237495006 CATTCCAGCTGGAGGCTGGAGGG + Intronic
948398062 2:237662077-237662099 GGTTCCTTCTGGAGGCTCTGAGG + Intronic
948419963 2:237851971-237851993 CATTCCTTCTGGAAGCTCTAGGG - Intergenic
948434954 2:237946834-237946856 CATTCCTTCTGGAGGCTTCAGGG + Intergenic
948489958 2:238306261-238306283 TAATCCTTCTGGAGGCTCTAGGG - Intergenic
948527715 2:238582392-238582414 CATTCCTTCCAGAGGCTTTAGGG + Intergenic
948536959 2:238653618-238653640 CATTCCTTCTGGAGGCCCTAGGG - Intergenic
948652658 2:239458145-239458167 GATTCCTTCTGGAGGTTCCGAGG + Intergenic
948698840 2:239748093-239748115 CTTTCCTTCTGCAGCCTCTGAGG + Intergenic
948704769 2:239782068-239782090 GGATTCTTCTGGAGGCTGTGAGG - Intronic
948784581 2:240345709-240345731 GGTTCCTCCTGGGGGCTGTGGGG + Intergenic
948896184 2:240928856-240928878 CATGCCCTCTGGAGGGTGTATGG + Intronic
1169389457 20:5177789-5177811 AATTCCATCTGGAGGCTGGGAGG - Intronic
1169578263 20:6990431-6990453 CCCTCCTTCCGGAGGCTCTGGGG - Intergenic
1169659969 20:7967694-7967716 CATTCCTTCTGGAGGCTTCAGGG - Intergenic
1169804675 20:9547226-9547248 GATTCCTTCTGGAAGCTCTGAGG - Intronic
1169809852 20:9598290-9598312 CATTCCTTTTTATGGCTGTGTGG + Intronic
1170402417 20:16002654-16002676 TGTTCCTTCTTGAGGCTCTGGGG - Intronic
1170513273 20:17101433-17101455 CACTCCTTCTGAAGGCTCTAGGG - Intergenic
1170594268 20:17793530-17793552 GGTTCCTTCTGGAGGCTCTAGGG - Intergenic
1170641368 20:18156641-18156663 GGTTCCTTTTGAAGGCTGTGAGG + Intronic
1170758894 20:19231604-19231626 CATTCCTACTGGAAGCTCTTGGG - Intronic
1170971595 20:21122089-21122111 CGTTCTTTCTGAGGGCTGTGGGG - Intergenic
1171395434 20:24829874-24829896 TGGTCCTTCTGGAGGCTCTGGGG - Intergenic
1172018513 20:31895734-31895756 CATTCCTTTTGGAGGCTCTATGG - Intronic
1172049101 20:32102735-32102757 CATTCTTTTTGGAGGCTCTAGGG + Intergenic
1172361515 20:34316060-34316082 GGTTCCTTCTGGAGGCTCTGAGG - Intergenic
1172588026 20:36098430-36098452 GGCTCCTTCTGGAGGCTCTGGGG + Intronic
1172638856 20:36428801-36428823 CATTCTCTCTGGAGGCTCTAGGG + Intronic
1172786351 20:37471356-37471378 GATTCCTTCTGGGGGCTGTGAGG - Intergenic
1172908945 20:38391630-38391652 CATTCCTTCAGGAAGCTCTGGGG + Intergenic
1173000752 20:39103865-39103887 CACTCCCTCTGGAGGCTGTAGGG + Intergenic
1173044889 20:39500631-39500653 CTTTCCTTCTGCAGGCATTGTGG - Intergenic
1173052345 20:39575575-39575597 CATTCCTTCTGGAGGCTCCAGGG - Intergenic
1173153593 20:40588734-40588756 TGTTCCTTCTGGAGGCTCTAGGG + Intergenic
1173190753 20:40873939-40873961 CCTTCCTTCTGGAGGATCTAGGG - Intergenic
1173204899 20:40985192-40985214 CATTCTTCCTGGAGGCTCTAGGG + Intergenic
1173242768 20:41312507-41312529 CATTCCTTCTGGTAGGTCTGTGG - Intronic
1173281986 20:41636874-41636896 TATTCCTTCTGGAGGCTGTAGGG - Intergenic
1173428313 20:42961998-42962020 CATTCCTTCTGGAGGCTGTAGGG - Intronic
1173474928 20:43352238-43352260 CATTCCTTCTGGAGACTCTAGGG - Intergenic
1173488006 20:43455832-43455854 CGTTCTTTCAGGAGGCTCTGGGG + Intergenic
1173572222 20:44084866-44084888 GGGTCCTTCTGGAGGCTCTGAGG - Intergenic
1173823037 20:46030835-46030857 CATTCCTCCTGGGGGCTGAGTGG + Intronic
1174092452 20:48059956-48059978 CATTCCTTCTGGTGGGTTCGTGG - Intergenic
1174098251 20:48106673-48106695 CATTCCTTCCAGAGGCTCTAAGG - Intergenic
1174329817 20:49809095-49809117 CATTCATTCTGGAGGCCCTACGG - Intergenic
1174466539 20:50722056-50722078 GGTTCCTTCTGGAGGCTCTGAGG - Intergenic
1174552882 20:51374328-51374350 CCTTCCTTCTGGAGGCTCTAGGG + Intergenic
1174554174 20:51382319-51382341 CGCTCCTTCTGGGGGCTCTGGGG - Intergenic
1174661310 20:52215461-52215483 GAATCGTTCTGGAGGCTCTGGGG - Intergenic
1174661318 20:52215485-52215507 CATTCCTTCTGGAGGCTCTGGGG - Intergenic
1174734343 20:52951042-52951064 CATTCCTTCTGTGGTCTGTGTGG - Intergenic
1174907130 20:54563142-54563164 GGTTCCTACTGGAGGCTGTGAGG - Intronic
1174956051 20:55099855-55099877 CATTCATTCTGGAGACTCTAGGG - Intergenic
1175113937 20:56668432-56668454 CTTTCCCTCTGAAGGCTCTGGGG - Intergenic
1175162242 20:57017633-57017655 CTTTCCCTCTGAAGGCTGTTGGG - Intergenic
1175172529 20:57090527-57090549 CATCCCTTCCTGAGGCTTTGGGG - Intergenic
1175175168 20:57107218-57107240 TGTGCCTTCTGGAGGCTCTGAGG + Intergenic
1175231213 20:57474558-57474580 CACTCCTTCTGGAGGTTATGGGG - Intergenic
1175334265 20:58184952-58184974 CATCCCTTCTGGAGGCTCTGGGG - Intergenic
1175525299 20:59629508-59629530 GGTTCCTTCTGAGGGCTGTGAGG + Intronic
1175608400 20:60330171-60330193 GGTTCCTTCTGGGGGCTTTGAGG - Intergenic
1175820137 20:61904639-61904661 CCGTTCTTCAGGAGGCTGTGGGG - Intronic
1175921249 20:62451468-62451490 TCATCCTTCAGGAGGCTGTGAGG - Intergenic
1176430382 21:6571733-6571755 TGTTCCCTCTGGAGGCTCTGGGG + Intergenic
1176893877 21:14352204-14352226 GATTCCTTCTGGAGGCTTTGAGG + Intergenic
1176922322 21:14703303-14703325 CATTCCTTCAGAACCCTGTGGGG + Intergenic
1176932827 21:14833310-14833332 GATTCCTTCTGAGGGCTGTGAGG + Intergenic
1176981841 21:15391106-15391128 CATTCCTTTTTATGGCTGTGTGG + Intergenic
1177163342 21:17573071-17573093 GGTTCCTTCTGAGGGCTGTGAGG + Intronic
1177330034 21:19647350-19647372 TTTTCCTTCTGGAGGCTCTAGGG + Intergenic
1177377665 21:20294314-20294336 CATTCATTCTTGAGGCTCTGGGG + Intergenic
1177418456 21:20825125-20825147 GGTTCCTTCTGGAGTCTCTGAGG - Intergenic
1177548783 21:22594360-22594382 GGTTCCTTCTATAGGCTGTGAGG + Intergenic
1177686935 21:24449231-24449253 CATTCCTTCTGGAAGAGGTAGGG + Intergenic
1177783494 21:25644366-25644388 CATTCCTTCTGGAGGTTCTAGGG + Intronic
1177801991 21:25836922-25836944 GGTTCATTCTGGAGGCTCTGAGG + Intergenic
1177934569 21:27327808-27327830 GTTTCCTTCTGAAGGCTGTGAGG - Intergenic
1178019096 21:28389007-28389029 CATTCCCTCTGGAGACTCTACGG + Intergenic
1178065150 21:28896286-28896308 TGTTCCTTCTGGAGGCTCTTGGG - Intergenic
1178152114 21:29807267-29807289 CCTTCCCTGTGGCGGCTGTGGGG + Intronic
1178170464 21:30034423-30034445 TGTTCCCTCTGGAGGCTGTCAGG - Intergenic
1178181006 21:30161556-30161578 AGTTCCTTCTGAAGGTTGTGAGG + Intergenic
1178544193 21:33479717-33479739 CCGGCCTTCTGGGGGCTGTGGGG - Intronic
1178694523 21:34781409-34781431 GATTCCTTCTGAAGGATCTGAGG - Intergenic
1178804120 21:35824247-35824269 TGTTCCTTCTAGAGGCTCTGGGG - Intronic
1178817645 21:35946289-35946311 GTTTCCTTCTGAGGGCTGTGAGG - Intronic
1179036258 21:37760852-37760874 CATACATTCTGGAGGCGGGGTGG + Intronic
1179076720 21:38129174-38129196 GGTTCCTTCTGGGGGGTGTGAGG - Intronic
1179104919 21:38390638-38390660 CGTTCCTTCTCAGGGCTGTGAGG - Intronic
1179114801 21:38480390-38480412 GGTCCCTTCTGGAGGCTGTGAGG - Intronic
1179179964 21:39036541-39036563 CATTCCCTCTGCAGGCTCTAGGG - Intergenic
1179227082 21:39463966-39463988 GGTTCCTTCTGAAGGCTCTGAGG + Intronic
1179257135 21:39726773-39726795 CATTCCTCCTGGAGGCCCTCAGG - Intergenic
1179312959 21:40213002-40213024 GGTGCCTTCTGGAGGCTCTGAGG - Intronic
1179407137 21:41135704-41135726 CATCTCTTTTGGATGCTGTGCGG + Intergenic
1179487229 21:41718091-41718113 GGTTCCTCCTGGAGGCTCTGGGG + Intergenic
1179705776 21:43179195-43179217 TGTTCCCTCTGGAGGCTCTGGGG + Intergenic
1179714027 21:43278654-43278676 CCTTCCTCCTGGGGTCTGTGGGG - Intergenic
1179799536 21:43804496-43804518 CACACCTGCTGGAGCCTGTGAGG + Exonic
1180128788 21:45811301-45811323 CATCCCTTCTGGAGGCTCACGGG + Intronic
1180134345 21:45852316-45852338 TGTTCCTTCTGAAGGCTTTGGGG - Intronic
1180137922 21:45873128-45873150 CTTTACCTCTGGGGGCTGTGGGG + Intronic
1180786367 22:18549934-18549956 GAAGCCATCTGGAGGCTGTGAGG + Intergenic
1181131647 22:20735660-20735682 GAAGCCATCTGGAGGCTGTGAGG + Intronic
1181243287 22:21489487-21489509 GAAGCCATCTGGAGGCTGTGAGG + Intergenic
1181887285 22:26031388-26031410 AATTCCTTCTGAGAGCTGTGAGG + Intergenic
1181899565 22:26142046-26142068 CAGTCCCTCTGGAGGCTGGCTGG - Intergenic
1181911633 22:26242966-26242988 GATTCCTTCTGGAGGTTCTGAGG + Intronic
1182245166 22:28951524-28951546 GATTCCTTATGGGGGCTATGAGG - Intronic
1182775739 22:32829770-32829792 CCTTCCTTCTGGAGGAGCTGTGG - Intronic
1182919908 22:34069701-34069723 GGTTCCTTCTGGAGGCTCTGAGG + Intergenic
1183436107 22:37796344-37796366 CATTTCTTCTGCAGGCTCTAAGG + Intergenic
1183514922 22:38259626-38259648 TACTCCTTCTGGAGGCTCTGGGG - Intronic
1183866604 22:40709282-40709304 GGTCCCTTCTGGAGGCTCTGAGG + Intergenic
1184096156 22:42317633-42317655 CATTCCCGCTGGGGGCTGGGGGG + Intronic
1184138328 22:42562409-42562431 GGTTCCTTCTGAGGGCTGTGAGG + Intronic
1184393978 22:44221819-44221841 GATTCCTTCTGGAGGCTCTGAGG + Intergenic
1184489941 22:44802690-44802712 CACTCCCCCTGGAGGCTGCGGGG + Intronic
1184495745 22:44840304-44840326 CATTTTTTCTGGAGGTTCTGGGG + Intronic
1184821816 22:46915182-46915204 CATTCATTCTGGCAGCTGCGTGG + Intronic
1184951498 22:47845878-47845900 GATTCCTTCTGGAGGCTCCAGGG + Intergenic
1185188706 22:49418928-49418950 CACTCCTTCTGGAGGCTCTAGGG + Intronic
949092243 3:42037-42059 CAGTCCTTCTGGAGGCTGTAAGG + Intergenic
949167520 3:959922-959944 GATTCCTTCTGGGGACTATGAGG - Intergenic
949320261 3:2802222-2802244 CAATCCTTTTGGAGTCTTTGTGG + Intronic
949331910 3:2932490-2932512 CACTCATTCTGGAGGCTCTAGGG + Intronic
949362175 3:3243619-3243641 CACTCCCTCTGGAGGCTATGTGG - Intergenic
949383401 3:3470638-3470660 CATACATTCTGGATGCTGTGTGG - Intergenic
949398038 3:3635907-3635929 CATTCTTGCTGGAGCCTGTTGGG - Intergenic
949426556 3:3923443-3923465 GGTTACTTCTGAAGGCTGTGGGG - Intronic
949527079 3:4915634-4915656 GGTTCCTTCTGAAAGCTGTGAGG + Intergenic
949592769 3:5510864-5510886 CTTTCCTTCTGGTGGTTCTGAGG + Intergenic
949708232 3:6843117-6843139 CATGCCCTCTGGGGGCTTTGAGG + Intronic
949890011 3:8726676-8726698 CATTCCTTCTGGAGGTTCTAGGG - Intronic
949907085 3:8866657-8866679 CATTCCCTCTGGAGGCTCTAGGG - Intronic
950068801 3:10135736-10135758 TGTTCCTTCTGGTGGCTGCGTGG + Intergenic
950132145 3:10554573-10554595 CATTCCTTCTGGAGGCTGCGGGG - Intronic
950817607 3:15722806-15722828 GGTTCCTTATGGAGGCTCTGAGG - Intronic
950844446 3:16000892-16000914 GGTTCCTTCTGATGGCTGTGAGG + Intergenic
950995516 3:17492314-17492336 CATTCATTCTGGTAGCTTTGGGG + Intronic
951051366 3:18097621-18097643 CATTCCTTCTGGATGCTCTAGGG + Intronic
951212831 3:19994202-19994224 CATTTTTTCTGTAGTCTGTGTGG - Intronic
951220693 3:20066072-20066094 CACTCCTTTTGAAGGCTGTAGGG + Intronic
951415609 3:22418161-22418183 CATTCCTCCTGGTGGGTTTGTGG - Intergenic
951551253 3:23877455-23877477 CATTCTTTGTGGGGGCTGTCTGG + Intronic
951563603 3:23990846-23990868 GGTTCCTTCTGAGGGCTGTGAGG + Intergenic
951627278 3:24679776-24679798 GGTTCCTTCTGAGGGCTGTGAGG + Intergenic
951787832 3:26442612-26442634 CATTCCTTCTGGAGGCTCTGAGG + Intergenic
951820067 3:26798409-26798431 GGTTCCTTCTGGAGGCTCTGAGG - Intergenic
952025341 3:29073967-29073989 TATTCCTTCTGGAGGCTCTAAGG + Intergenic
952076452 3:29702624-29702646 CATTCCTCCTGGTGGGTTTGTGG - Intronic
952457246 3:33484795-33484817 CCTTCCTTCTGGAGGCTCTAGGG + Intergenic
952478113 3:33732092-33732114 TTTTCCTTCTGGAGGCTCTGAGG - Intergenic
952568019 3:34681485-34681507 CATTTGATCTGGAGGCTGTAGGG + Intergenic
952728724 3:36617280-36617302 CTCTCCTTCTGGAGCCTCTGGGG - Intergenic
952766204 3:36956436-36956458 CATTCTTTCTGAGGGCTCTGAGG - Intergenic
953028881 3:39163267-39163289 GTTTCCTTCTGGACACTGTGAGG + Intergenic
953450874 3:43004927-43004949 AGTTCTTTCTGGAGGCTCTGGGG + Intronic
953551051 3:43903367-43903389 TGTTCCTTCTGGAGGCTCTAGGG - Intergenic
953756196 3:45647832-45647854 CAGCACTTCGGGAGGCTGTGGGG - Intronic
953775553 3:45813569-45813591 GGTTCCTTCTGGAGGCTCTGAGG - Intergenic
954295241 3:49670848-49670870 CTTGCCTTCTGGAGCCTGTAGGG + Exonic
954434242 3:50487602-50487624 AATCCCCTCTGCAGGCTGTGAGG + Intronic
954878000 3:53815791-53815813 CTTTCCTGCTGGAGCGTGTGTGG - Exonic
954924297 3:54218748-54218770 TGTTCCTTCTGGAGGCTCTAGGG + Intronic
955142186 3:56280238-56280260 CATTCCTTCTGGAAGCTCTCAGG - Intronic
955155409 3:56412248-56412270 GGTTCCTTCTGAAGGCTCTGAGG - Intronic
955157134 3:56427750-56427772 GCTTCCTTCTGAGGGCTGTGAGG - Intronic
955234125 3:57124596-57124618 GGCTCCTTCTGGAGGCTGTAGGG - Intronic
955251792 3:57290228-57290250 TGTTCCTTCTGGAGGCTCTTGGG + Intronic
955325605 3:58007713-58007735 ATTCCCTTCTGGAGGCTGTAGGG - Intergenic
955412464 3:58664766-58664788 CCTTGCTTCTGGAGGCTCAGAGG - Intronic
955442362 3:58970501-58970523 GGTTCCTTCTGGAGGCACTGAGG - Intronic
955692408 3:61603677-61603699 CTTTCATTTTGGAGGCTCTGAGG + Intronic
955885372 3:63592213-63592235 AATTCTTCCTGGAGGCTCTGAGG - Intronic
955896562 3:63706829-63706851 CATTCCTTTTCGAGGCTCTAGGG + Intergenic
955970138 3:64430758-64430780 GGTTCCCTCTGGAGGCTCTGAGG - Intronic
956056059 3:65300354-65300376 GGCTCCTTCTGGAGGCTCTGAGG + Intergenic
956132696 3:66069372-66069394 GATTCCTTCTGGGGGCTCTAAGG + Intergenic
957032507 3:75257992-75258014 CAGTCCTTCTGGGAGCTGTAAGG + Intergenic
957420821 3:79967542-79967564 CATTCATGCTGGAGGCTCTAGGG - Intergenic
957541918 3:81582414-81582436 CATTTCTTCTGGAGGCTGTAAGG - Intronic
957637836 3:82809672-82809694 CATTCCTTCCTGAGGCTCTAGGG - Intergenic
958097062 3:88960011-88960033 GGTTCCTTCTGTAGGCTCTGAGG + Intergenic
958165708 3:89876202-89876224 AATTGTTTGTGGAGGCTGTGGGG + Intergenic
958195979 3:90243494-90243516 CATTCCTTCTGGAGACTTCAAGG + Intergenic
958419165 3:93912129-93912151 CATTCCTTCTGGAGACTTCAAGG + Intronic
958730557 3:97956322-97956344 CATTCCTTCAGGAGGCTGTAGGG - Intronic
958882453 3:99688315-99688337 CATTCCTTCTGGTGGCTCCTGGG + Intronic
959010904 3:101074766-101074788 TGTTCCTTCTGGAGGCTCTAGGG - Intergenic
959018893 3:101166977-101166999 GGTTCCTTCTGGAGACTCTGAGG - Intergenic
959231936 3:103665951-103665973 CATTCCTTCTGGAGGCACCAGGG + Intergenic
959462599 3:106644729-106644751 TATTCCTTCTGGTGGGTTTGTGG - Intergenic
959630395 3:108500963-108500985 CACTCCCTCTGGAGGCTCTTGGG - Intronic
960196630 3:114776503-114776525 CATTCCTTCTGGATGCTCTAGGG - Intronic
960265724 3:115618857-115618879 TGTTCCCTCTGGAGGCTCTGAGG - Intergenic
960636935 3:119793466-119793488 GCTGCCTTCTGGAGGCTGTAGGG + Intronic
960704662 3:120470273-120470295 GGTTCCTTCTGAGGGCTGTGAGG + Intergenic
960704910 3:120472627-120472649 TATTTCTTCTGGAGGCTCTACGG - Intergenic
960757119 3:121027473-121027495 ACTTCTTTCTGGAGGCTGTAGGG + Intronic
960958684 3:123053564-123053586 GGCTCCTTCTGAAGGCTGTGAGG - Intergenic
961121318 3:124373545-124373567 TGTTCCTTCTGAGGGCTGTGAGG + Intronic
961130294 3:124459999-124460021 GATTCCTTCTGAGGGCAGTGAGG + Intronic
961580272 3:127875180-127875202 GGTTCCTTCTGGGGACTGTGAGG + Intergenic
961638862 3:128352239-128352261 CATTCCTACAGGATGCTGTGAGG - Intronic
961660169 3:128464382-128464404 CACTCCCTCTGGAGGCTGCAGGG - Intronic
961752878 3:129107675-129107697 GAATTCTTGTGGAGGCTGTGAGG - Intronic
961956866 3:130813834-130813856 TATTCCTTCTGGTGGGTTTGTGG + Intergenic
961990858 3:131189151-131189173 GGTTCCTTCTGGAAGCTCTGAGG - Intronic
962200867 3:133400197-133400219 CATTGGTCCTGGAGGCTGGGGGG - Exonic
962363252 3:134759103-134759125 CATTCCTTCTGAAGGCTCTAGGG - Intronic
962583674 3:136819898-136819920 CGTGGCTGCTGGAGGCTGTGCGG - Intronic
962608981 3:137057079-137057101 GGTTCCTTCTGAAGTCTGTGCGG - Intergenic
962749355 3:138422117-138422139 GGATCCTTCTGGAGGCTCTGAGG - Intergenic
962877258 3:139544701-139544723 CATTCCCTCTGGAGGCTCTAGGG + Intergenic
962908144 3:139823938-139823960 GGTTCCTTCTGGAGGCTCTGAGG + Intergenic
962922626 3:139964650-139964672 GATGCCTTCTGGAGGGAGTGAGG + Intronic
963002398 3:140694720-140694742 CATTCCTTCTGAAGGGCCTGAGG + Intronic
963075672 3:141344262-141344284 GTTTCCTTCTGGAGGCTTAGGGG + Intronic
963268197 3:143259946-143259968 GCTTCCTTCTGGAGGCTTTGAGG + Intergenic
963423562 3:145093907-145093929 CATTCCTTTTGGAGGTTCTAGGG - Intergenic
963692830 3:148526034-148526056 TATTCCTTCTGGTGGGTTTGTGG - Intergenic
963918837 3:150886627-150886649 TATTCCTTCTGGAAGCTTTTGGG + Intronic
964163569 3:153674289-153674311 CACTCCTTCTTGAGGCTCTAGGG + Intergenic
964206427 3:154179967-154179989 GTTTCCTTCTGGAGGCTGTAGGG + Intronic
964375201 3:156042392-156042414 TATTCCTTCTGGTGGGTTTGTGG - Intronic
964441071 3:156710750-156710772 CATTCATTCTGGAAGCTCTGGGG - Intergenic
964479483 3:157127570-157127592 CATTCCTTCTGGAGGCTCTAGGG + Intergenic
964526591 3:157621423-157621445 GGTTCCTTCTGAAGGCTCTGAGG - Intronic
964526953 3:157625189-157625211 GGTTCCTTCTGAAGGCTCTGAGG - Intronic
964558498 3:157967120-157967142 CAGTCCTTCTAGAGGCTCTGAGG + Intergenic
964608985 3:158589792-158589814 CATTCCTTCTGGAGTTTATGGGG + Intronic
964723758 3:159793551-159793573 GATTCCTTCTGGAGGCTCTAGGG + Intronic
965192845 3:165553532-165553554 TGTTCCTTCTGGAGCCTCTGAGG - Intergenic
965342895 3:167512018-167512040 CTTTCCTTCTGCTGGCTCTGAGG + Intronic
965348072 3:167576712-167576734 CATCCTTTCTGGTGGCTCTGGGG - Intronic
965422557 3:168480269-168480291 CATTCTTCCTGGAGGCTCTGAGG + Intergenic
965622827 3:170657889-170657911 GGTTCCTTCTGGAGGCTGTAGGG + Intronic
965658096 3:171011474-171011496 GGTTCCTTCTGGAGGCTTTGAGG - Intronic
966131496 3:176645636-176645658 CATTCCTTCTGGGGACTCTATGG + Intergenic
966433942 3:179862066-179862088 CGTTCCCTCTGAAGGCTCTGGGG + Intronic
966711136 3:182974001-182974023 CACTCCTTTGGGAGGCTGAGAGG + Intronic
966715867 3:183012439-183012461 ACTTCATTCTGGAGGCAGTGAGG - Intergenic
967288936 3:187900627-187900649 AGTTCCTTCTGGAGGCTGTAGGG + Intergenic
967547614 3:190750329-190750351 GATTCCTTCTGGAGGCTTTAGGG + Intergenic
967784154 3:193471859-193471881 CATTCCTGCAGGGGGCTGGGTGG + Intronic
968468429 4:764800-764822 CACTCCATCTCTAGGCTGTGAGG + Intronic
968472284 4:787660-787682 CACTCCCTCTGGAGGCTCTGGGG - Intronic
968635088 4:1674135-1674157 GCCTCCTTCTGGAGGCTGAGGGG + Intronic
968718755 4:2182502-2182524 AGTTCCTTCTGGAGTCTCTGAGG - Intronic
968836887 4:2971729-2971751 GGTTCCTTCTGTGGGCTGTGAGG + Intronic
969092456 4:4705179-4705201 GGTTCCTTCTGGAGGCTGTGAGG - Intergenic
969206760 4:5652987-5653009 GGTTCCTCCTGCAGGCTGTGAGG + Intronic
969240970 4:5897273-5897295 CCTTCCTTCTGGAGGCTCCAGGG - Intergenic
969430023 4:7148612-7148634 CATTCCCCATGGAAGCTGTGAGG - Intergenic
969461198 4:7330010-7330032 GGTTCCTTCTGGAGGCTCTAGGG + Intronic
969517108 4:7653950-7653972 GGTTCCTCCTGGAGGCGGTGGGG + Intronic
969847863 4:9933767-9933789 TGTTCCTTCTGGAGGCTCTAGGG + Intronic
969916418 4:10495954-10495976 CACTCCTTCTGGAGGCTCCAGGG - Intronic
969964016 4:10975611-10975633 CATATCTGCTGGAGGGTGTGGGG + Intergenic
969986027 4:11211854-11211876 GGTTCCTTCTGAGGGCTGTGTGG - Intergenic
969999440 4:11349819-11349841 GATTTCTTCTGAAGGCTATGAGG + Intergenic
970016503 4:11518032-11518054 GGTTCCTTCTGGGGGCTGTGAGG - Intergenic
970018093 4:11535138-11535160 CATTCCTTCTGTAGGCTGTGTGG - Intergenic
970027362 4:11637471-11637493 CATTCATTCTGGATGCTGTGGGG + Intergenic
970328821 4:14957528-14957550 GGTTCCTTCTGAAGGTTGTGAGG - Intergenic
970371504 4:15411805-15411827 CATTCCTCTTGGATGCTCTGGGG + Intronic
970527947 4:16951335-16951357 TGTTCCTTCTGGAGCCTTTGAGG - Intergenic
970639591 4:18049576-18049598 GATTCCTTCTGTAGGCTGCGAGG + Intergenic
970815370 4:20150033-20150055 CATTCTTTCTAGAGGCTCTAGGG + Intergenic
970970805 4:21981322-21981344 GGTTCCTTCTGAGGGCTGTGAGG + Intergenic
971039970 4:22741183-22741205 TATTCCTTCTGGAGGCTCTCAGG - Intergenic
971209044 4:24598714-24598736 CATTCCTTCTGGTGGGTTCGTGG + Intergenic
971367962 4:25992798-25992820 GGTTCCTTCTGGAGGCTCTGAGG + Intergenic
971447122 4:26762885-26762907 CATTCCTTCTGGAGGGTCATGGG - Intergenic
971506021 4:27367423-27367445 CATTCCTTCTGGGAGCTCTAGGG + Intergenic
971548373 4:27916493-27916515 CATTGCTTCTGGAGACTCTAGGG + Intergenic
971635258 4:29048562-29048584 TCTTCCTTCTGGTGGGTGTGTGG - Intergenic
971689330 4:29812468-29812490 CATTCCTGCTGGAGGCTGTAGGG + Intergenic
971797957 4:31253293-31253315 GGTTCCTTCTGGAGGCTCTGAGG + Intergenic
972043230 4:34630598-34630620 CATTCCTTCTAGAGACTCTAAGG + Intergenic
972082827 4:35174473-35174495 CCTTCTTTCTGCTGGCTGTGGGG - Intergenic
972102138 4:35433021-35433043 CGTTCCTTCTAGAGGCTGTATGG - Intergenic
972419805 4:38876765-38876787 GATTCCTTCTAGAGTCTTTGAGG + Intronic
972575096 4:40344144-40344166 CATTCCTTCTGGAGACTCCAGGG - Intronic
972576907 4:40360186-40360208 CTTTCCTTTTGGAGGCTCTAGGG - Intergenic
973077001 4:45941261-45941283 AGTTCCTTCTGGAGGCACTGAGG + Intergenic
973223435 4:47754818-47754840 CATTCTTTCTGAAGGCAGTTAGG + Intronic
973530282 4:51831010-51831032 TGTTCCTTCTGGAGGCTCTAGGG + Intergenic
973943256 4:55931967-55931989 GATTCTTTCTGAGGGCTGTGAGG + Intergenic
974015480 4:56645071-56645093 CATTCTCCCTTGAGGCTGTGTGG - Intergenic
974118535 4:57610274-57610296 CATCCATTCTGTAGGCTATGGGG - Intergenic
974159885 4:58124826-58124848 CATTCCTTCTGGTGGGTTCGTGG + Intergenic
974199563 4:58621556-58621578 ACTTACTTCTGGAGGCTGTGGGG - Intergenic
974214204 4:58824021-58824043 ATTCCCTTCTGGAGGCTGTAAGG + Intergenic
974455285 4:62122872-62122894 GGTTCCTTCTGTAGGCTCTGAGG + Intergenic
974458261 4:62156223-62156245 GCTTCCTTGTGGAGGCTCTGAGG - Intergenic
974523543 4:63017998-63018020 GCTTTCTTCTGGAGGCTTTGAGG - Intergenic
974670156 4:65019944-65019966 TGTTTCTTGTGGAGGCTGTGAGG + Intergenic
974670213 4:65020627-65020649 GTTTCCTTGTGGAGACTGTGAGG - Intergenic
974757215 4:66225486-66225508 TATTCCTTCTGGGGACTGTAGGG + Intergenic
974821379 4:67070737-67070759 GGTTCCTTCTGGAGACTCTGAGG - Intergenic
974857215 4:67475471-67475493 ATTTCTTTCTGGAGGCTGTAAGG - Intronic
975196162 4:71526776-71526798 CATTCCTTCTCGAGGCTCTAGGG + Intronic
975419847 4:74150153-74150175 TATTCCTTCTGGAGGCTCTAAGG - Intronic
975454316 4:74572249-74572271 CATTCATTTTGGAGGCTTTCAGG - Intergenic
975517886 4:75267147-75267169 TATTCCCTCTGGAGGCTCTGGGG - Intergenic
975543508 4:75537884-75537906 CATTCCCTCTGGATGCTCTCTGG - Intronic
975798448 4:78033760-78033782 CATTCCTTCTGGAGACTCTAGGG - Intergenic
976152574 4:82106965-82106987 CATTCTTTTTTGTGGCTGTGTGG + Intergenic
976291477 4:83422627-83422649 GATTCCTTCAGGAGCCTCTGAGG - Intronic
976334442 4:83869317-83869339 GGTTCCCTCTGGAGGCTCTGAGG - Intergenic
976392061 4:84516102-84516124 GCTTCCTTCTGAGGGCTGTGAGG - Intergenic
976424075 4:84880223-84880245 CATTCTTTCTGGACGCTCTAGGG - Intronic
976830693 4:89310393-89310415 CACTCTTTCTGGAGACTGAGGGG + Intergenic
976962563 4:90997167-90997189 TGTTCCTTCTGGAGGTTGTAGGG + Intronic
977121907 4:93112751-93112773 GATTCCTTCTGAGGGGTGTGAGG + Intronic
977416790 4:96743465-96743487 CATTCCTCCTGGTGGGTTTGTGG - Intergenic
977443036 4:97094679-97094701 GATTCCATCTGGAGGCAGAGTGG + Intergenic
977526672 4:98154542-98154564 GGTTCCTTCTGAGGGCTGTGAGG + Intergenic
977526861 4:98156744-98156766 GGTTCCTTCTGAGGGCTGTGAGG - Intergenic
977533178 4:98224568-98224590 CATGACTTCAGGAGGCTCTGGGG - Intergenic
977758334 4:100700459-100700481 GATTCCTTCTAGAGGCCTTGAGG + Intronic
977910231 4:102525919-102525941 GGTTCCTTCTGGAGGCTCTCAGG + Intronic
977942552 4:102874605-102874627 GATTCTTTCTGGAGGATCTGAGG - Intronic
978254737 4:106680834-106680856 CATTCCTTCTTGTGGGTTTGTGG + Intergenic
978466398 4:109013619-109013641 CATTCCTCCTGGTGGGTTTGTGG - Intronic
978568975 4:110115850-110115872 CATTTCTTCTGAAGGCTCTATGG + Intronic
978644935 4:110918986-110919008 CGCTCCTTCTGGAGGCTCTAGGG + Intergenic
979033454 4:115680689-115680711 GGTTCCTTCTGAGGGCTGTGAGG - Intergenic
979039967 4:115777206-115777228 GTTTCCTTCTGAGGGCTGTGAGG - Intergenic
979079339 4:116313792-116313814 CTTTTCTTCTGGAGGCTCTAGGG - Intergenic
979155351 4:117380943-117380965 TATTCCTTCTGGATGCTCTAGGG + Intergenic
979175144 4:117653110-117653132 GGTTCCTTCTGGAGGCTCTAGGG + Intergenic
979502725 4:121458468-121458490 CATTATTTCTGGAGGCCCTGGGG - Intergenic
979511394 4:121557706-121557728 GGTTCCTTCTGGAAGCTCTGAGG - Intergenic
979559256 4:122083595-122083617 CATTCCTTCTGCAGGTTTTAGGG - Intergenic
979845835 4:125510551-125510573 CATTCCTTCTGAAGGCTCTAGGG + Intergenic
979935126 4:126684534-126684556 GATTTCTTCTTAAGGCTGTGAGG + Intergenic
980015675 4:127647323-127647345 CATTCCTTTTGGAGGCTCCAGGG + Intronic
980677052 4:136099065-136099087 CATTCCTCCTGGTGGGTTTGTGG + Intergenic
980696054 4:136356884-136356906 AATTTTTTCTGGAGGCTGTATGG - Intergenic
980823963 4:138052281-138052303 CATTCCTCCTAGTGGGTGTGTGG + Intergenic
980844300 4:138305630-138305652 GGTTCCTTCTGAAGGCTGTGAGG + Intergenic
980848580 4:138353918-138353940 CACTCCTTCTGGAGGCTCTAGGG + Intergenic
981101901 4:140838368-140838390 CAGTCCGTCTGGAGGCTCTAAGG + Intergenic
981145728 4:141321816-141321838 GATTCCTTCTGAGGGCTATGTGG + Intergenic
981291132 4:143076899-143076921 CATTCCTTCTGGAGGCTTAAGGG - Intergenic
981713691 4:147732623-147732645 CATTCCTCCTCGAGGCAGCGCGG + Intronic
981778514 4:148397948-148397970 CACTCCCTCTGAAGGCTCTGGGG + Intronic
982089326 4:151866839-151866861 GGTTTCTTCTGGGGGCTGTGAGG + Intergenic
982308849 4:153962845-153962867 GGTTCCTTCTGGAGGCTCTGAGG - Intergenic
982320619 4:154073188-154073210 CATTCCTTCTGGAGGCTCAAGGG - Intergenic
982359180 4:154500305-154500327 TGTTCCTTCTGGATGCTCTGGGG - Intergenic
982438235 4:155401961-155401983 CACTCCTTCTAGAGGCTTTAGGG - Intergenic
982583547 4:157209058-157209080 CATTCCTCCTGGTGGGTTTGTGG + Intronic
982700780 4:158658103-158658125 CATTCCTTCCGGTGGGTTTGTGG - Intergenic
982778966 4:159470319-159470341 CAGTCATTGTGGAGGCAGTGTGG + Intergenic
982834875 4:160110988-160111010 TGTTCCTTCTGGAGGCTGAGAGG + Intergenic
983056995 4:163109658-163109680 CATTCTTTTTTTAGGCTGTGAGG - Intergenic
983470297 4:168146747-168146769 GTTTCCTTCTGTAGTCTGTGGGG - Intronic
983672197 4:170250945-170250967 CACACCTTCTGGAGGCTGTGGGG - Intergenic
983768662 4:171519723-171519745 CATTCCTTCTCTAGGGTATGGGG + Intergenic
984099513 4:175468350-175468372 CATTACTTTGGGAGGCTGAGGGG - Intergenic
984164378 4:176289608-176289630 CATTCCTTCTTGAAGCCCTGTGG - Intergenic
984285353 4:177721727-177721749 CATTCCTTCTGGAGGCTCTAGGG - Intergenic
984468948 4:180140815-180140837 CAGTGCTTTTGGAGGCTGAGTGG + Intergenic
984799392 4:183699681-183699703 CGTTCCTTCTGGAGGCTCTCAGG + Intronic
984889848 4:184482240-184482262 GGTTCCTTCTCAAGGCTGTGGGG + Intergenic
985090479 4:186357899-186357921 CCTTCCTTCTGGAGGCTCCTGGG - Intergenic
985198682 4:187461581-187461603 CGTTCCTTCTCGAGGCTCTGCGG + Intergenic
985443819 4:190007883-190007905 CATTCCTTTTTGTGGCTGAGTGG - Intergenic
985703905 5:1389699-1389721 GGTTCCTGCTGGAGGCTCTGGGG + Intergenic
986082296 5:4407728-4407750 GCTTCCTTCTGGAGGCTGTGGGG + Intergenic
986231566 5:5868961-5868983 TACTCCTCCTGGAGGCTGTGGGG + Intergenic
986290064 5:6392707-6392729 CACTCCTTCTGGGGGCTGCGGGG + Intergenic
986375214 5:7124296-7124318 CATTCCCTCTAGAGGCTCTAGGG + Intergenic
986414472 5:7514854-7514876 TGTTCCTCCTGGAGGCTTTGAGG - Intronic
986448140 5:7840933-7840955 GGTTCCTTCTAGGGGCTGTGAGG - Intronic
986649876 5:9952836-9952858 TATTCCTTCTGGAGGCTCTCAGG + Intergenic
986676925 5:10193890-10193912 GATTCCTTCTGAGGGCTCTGAGG - Intergenic
986717166 5:10533045-10533067 GGTTCCTTCTGGAGGCTCTAAGG - Intergenic
987103243 5:14611488-14611510 CGTTCCTTCTGGAGGCTATGGGG - Exonic
987214125 5:15715015-15715037 CGTTCCTTCTAGAGGCTCAGGGG - Intronic
987297876 5:16569978-16570000 CATTCCCTCTGGAGTCTCTAAGG - Intronic
987488682 5:18551112-18551134 CATTCCTCCTGGTGGGTTTGTGG + Intergenic
987493523 5:18613480-18613502 GGTTCCTGCTGAAGGCTGTGAGG + Intergenic
987698313 5:21361286-21361308 CATTCCTTCTATAGTCTCTGTGG + Intergenic
987833499 5:23129765-23129787 CATTCGTTCTCATGGCTGTGTGG - Intergenic
987899977 5:23998808-23998830 GCTTCCTTCTAGAGGCTGTAGGG + Intronic
988522581 5:31959830-31959852 GGTTCCTTATGGAGGCTTTGAGG + Intronic
988692032 5:33581988-33582010 AATTCCTTCTGAAAGCTGGGAGG - Intronic
988754339 5:34230240-34230262 CATTCCTTCTATAGGCTCTGTGG - Intergenic
988884819 5:35545256-35545278 GACTCCTTCTGGAGCCTCTGAGG + Intergenic
988912180 5:35854420-35854442 CAGTCCTTCTAGAGATTGTGGGG - Intronic
988932833 5:36053765-36053787 CATTTCTTCTGGAGGCTCTGGGG + Intronic
988977772 5:36531754-36531776 GGTTCCTTGTGGAGGCTCTGGGG - Intergenic
989001167 5:36762388-36762410 GGTTCCTTCTGCAGGCTCTGAGG + Intergenic
989213225 5:38878337-38878359 CATTCATGCTGGGGGCTGGGGGG + Intronic
989297015 5:39840737-39840759 GGTTCCTCCTGCAGGCTGTGAGG - Intergenic
989496771 5:42117754-42117776 TATTCCTTCTGGTGGGTTTGTGG - Intergenic
989543291 5:42642793-42642815 GGTTCCTTCTGGAGGCTCTGAGG + Intronic
989729676 5:44633687-44633709 CATTCCTTCTGGAGGCTTCAGGG - Intergenic
990148610 5:52790481-52790503 CATTTCTTCTGGAGGTTCTAGGG + Intronic
990346952 5:54880803-54880825 CCTTCCTTCTAGAGGCTCTAGGG + Intergenic
990353399 5:54940965-54940987 TCTTCCTTCTGGAGGCTCTAGGG + Intergenic
990440668 5:55841893-55841915 TGTTCCTTCTGGAGTCTCTGAGG + Intergenic
990484941 5:56248943-56248965 TCTTCCTTCTGGCGGCTTTGTGG + Intergenic
990506673 5:56452006-56452028 AGTTCCTTCTGGAGGCTCAGAGG - Intergenic
990510971 5:56488660-56488682 CATTCCTCCTGGTGGGTTTGTGG - Intergenic
990592607 5:57281595-57281617 CATTCCTTCTGGAGGCTCTAGGG - Intergenic
990645251 5:57836548-57836570 GGTTCCTTCTGGAGGATCTGAGG + Intergenic
990706527 5:58536036-58536058 CATACCTTCTGGTGGCTGCTGGG + Intergenic
990737335 5:58878576-58878598 CATTCCTTCTGGAAGTTCTGGGG - Intergenic
990831307 5:59961427-59961449 GGTTCCCTCTGGAGGCTCTGGGG - Intronic
991217504 5:64172375-64172397 CATTCCTTGTGGGGGGTGGGGGG - Intronic
991259836 5:64655026-64655048 CATTCCTTTTGAAGGCTCTAGGG + Intergenic
991404212 5:66285941-66285963 CATTCCTTCTGGAGGCTCTAGGG + Intergenic
991503512 5:67301183-67301205 GGTTCCTTCTGAAGGCTGTGAGG - Intergenic
991560404 5:67945370-67945392 GGTTTCTTCTGGAGGCTCTGAGG - Intergenic
991599339 5:68336856-68336878 CATTCCTTCTGGAGACTCTAAGG - Intergenic
991613258 5:68469795-68469817 GGTTCCTTCTGAGGGCTGTGAGG - Intergenic
991621203 5:68547121-68547143 GGTTCCTTCTGAAGGCTGTGAGG + Intergenic
991701007 5:69316500-69316522 CGTTCCTTCTGGAGGTTCAGTGG - Intronic
991742116 5:69691087-69691109 CATTCCTTCTATAGGCTCTGTGG - Intergenic
991755577 5:69864121-69864143 CATTCCTTCTATAGGCTCTGTGG + Intergenic
991793690 5:70270827-70270849 CATTCCTTCTATAGGCTCTGTGG - Intergenic
991821506 5:70566391-70566413 CATTCCTTCTATAGGCTCTGTGG - Intergenic
991834904 5:70739269-70739291 CATTCCTTCTATAGGCTCTGTGG + Intergenic
991886068 5:71270359-71270381 CATTGCTTCTATAGGCTCTGTGG - Intergenic
991908383 5:71535674-71535696 GGTTCCTTCTGGAGGCTCTGAGG + Intronic
991977766 5:72199741-72199763 CTTTCCTCCTGGAGGCGGTGGGG - Exonic
992075102 5:73184812-73184834 CACTCCATCTGGAGGCTCTCAGG - Intergenic
992165585 5:74047663-74047685 TGTTCCTTCTGGAGGCTCTAGGG + Intergenic
992356202 5:75986451-75986473 GATTCCTTCTGGAGGCTCTGAGG - Intergenic
992494740 5:77281459-77281481 GACTCCTTCTGGAGGCTCTAGGG + Intronic
992713011 5:79479577-79479599 CACTCCTTCAGGAGGCTGTAGGG - Intronic
992887051 5:81169396-81169418 CATACTTTCTGGAGGCTCTGGGG + Intronic
993180297 5:84543919-84543941 GGTTCCTTCTGGAGGCTCTGAGG + Intergenic
993282302 5:85940296-85940318 CATTCCTTCTGGAGGCACTAGGG + Intergenic
993382655 5:87225262-87225284 CATTCTTTCTGGAGGCTGAAAGG - Intergenic
994049264 5:95344106-95344128 GATTCCTTCTGAGGCCTGTGAGG + Intergenic
994164688 5:96596393-96596415 CGTTCCTTCTGGAGGTTCTGAGG - Intronic
994178683 5:96740371-96740393 GGTTCCTTCTGAGGGCTGTGAGG + Intronic
994250658 5:97533086-97533108 GGTTCCTTCTGGAGGCTCTGGGG + Intergenic
994383206 5:99096489-99096511 GATTCCTTCTGGTGGCTGTAGGG + Intergenic
994724367 5:103416811-103416833 TGTTCCTTCTGGAAGCTCTGGGG + Intergenic
994750928 5:103736051-103736073 CATTCCTGCCGAAGGCTCTGGGG + Intergenic
994751333 5:103740601-103740623 CATTCCTTTTGGAGGCAGTAGGG - Intergenic
994851721 5:105063376-105063398 GATTCCTTCTGGAGGCTGCAAGG - Intergenic
994950320 5:106453298-106453320 GGTTCCTTCTGGAGACTCTGAGG - Intergenic
995060147 5:107804775-107804797 CATTCCTTATGGAGGCTCTAGGG + Intergenic
995137454 5:108695411-108695433 CCTTCCTTCTGGAGGCTCTACGG - Intergenic
995234190 5:109807477-109807499 GGTTCCTTCTGGCGGCTCTGAGG + Intronic
995261931 5:110114182-110114204 GGTTCCATCTGGAGGCTCTGAGG + Intergenic
995262119 5:110116362-110116384 CATTCCTTCTGGAGGCTCTAGGG + Intergenic
995334178 5:110979736-110979758 CATTCCTTCTGTGAGCTCTGGGG + Intergenic
995405948 5:111796095-111796117 CATGCCTTCTGGAGGCTCTATGG + Intronic
995756835 5:115514404-115514426 AATTCCTTCTGGAGGCTCTGAGG + Intergenic
995856695 5:116600345-116600367 CATTCTTTCTGGGGGCTCTAGGG + Intergenic
996624745 5:125557226-125557248 CATTCCTTCTGCAGACTCTAAGG + Intergenic
996643024 5:125780165-125780187 CATTCCTTCTGGGGGATTTGGGG + Intergenic
996960798 5:129246763-129246785 CATTCCTTATAGAGGCTCTGAGG - Intergenic
996984257 5:129539416-129539438 CATTCCTTCTAGAGGCACTAGGG - Intronic
997120570 5:131168613-131168635 CATTCCTTCTGGATGCTCTAGGG + Intronic
997459990 5:134045425-134045447 CCTTCATTCTGGAGGCTTTAGGG + Intergenic
997616454 5:135249421-135249443 GACTCCTTCGGGAGGATGTGCGG + Intronic
997693700 5:135845121-135845143 GATGCCTTCTGGAGGCTCCGAGG + Intronic
997847956 5:137305010-137305032 CATTCCCTCTGAAAGCTGTAGGG + Intronic
997949832 5:138233515-138233537 GCTTCCTTCTGAGGGCTGTGAGG + Intergenic
998094642 5:139390384-139390406 CATTCCTTCTGGTGGTTGAGTGG - Intergenic
998188719 5:140003557-140003579 TGTTCCTTCTGGAGGCTCTATGG - Intronic
998326129 5:141281464-141281486 GGTTCCTTCTGAGGGCTGTGAGG + Intergenic
998691863 5:144596051-144596073 TATTCCTTCTGGTGGGTTTGTGG - Intergenic
999447327 5:151650496-151650518 CCTTCCTTCTGGTGGCTGCATGG - Intergenic
999513444 5:152276767-152276789 AATTCCTTCTTGGGACTGTGGGG + Intergenic
999615689 5:153420742-153420764 AATTCCTTCTGGAGGCTCTAGGG + Intergenic
1000165942 5:158648786-158648808 GGTTCCTTCTGGGAGCTGTGAGG - Intergenic
1000399300 5:160808893-160808915 GGTTCCTTCTGGGGGCTGTGAGG + Intronic
1000460527 5:161511692-161511714 GGTTCCTTCTGAGGGCTGTGAGG + Intronic
1000509045 5:162159557-162159579 CATTCCTTCTGAAGGATCTAGGG + Intergenic
1000552575 5:162685208-162685230 AGCTCCTTCTGGAGGCTTTGAGG - Intergenic
1001019468 5:168170737-168170759 CACTCCCTCTGGCTGCTGTGTGG - Intronic
1001137203 5:169112483-169112505 TCTTCCATCTGGAGGCTCTGGGG + Intronic
1001165449 5:169361483-169361505 GGTTCCTTCTGAGGGCTGTGAGG - Intergenic
1001180491 5:169515447-169515469 GGTTCCTTCTGAGGGCTGTGAGG + Intergenic
1001657335 5:173361786-173361808 GTTTCCTTCTGAGGGCTGTGAGG + Intergenic
1001706338 5:173743734-173743756 CATTCCTCCTGGAGGCTTTAGGG - Intergenic
1001765107 5:174239620-174239642 CACTCCTTCTGCAGGCTCTAAGG - Intronic
1001778313 5:174345626-174345648 CTTTCATTCTGGAAGTTGTGTGG + Intergenic
1001798619 5:174523907-174523929 CATTCCTCCTGGAGGCTGTGGGG + Intergenic
1001907523 5:175485349-175485371 CCTTCCTTCTGGAGGCTCTAGGG + Intronic
1002086279 5:176777599-176777621 GGTTCCTTCTGAAGGCTGTGAGG - Intergenic
1002086679 5:176780298-176780320 CATTCCTTCTAGAGGCTCCAGGG - Intergenic
1002447678 5:179299640-179299662 CATTCCTTCTGGAAGCTCTAAGG + Intronic
1002949126 6:1791134-1791156 CATCCCTTCCAGAGGCTCTGGGG - Intronic
1002981450 6:2142575-2142597 GGTTCCTTCTGAGGGCTGTGAGG - Intronic
1003244521 6:4372799-4372821 CATTACTTCTCAAGGCTGTTTGG + Intergenic
1003373505 6:5551717-5551739 GGTTCCTTCTGGAGGCTCTGGGG + Intronic
1003429336 6:6024683-6024705 CTTTCCTTCTGAGGGCTGTGAGG + Intergenic
1003628546 6:7765789-7765811 TGTTCCTTCTGGAGGCTCTAGGG + Intronic
1003949034 6:11101140-11101162 CCTTTCTTCTGGAGGATGTTTGG + Intronic
1004145365 6:13060999-13061021 GGTTCCTTCTGGAGACTCTGAGG + Intronic
1004189813 6:13454207-13454229 GGTTCCTTCTGAGGGCTGTGAGG - Intronic
1004232266 6:13844106-13844128 GGTTCCTTCTGGAGGCTCTGAGG - Intergenic
1004361716 6:14977146-14977168 GGTTCCTTCTGGAGGCTCCGAGG + Intergenic
1004505323 6:16242483-16242505 GATTCCTTCTGAGGGCTGGGAGG + Intronic
1004564622 6:16784467-16784489 CACTCCCTTTGAAGGCTGTGAGG - Intergenic
1004576488 6:16900660-16900682 CGTTCCTTCTGGAGGCTCTAGGG - Intergenic
1004861242 6:19806374-19806396 CATTCCTTCTGGTGGGTTTGTGG + Intergenic
1004876698 6:19962770-19962792 CATTCCTTCTGGAAGTTCTAGGG - Intergenic
1005027062 6:21473447-21473469 GATTCCTTCTGAGGGCTGTGAGG + Intergenic
1005264063 6:24092623-24092645 TGATCCTTCTGGAGGCTCTGAGG - Intergenic
1005276886 6:24229209-24229231 TGTTCCTTCTGGAGGCTCTAGGG + Intronic
1005424312 6:25685129-25685151 CATTCCTTCTGGAGGTTCTCGGG - Intronic
1005461075 6:26070942-26070964 GATTCCTTCTGAAGGCAATGAGG + Intergenic
1005552524 6:26937095-26937117 CATTCCTTCTATAGGCTCTGTGG - Intergenic
1005879942 6:30049052-30049074 AGTTTCTTCTGGAGGCTCTGGGG - Intergenic
1006591881 6:35164268-35164290 CAGTCCATCTGGAGGCTTTGGGG - Intergenic
1006692514 6:35901446-35901468 GATTCCTTTTGAGGGCTGTGAGG - Intronic
1006944546 6:37776747-37776769 ATTTCCTTCTGGAGGCTCTGGGG + Intergenic
1007972649 6:46068187-46068209 CACTCCTTCTGAAGGCTCTAGGG - Intronic
1007973480 6:46076583-46076605 TTTTCCTTCTGGAGGCTCTGGGG - Intronic
1008037719 6:46763490-46763512 GTTTCCTTCTGAGGGCTGTGAGG - Intergenic
1008132438 6:47734087-47734109 CATTCCTTCTGGATGCTCCAGGG - Intergenic
1008133413 6:47744138-47744160 CATTCCTTCTGGATTCTTTAGGG + Intergenic
1008417962 6:51265363-51265385 GGTTTCCTCTGGAGGCTGTGAGG - Intergenic
1008538470 6:52526004-52526026 GATTCCTTCTGAGGGCTGTGAGG - Intronic
1008861249 6:56152145-56152167 CATTCTTTCTGGAGGCTCTAGGG + Intronic
1008992268 6:57617100-57617122 AATTCCTTCTGAGAGCTGTGAGG + Intronic
1009026226 6:58003558-58003580 CATTCTTTCTGGAGGCTCTAGGG + Intergenic
1009201779 6:60755031-60755053 CATTCTTTTTGGAGGCTCTAGGG + Intergenic
1009350273 6:62666912-62666934 GATTTCTTCAGGAGGCTCTGAGG - Intergenic
1009357892 6:62774783-62774805 CATTGCTTCAGGAGCCTATGGGG + Intergenic
1009868266 6:69424942-69424964 CAGTCCTTCCGGGGGCTGGGCGG + Intergenic
1009887840 6:69645463-69645485 TGTTCCTTCTGGAGGCTCTAAGG + Intergenic
1009976693 6:70678680-70678702 CATTCCTTTTGGAGGTTCTAGGG + Intronic
1010188224 6:73166720-73166742 GCTTCCTTCTGGAAGCTCTGTGG + Intronic
1010284339 6:74057964-74057986 ATTTCCTTCTGGAGGCTTTAAGG - Intergenic
1010302054 6:74272764-74272786 CATTTCTTCTGGAGGCTGTAAGG + Intergenic
1010596956 6:77775515-77775537 CATTCCTTTTTATGGCTGTGTGG + Intronic
1010753130 6:79636661-79636683 GCTTCCTTCTGAGGGCTGTGAGG + Intronic
1011135122 6:84092026-84092048 CATTCCATCTGGAGGCTCTCAGG + Intergenic
1011292368 6:85790122-85790144 GATTCCTTCTGAAGGCTCTGAGG - Intergenic
1011551316 6:88533456-88533478 GGTTCCTACTGGAGGCTGTAAGG - Intergenic
1011797929 6:90978036-90978058 GCTTCCTTCTGGAGGCTGTGGGG - Intergenic
1011955755 6:93023806-93023828 TATTCCTTCTGGAAGCTCTAGGG + Intergenic
1012088393 6:94859338-94859360 GGTTCCTTCTGGAGGCTCTCAGG + Intergenic
1012131449 6:95498156-95498178 CATTCCTCCTGGTGGGTTTGTGG - Intergenic
1012279592 6:97313012-97313034 GGTTCCTTCTGGAGGCTGCATGG - Intergenic
1012433357 6:99189245-99189267 TGTTCCTTCTGGAGGCTCTAGGG + Intergenic
1012586422 6:100928510-100928532 AGTTCCTTCTGGAGGCTCTATGG + Intergenic
1012946641 6:105473266-105473288 GGTACCTTCTGGAGGCTCTGAGG - Intergenic
1012972894 6:105750502-105750524 GATTCTTTCTGCAGGCTGTGAGG + Intergenic
1013091908 6:106907816-106907838 TGTTCCTTCTGTGGGCTGTGAGG - Intergenic
1013179587 6:107706896-107706918 CTTTCCTTCTGGAGGTTCTAGGG - Intronic
1013204333 6:107933221-107933243 ACTTCCTTCTGGAGGCTCTAGGG - Intronic
1013223486 6:108101307-108101329 GGTTTCTTCTGCAGGCTGTGAGG - Intronic
1013356142 6:109347462-109347484 GGTTCCTTTTGGAGGCTCTGAGG + Intergenic
1013730357 6:113157327-113157349 GGTTCCTTCTAAAGGCTGTGAGG + Intergenic
1013817181 6:114112403-114112425 CATTCCTTCTGGAGGCACTAAGG - Intronic
1013863334 6:114662214-114662236 GACTCCTTCTGAAGGCTGTGAGG + Intergenic
1014349345 6:120320125-120320147 GGTTCCTTCTGAGGGCTGTGAGG - Intergenic
1014621502 6:123673549-123673571 TGTTCCTTCTGGAGGGTCTGAGG + Intergenic
1014676308 6:124370885-124370907 CATTCATTCTGTAGGCTTTCTGG - Intronic
1015020652 6:128469920-128469942 GGTTCCTTCTGGAGTCTGTAGGG - Intronic
1015025535 6:128527836-128527858 TGTTCCATCTGGAGGCTGTAGGG - Intergenic
1015436339 6:133193506-133193528 AGTTCCTTCTGGAGGCTCTGAGG - Intergenic
1015481448 6:133715525-133715547 CGTTGCTTCTGGAGGCTCTAAGG + Intergenic
1015575858 6:134670388-134670410 GGTTCCTTCTGAGGGCTGTGAGG - Intergenic
1015589659 6:134810800-134810822 GGTTCCTTCTGAGGGCTGTGAGG - Intergenic
1015798490 6:137036658-137036680 GGTTCTTTCTGAAGGCTGTGAGG - Intronic
1016150032 6:140729165-140729187 CATTCCTTCTGGAAGCTCTAGGG + Intergenic
1016237371 6:141884656-141884678 CATTCCTTCTGAATTCTGTGAGG - Intergenic
1016372244 6:143387141-143387163 CATTCCTTTTTATGGCTGTGTGG + Intergenic
1016396430 6:143628396-143628418 CATTCCTTCTGGAGGCACTGGGG + Intronic
1016787744 6:148031510-148031532 GGTTCCTTCTGAGGGCTGTGAGG + Intergenic
1016879906 6:148900832-148900854 CGTTCCTTCTGGAAGCTCTGGGG + Intronic
1017183666 6:151578332-151578354 GGTTCCTTCTGAGGGCTGTGAGG + Intronic
1017326530 6:153146872-153146894 ATTTCCTTCTGGAGGCTCTCAGG - Intergenic
1017409582 6:154153835-154153857 CACTCCTTGTGGAGGCTCTGGGG - Intronic
1017647415 6:156551835-156551857 GATTCTTTCTGGAGGCTTTGGGG - Intergenic
1017774442 6:157669834-157669856 CCGGCCTGCTGGAGGCTGTGCGG + Intronic
1017878921 6:158546257-158546279 CATTCCTACTGCAGCCTGAGGGG - Intronic
1017937103 6:159015373-159015395 GGTTCCTTCTGAGGGCTGTGAGG - Intergenic
1018146695 6:160898155-160898177 GATTCCTTCTGGGGGCTGTGAGG - Intergenic
1018209786 6:161469711-161469733 CATTCCTTCTGGAGGCTGTGGGG - Intronic
1018230460 6:161670350-161670372 GCTTCCTTCTGGAGGCTCTGAGG + Intronic
1018257022 6:161930942-161930964 CGTTCCTTCTGGAAGCTCTCAGG - Intronic
1018508223 6:164494296-164494318 TGTTCCTTCTGGAGGCTGCAGGG - Intergenic
1018883944 6:167916078-167916100 GATTCCTTCTGGGGGCTCTGAGG + Intronic
1018967241 6:168498592-168498614 CCTTCCTGCTGCAGGCTGAGTGG + Intronic
1019078633 6:169412008-169412030 CAGTCCTCATGGATGCTGTGTGG - Intergenic
1019493247 7:1324742-1324764 CGCACCTCCTGGAGGCTGTGAGG - Intergenic
1019739808 7:2667012-2667034 GGTTTCTTCTGGAGGCTCTGTGG + Intergenic
1019819350 7:3230249-3230271 GGTTCCTTCTGGAGGCCCTGAGG + Intergenic
1020244581 7:6420791-6420813 CATTCCTTCGGGAGGAGCTGAGG + Intronic
1020520375 7:9178345-9178367 CATTCTATCTGGAGGCTTTAAGG - Intergenic
1021084792 7:16409241-16409263 CATTCCTTCTGGAAGATTTGGGG - Intronic
1021113772 7:16725506-16725528 CATTCCTTCTGGATGCTCTAGGG + Intergenic
1021131828 7:16921169-16921191 GATTCCTTCTGGAGGCTCCAGGG + Intergenic
1021362656 7:19734699-19734721 CATTCTTTCTGGAGGCTCCAGGG - Intronic
1021490697 7:21217409-21217431 GATTCCTTTTGGACACTGTGAGG - Intergenic
1021495424 7:21269079-21269101 TGTTCCTTCTCGAGGCTCTGGGG + Intergenic
1021602674 7:22379845-22379867 CATGCCTTTTGGAGGCTGAGAGG + Intergenic
1022067937 7:26879972-26879994 CATTCCTTCTGGAGGCTCCAGGG - Intronic
1022074390 7:26953256-26953278 TGTTCCTTCTGGAGGCTCTGAGG + Intronic
1022209782 7:28197047-28197069 CATTCTTTCTGGAGGCTCTAGGG + Intergenic
1022448096 7:30486313-30486335 CATTCCTTCTGGAGGGTCTGTGG - Intergenic
1022450197 7:30506843-30506865 CATTCCTTCTGGTGGGTTTGTGG + Intronic
1022450234 7:30507115-30507137 CATTCCTTCTGGTGGGTTTGTGG + Intronic
1022477538 7:30721541-30721563 CAATCCTTCTGGAGGTTCTAGGG - Intronic
1022488102 7:30795724-30795746 CATTCCTTCTGGAGCCTCTAGGG + Intronic
1022520057 7:31000439-31000461 CATTGCTTCCGGAACCTGTGCGG + Intergenic
1022737794 7:33092242-33092264 GCTTCCATCTGGAGGCTCTGGGG + Intergenic
1022834848 7:34103589-34103611 CATTCCTCCTTGAGGCAGAGGGG + Intronic
1022874214 7:34512101-34512123 CAATCTTTCTGAAGGCTGTAGGG - Intergenic
1022911483 7:34903026-34903048 CATTCCTTCTGGAGGTTCTGAGG - Intergenic
1023027656 7:36065368-36065390 TCTTCCTTCTGGTGGATGTGTGG + Intergenic
1023067708 7:36395264-36395286 TGTTTCTTCTGGAGGCTGTAGGG + Intronic
1023557122 7:41435440-41435462 CCTTCCTTCTGGTGGGTTTGTGG - Intergenic
1023574643 7:41613805-41613827 CATTCCTTCTGAAGGCTCCAGGG + Intergenic
1023601456 7:41885504-41885526 CTCTCCTTCTGTAGCCTGTGAGG + Intergenic
1023658557 7:42450507-42450529 CATTCCTTTTGGAGGCTCTAGGG - Intergenic
1024384989 7:48740438-48740460 TGTTTCTTCTGGAGGCTCTGGGG + Intergenic
1024654593 7:51439937-51439959 GATTCCTTCTGAGAGCTGTGAGG - Intergenic
1024835502 7:53513486-53513508 TATTTCTTCTGGAGGCTGTAGGG + Intergenic
1024890582 7:54196843-54196865 AGTTCCTTCCGGAGGCTCTGAGG - Intergenic
1026103813 7:67404995-67405017 GGCTCCTTCTGAAGGCTGTGAGG + Intergenic
1026120349 7:67531479-67531501 CATTCCTTCTGGAGGTTTTTGGG + Intergenic
1026134830 7:67650779-67650801 AATTCCTTCTGACTGCTGTGTGG + Intergenic
1026299386 7:69083892-69083914 GGTTCCTTCTGAGGGCTGTGAGG + Intergenic
1026502359 7:70953448-70953470 CATTCCTTCTGGAAGCTCTTGGG - Intergenic
1026613564 7:71882120-71882142 CGTTCCTTCTGGAAGCTCTAAGG + Intronic
1026634482 7:72069450-72069472 CACTCCCTCTGGAGGCTCTAGGG + Intronic
1027388628 7:77683010-77683032 GATTCCTTCTGAGGGCTGTGAGG + Intergenic
1027515604 7:79138081-79138103 CATTCTTTCTGGAGACTCTAGGG - Intronic
1027649656 7:80850955-80850977 CAGTCCCTCTGGAGGCTTTGGGG + Intronic
1027791988 7:82645876-82645898 TATTCCTTCTGGTGGGTTTGTGG - Intergenic
1027943641 7:84717763-84717785 CATTCCTTCTGGAGGTTCTAGGG - Intergenic
1028333270 7:89622711-89622733 CATTCCTTGCAGAGACTGTGAGG + Intergenic
1028572493 7:92306267-92306289 CATTCCTTTTGGAGGCTCCAGGG + Intronic
1028853353 7:95561888-95561910 GATTCTTTCTGGGGGCTGTGAGG - Intergenic
1028983976 7:96995862-96995884 GATACCTTCTGGAGGCTTAGTGG - Intergenic
1029157571 7:98528241-98528263 GGTTCCTTCTGGAAGCTCTGAGG + Intergenic
1029906835 7:104101128-104101150 AGTTCCTTCTGGAGGCTCTAGGG - Intergenic
1029972973 7:104807344-104807366 GATTCCTTCTGGTGGCTGTGAGG - Intronic
1030074424 7:105724168-105724190 GGTTCCTTCTGGGGGCTCTGAGG + Intronic
1030173334 7:106626791-106626813 AGTTCCTTCTGGAGGTTCTGAGG - Intergenic
1030292833 7:107889223-107889245 CATTCCTCCTGGTGGGTTTGTGG - Intergenic
1030318148 7:108137364-108137386 GGTTCCTTCTGGAGGCTCTGAGG + Intergenic
1030384771 7:108855329-108855351 ATTTCCTTCTGGAGGATCTGAGG - Intergenic
1030386377 7:108872394-108872416 GATTCCTTCTGGAGGCTCTTAGG + Intergenic
1030446598 7:109653100-109653122 CATTCCTTCTGGAGATTGTAAGG - Intergenic
1030512733 7:110504453-110504475 AAATCCTTATGGAGGCTGTTGGG - Intergenic
1030557551 7:111045741-111045763 CATTCCTTTTGGAGGCTCTAGGG - Intronic
1031137471 7:117900774-117900796 CATTCCTTCTGGAGGCTCTAGGG + Intergenic
1031201965 7:118699804-118699826 CATTCCTTCTGAAGGCTCCAGGG - Intergenic
1031434793 7:121719896-121719918 CATTCGTTCTTATGGCTGTGTGG + Intergenic
1031482325 7:122293385-122293407 AATTCCTTCTGGAGACTCTAGGG - Intergenic
1031513134 7:122673067-122673089 CATTCCTTCTGGTGGGTTCGTGG + Intronic
1032016520 7:128383645-128383667 CATTCCTCCTGGAGGCTCTAGGG - Intergenic
1032592120 7:133201094-133201116 GGTTGCTTCTGGAGACTGTGAGG + Intergenic
1032593871 7:133219420-133219442 CGCTCCTTCTGGAGGCTCTAGGG + Intergenic
1032611941 7:133424321-133424343 CATTCCTTCTGGTGGGTTCGTGG - Intronic
1032876810 7:136046716-136046738 CATTCCTTCTGGAGTTTCTAGGG + Intergenic
1032894242 7:136233292-136233314 CATTCTTTCTGGAGGCTTCAGGG - Intergenic
1033135681 7:138782178-138782200 GGTTCCCTCTGAAGGCTGTGAGG + Intronic
1033151927 7:138922037-138922059 GCTTCCTTCTGAAGCCTGTGAGG - Intronic
1033466199 7:141592259-141592281 TGTTCCTTCTGGAGGCTCTAGGG + Intronic
1033472035 7:141658933-141658955 TTTTCCTTCTGGTGGCTATGAGG - Exonic
1033550135 7:142439366-142439388 CATTCCTTCCTGAGGCTCTAGGG + Intergenic
1033563760 7:142558989-142559011 CATTCCTTCCCGAGGCTCTCAGG + Intergenic
1033814672 7:145057429-145057451 CATCCCTTCTGGAGGCTCTGGGG + Intergenic
1033869407 7:145732307-145732329 CATTCCTTCTGAAAGCTTTAAGG - Intergenic
1034220514 7:149441461-149441483 TATTCCTTCTGGAGGATGTTCGG + Intronic
1034472950 7:151265370-151265392 GGTTCCTTCTGAAGGCTGTGAGG - Intronic
1034679234 7:152915909-152915931 CATTGCTGTTGGTGGCTGTGCGG + Intergenic
1034695681 7:153051230-153051252 ATTTCTTTCTGGAGGCTCTGGGG - Intergenic
1034715340 7:153236349-153236371 GGTTCCTTCTGGGGACTGTGAGG + Intergenic
1036000186 8:4593995-4594017 CACACCTTCTGGAGGTTGTTGGG + Intronic
1036152661 8:6313112-6313134 TGTTCCTTCTGGCGGCTCTGGGG - Intergenic
1037069560 8:14626757-14626779 GGTTCCTTCTGAGGGCTGTGAGG - Intronic
1037226920 8:16603303-16603325 CATTCCTTCTGGAGACCCTAGGG - Intergenic
1037232967 8:16681859-16681881 GGTTCCTTCTGGAGGCTCTGAGG + Intergenic
1037420667 8:18698577-18698599 TATTCCTTCTGGAGGCTCGAGGG - Intronic
1037574055 8:20184424-20184446 CATTCCTTCTGGAGATTCTGGGG + Intergenic
1037578934 8:20233317-20233339 GGTTCCTCCTGCAGGCTGTGAGG - Intergenic
1037600015 8:20385930-20385952 CATTGCTGGTGGAGGGTGTGGGG + Intergenic
1038062076 8:23924981-23925003 CACTCCCTCTGGAGGCTCTAGGG + Intergenic
1038177727 8:25196193-25196215 CATTATTTCTGGAGGCTTTATGG + Intronic
1038403958 8:27308121-27308143 CATTCCTTTTGGAGGCTCCAGGG - Intronic
1038915343 8:32015000-32015022 CGTTCCTTTTGCATGCTGTGAGG - Intronic
1039073852 8:33670993-33671015 TATTTCTTATGGAGGCTGTGGGG - Intergenic
1039124061 8:34180990-34181012 CATTCCTTTTTATGGCTGTGTGG - Intergenic
1039134563 8:34306208-34306230 TATTCCTTCTGGAGGCTTCGGGG + Intergenic
1039135369 8:34316699-34316721 CATTTCTTCTGGAGGCTTCAGGG + Intergenic
1039862150 8:41468278-41468300 GGTTCCTCCTGGAGGATGTGAGG - Intergenic
1040324114 8:46332935-46332957 TCTTCCTTCTGGTGGGTGTGTGG - Intergenic
1040896556 8:52374405-52374427 GCTTCCTTCTGGAGGCTCCGAGG - Intronic
1040902722 8:52433479-52433501 GGTTCCTTCTGGAGGCCCTGAGG + Intronic
1041173577 8:55170483-55170505 TGTTCCTTCTGCAGGCTCTGGGG - Intronic
1041190937 8:55353482-55353504 CATTCCTCCTGAAGTCTGTAAGG - Intronic
1041353737 8:56977291-56977313 AGTTTCTTCTGGAGGCTTTGAGG + Intronic
1041440311 8:57888070-57888092 TGGTCCTTCTGGAGGCTGAGGGG - Intergenic
1041459969 8:58100513-58100535 GGTTCCTTCTGGGGGCTCTGAGG + Intronic
1041660102 8:60392954-60392976 GGTTCCTTCTGGGGGCTGTGAGG - Intergenic
1041731950 8:61071317-61071339 GGTGCCTTCTGGAGGCTGTAGGG + Intronic
1041774855 8:61512492-61512514 TGTTCCTTCTGGAGGCTCTAAGG - Intronic
1041865431 8:62567728-62567750 CATTCCTTCTGGAGGCCATAGGG - Intronic
1041958444 8:63583367-63583389 GGCTCCTTCTGAAGGCTGTGAGG - Intergenic
1042062894 8:64840395-64840417 AGTTCCTTCTGGAGGCTCTGGGG - Intergenic
1042069487 8:64915148-64915170 CATTTCTTCTGGAGGCTCCAGGG - Intergenic
1042076018 8:64995687-64995709 CATTAATTCTGGAGCATGTGTGG + Intergenic
1042353981 8:67805898-67805920 TAGGCCTTCTGCAGGCTGTGTGG - Intergenic
1042460128 8:69055967-69055989 GATTCCTTCTGGAAGCTCTTTGG + Intergenic
1042874183 8:73425443-73425465 GGTTCCTTCTGAAGGCTGTGAGG - Intronic
1043305457 8:78787929-78787951 GGTTCCTTTTGGAGGCTCTGTGG + Intronic
1043534850 8:81191330-81191352 TGTTCCTTCTGGAGGCTTTTGGG - Intergenic
1043761225 8:84070604-84070626 GAGTCTTTCTGGAGGCTCTGGGG - Intergenic
1043821187 8:84867068-84867090 GGTTCCTTCTGATGGCTGTGAGG + Intronic
1043878715 8:85516513-85516535 GATTCGTTCTTGAGGCAGTGAGG + Intergenic
1043926458 8:86042307-86042329 GGTTCCTTCAGGAGGCTCTGAGG - Intronic
1043993340 8:86782425-86782447 GGTTCCTTCAGGAGGCTCTGAGG + Intergenic
1044237838 8:89852412-89852434 CATTCCTTCTGGAGGCTCCAGGG + Intergenic
1044279385 8:90338541-90338563 CATTGCTTCTGGAGACTCTAGGG + Intergenic
1044464662 8:92489198-92489220 GGTTCCTTCTGGAGGCTCTGAGG + Intergenic
1044478752 8:92660029-92660051 CATTCCTTCAGGAGGCTCTCCGG - Intergenic
1044725906 8:95193999-95194021 CATTCCTTCCAGAGGCTCCGGGG - Intergenic
1044742052 8:95337433-95337455 CATTCCCTCAGGAGGGGGTGGGG + Intergenic
1044826990 8:96208192-96208214 CACTCCTTCTGGAAGCTTTGGGG + Intergenic
1044855039 8:96467136-96467158 CGTTTCTTCTGGAAGCTCTGAGG - Intergenic
1044879408 8:96707800-96707822 CATTCCTTCTGGAGGCTCTAGGG + Intronic
1045249992 8:100475131-100475153 GGCTCCTTCTGGAGGCTCTGAGG - Intergenic
1045391247 8:101716969-101716991 TGTTCCTTCTGGAGGCTGTTGGG - Intronic
1045406266 8:101869419-101869441 CATTCCTTCTGGATGCCCTATGG - Intronic
1045486158 8:102633287-102633309 GATTCCTTCTGGAGGCTCTAAGG - Intergenic
1045504106 8:102766629-102766651 CATTCCTTCTGGAGGTGCTGGGG + Intergenic
1045548353 8:103148340-103148362 GGTTCCTTCTGGAGGCCCTGAGG - Intronic
1045662937 8:104456837-104456859 CATTTCTTCTGGAAGCAGTGTGG - Intronic
1046070595 8:109248221-109248243 CATTCATTCTGGAGGCTCTAGGG - Intronic
1046097768 8:109580740-109580762 CCTTTGTTCTGGAGGCAGTGGGG - Intronic
1046201759 8:110936496-110936518 TTTTCCTTCTGGAGGCTCTAGGG + Intergenic
1046380707 8:113446290-113446312 GATTCTTTCTGGAGGCTCTGGGG - Intergenic
1046526208 8:115385123-115385145 CATTCCCTCTGGAGGCTCTAGGG - Intergenic
1046556271 8:115777047-115777069 GCTTCCTTCTGGAGTCTCTGGGG + Intronic
1046692249 8:117298956-117298978 CATTCCTTCTGGAGGCTCCAGGG - Intergenic
1047022914 8:120795740-120795762 GGTTCCTTCTGAAGACTGTGAGG + Intronic
1047054761 8:121151723-121151745 CACTCCTTCTGGAGGCTCCAGGG + Intergenic
1047063455 8:121253420-121253442 CACTCCCTCTGGAGGCCGTCAGG + Intergenic
1047285523 8:123484419-123484441 CATTGCTTCTGGAGGTTCTAGGG - Intergenic
1047295874 8:123570151-123570173 GGTTCCTTCTGGAGGCTGTAGGG - Intergenic
1047324719 8:123825264-123825286 GGTTCCTTCTGGAGGCTCTGGGG - Intergenic
1047349040 8:124055827-124055849 TGTTCCTTCTGGAGGCTCTAGGG + Intronic
1047356306 8:124125461-124125483 CCTTCCCTCTGGAGGCTTTAGGG + Intergenic
1047407166 8:124595397-124595419 CATTCCTTCTGGAGGCTGCAGGG + Intronic
1047559546 8:125971895-125971917 GATTCCTTCTGCAGGCTGTGAGG + Intergenic
1047584636 8:126257940-126257962 CATTGCTTCTGGAGGCTCTGGGG + Intergenic
1047655236 8:126970220-126970242 CATTCCTCCTGGAGGCTCCATGG + Intergenic
1047814303 8:128445796-128445818 GGTTCCTTCTGCAGGCTGTGAGG + Intergenic
1047905924 8:129473252-129473274 CATTCTTTCTGGAGGCTCTGGGG - Intergenic
1048217881 8:132513386-132513408 CATTTCTTCTGGAGGCTGTAGGG + Intergenic
1048323589 8:133421551-133421573 CACTCCTTCTGGAAGCCTTGGGG - Intergenic
1048356210 8:133656105-133656127 CATTCCTCCTGGATGCTCTAGGG + Intergenic
1048440103 8:134453444-134453466 CATCCCTTCTGGAGGCTCCAGGG + Intergenic
1048450259 8:134527223-134527245 TATTCCTTCTGGAGACTCTAGGG - Intronic
1048752898 8:137699811-137699833 CAAGCTTTCTGGAGGCTGAGGGG + Intergenic
1048756255 8:137741410-137741432 TATTCCTTCTGGTGGGTTTGTGG - Intergenic
1048837646 8:138536742-138536764 GGTTCCTTTTGGAGGCTGTCGGG - Intergenic
1049402912 8:142438403-142438425 GGCTCCTTCTGGAGGCTCTGGGG + Intergenic
1049827033 8:144675542-144675564 CATTCCTTCCGGTGGGTTTGTGG + Intergenic
1050164094 9:2746344-2746366 GGTTCCTTCTGAAGGCGGTGAGG - Intronic
1050715138 9:8515736-8515758 GGTTCCTTTTGAAGGCTGTGAGG - Intronic
1050931112 9:11327949-11327971 AATTTCTTCTGGAGGCTATAAGG + Intergenic
1051002907 9:12306898-12306920 GCTTGCTTCTGAAGGCTGTGAGG + Intergenic
1051301741 9:15658758-15658780 CATTCCTTCTGGAGACTCTAGGG - Intronic
1051310635 9:15767253-15767275 TATTCCTTCCGGAGGCTGTAAGG + Intronic
1051347424 9:16164794-16164816 TGTTCCTTCTGGGGGCTCTGAGG - Intergenic
1051510644 9:17874283-17874305 CATTCCTTCTGGAGGCTCTAGGG - Intergenic
1051599569 9:18859218-18859240 GTTTCCTTCTGGAGGCTCTACGG + Intronic
1051667004 9:19475094-19475116 GGTTCCTTCTGAGGGCTGTGAGG + Intergenic
1051704002 9:19857115-19857137 AGTTTCTTCTGGAGGCTGTCAGG + Intergenic
1051724302 9:20072818-20072840 GCTTCCTTCTGAAGGCTGTGAGG - Intergenic
1051784653 9:20729221-20729243 GATTCCTTCTGGAGGCTCTGTGG + Intronic
1052278143 9:26702078-26702100 CATTCCTTCTGGAGGCTCAAAGG - Intergenic
1052415330 9:28170662-28170684 CATTCCTTCTTGAGGCCATAGGG + Intronic
1052684954 9:31743934-31743956 CATTCTTTCTGGAGGCTCTAAGG + Intergenic
1053049854 9:34951596-34951618 TATTCCTTCTGGAGGCTCTTGGG - Intergenic
1053214733 9:36260987-36261009 CCTTCCTACTGGAGGCTGCCAGG + Intronic
1053480421 9:38412696-38412718 CATTCTTTCTGAAGGCTCTCAGG + Intronic
1053529713 9:38868222-38868244 GGTTCCTTCTGAAGGCTTTGAGG - Intergenic
1054201938 9:62092649-62092671 GGTTCCTTCTGAAGGCTTTGAGG - Intergenic
1054636419 9:67495710-67495732 GGTTCCTTCTGAAGGCTTTGAGG + Intergenic
1054727441 9:68666370-68666392 GGTTCCTTCTGGGGGCCGTGTGG + Intergenic
1054734469 9:68736573-68736595 CACTCCTTCTGGAGGCTCCAGGG + Intronic
1054736822 9:68761575-68761597 CCTTCCTTTTGGAGGCTCTGGGG + Intronic
1054760537 9:69000524-69000546 GATTCCTTCTGAGGGCTGTGAGG + Intronic
1055054953 9:72014983-72015005 GATTCCTTCTGAGGGCTGTGAGG + Intergenic
1055567949 9:77587896-77587918 TGTTCCTTCTGGAGGCTCTAAGG + Intronic
1055710835 9:79060380-79060402 GTCTCCTTCTGGAGGCTCTGGGG + Intergenic
1055722063 9:79186198-79186220 CATTCCTTCTGGAAGCTCTGGGG + Intergenic
1056069527 9:82971714-82971736 CCTTCCTTCTAGAGGCTCTAGGG - Intergenic
1056198358 9:84250420-84250442 CATTCCTTCTGGAGGCTCTGGGG - Intergenic
1056224616 9:84482958-84482980 CATTCATTCCGGAGTATGTGAGG + Intergenic
1056289699 9:85130259-85130281 CCTTCCTCCAGGAGGCTGTTGGG - Intergenic
1056478839 9:86980495-86980517 CATTCCTTCTGGAGGCTTTGGGG + Intergenic
1056897426 9:90564013-90564035 CAATCTTTCTGAAGGCTGGGAGG + Intergenic
1056983780 9:91342153-91342175 CATTCCTTCTGGAGGCACTAGGG + Intronic
1057029972 9:91768152-91768174 GGTTCCTTCTGAAGGCTCTGGGG - Intronic
1057166524 9:92931528-92931550 GGTTCCTTCTGGAGGCTTTGGGG - Intergenic
1057786731 9:98093605-98093627 CATTCATTCTGCAGGTTCTGTGG - Intronic
1057839011 9:98470068-98470090 CATTCTCTCTAGAGGGTGTGGGG - Intronic
1057843950 9:98507469-98507491 GGTTCCTTCTGGAGGCTTTAGGG - Intronic
1057860595 9:98637735-98637757 CTTTCCTTCTGGAGGCTTTAGGG - Intronic
1057951998 9:99376645-99376667 CCCTCCCTCTGGAGGCTGTAGGG - Intergenic
1057994150 9:99804808-99804830 CATTCCCTCTGGAGGCTCTTTGG - Intergenic
1058065021 9:100539563-100539585 CGTTCCTTCTGGTGGGTTTGTGG + Intronic
1058082762 9:100716910-100716932 GGTTCCTTCTGAGGGCTGTGAGG + Intergenic
1058116558 9:101091407-101091429 CATGTCTTCTGGAGGCTCTGGGG + Intronic
1058175333 9:101729365-101729387 CATTCTTTCTGGAGCCTCTGAGG + Intronic
1058256131 9:102766303-102766325 CATTCCTTCTGGAGGCTCTGGGG - Intergenic
1058755843 9:108082533-108082555 GGTTCCTTCCGGAGGCTCTGAGG + Intergenic
1058884532 9:109313387-109313409 CACTCCTTCTGCAGCCTCTGTGG - Intronic
1058886194 9:109322891-109322913 CATTCCTTCTGGAATCTCTAGGG - Intergenic
1058918279 9:109588348-109588370 GATTCCTTCTGAAGGCCGTGAGG - Intergenic
1058935213 9:109763677-109763699 GGTTCCTTCTGGAGGCTCTAAGG + Intronic
1058974581 9:110114158-110114180 GGTTCCTTCTGGAGGCTTTGAGG + Intronic
1059030286 9:110686106-110686128 AGTTCCTTCTGGAGGCTCTAGGG + Intronic
1059246615 9:112854942-112854964 CATTCCTACTGCAGCCAGTGTGG - Intronic
1059485465 9:114623528-114623550 TTTTCTTTCTGGAGGCTCTGGGG + Intronic
1059486260 9:114629294-114629316 GCTTCCTTCTGAAGGCTCTGGGG + Intronic
1059573048 9:115460766-115460788 CATTCCTTCTGGAGCCCCTAGGG - Intergenic
1059591293 9:115665644-115665666 GAATCCTTCTGGAGGCTTTGAGG + Intergenic
1059603882 9:115811888-115811910 GATTCCTTCTGAGGACTGTGAGG - Intergenic
1059704794 9:116812501-116812523 CATTCCTTCTGGAGGCCTTAGGG - Intronic
1059867013 9:118526329-118526351 GGTTCCTTCTGGAAGCTCTGAGG - Intergenic
1059948478 9:119437642-119437664 TGTTCCTTCTGGAGGCTCTAGGG + Intergenic
1060308979 9:122442326-122442348 GGTTCCTCCTGGAGGCTCTGAGG + Intergenic
1060921442 9:127423312-127423334 CATTCCTTCTGGAGGTTCCAGGG - Intergenic
1060980897 9:127791210-127791232 GGTTCCTTCTGGAGGATCTGAGG + Intergenic
1061229645 9:129307460-129307482 CATTCCTTCTGGAAGCTCTAGGG - Intergenic
1061452902 9:130678229-130678251 CATTACTTCTGCTTGCTGTGAGG + Intronic
1061615695 9:131777301-131777323 CATTCCTGCTCTGGGCTGTGAGG - Intergenic
1061615959 9:131779092-131779114 CATTCCTTCTGGAGCCTCTAGGG - Intergenic
1061819840 9:133220993-133221015 GGTTCCTTCTGGAGGCTCTTGGG - Intergenic
1061915838 9:133753300-133753322 GGTTCCTTCTGGAGGCTCTAGGG + Intergenic
1062155237 9:135044600-135044622 GCTTCCTTCTGGAGGCTCTGGGG + Intergenic
1062240814 9:135536955-135536977 GGTTCCTTCTGGAGGCTCTTGGG + Intergenic
1062398154 9:136360861-136360883 CAGGCCCTCTGGAGGCAGTGAGG + Intronic
1062632127 9:137467937-137467959 CCTTCCTTCTGGAGGTACTGAGG + Intronic
1185455772 X:310058-310080 AGTTCCTTCTGGAGGCTCTAGGG - Intronic
1185455833 X:310398-310420 AGTTCCTTCTGGAGGCTCTAGGG - Intronic
1185511163 X:666122-666144 AGTTCCTTCTGGAGGCTCTAGGG - Intergenic
1185528000 X:794406-794428 TGTTCCCTCTGGAGGCTGTAGGG - Intergenic
1185536840 X:869227-869249 TCTTCCCTCTGGAGGCTGTAGGG + Intergenic
1185536890 X:869566-869588 AGTTCCTTCTGGAGGCTCTAGGG + Intergenic
1185579898 X:1203694-1203716 CATTCCCTCTGGAGGTTCTAAGG - Intronic
1185622012 X:1455771-1455793 GCTTCCTTCTGGAGGCTCTAGGG + Intergenic
1185666645 X:1770553-1770575 GGTTCCTTCTGGAGGCTCAGAGG - Intergenic
1185667356 X:1776466-1776488 GTTTACTTCTGGAGGCTTTGAGG - Intergenic
1185695262 X:2189261-2189283 GGTTCCTTCTGGAGCCTGTAAGG + Intergenic
1185798034 X:2983702-2983724 CATTCCCTCTGGAGACTCTAGGG + Intergenic
1185831068 X:3303554-3303576 AGTTCCTTCTGGAGGCTTTAAGG - Intergenic
1185837623 X:3360117-3360139 TGTTCCTTCTGGAGGCTCTTGGG + Intergenic
1185874960 X:3694566-3694588 AGTTCCTTCTGGAGGCTCTAGGG - Intronic
1185882606 X:3754869-3754891 GGTTCTTTCTGGAGGCTGTGGGG - Intergenic
1185911469 X:3984919-3984941 AGTTCTTTCTGGAGGCTGTAGGG + Intergenic
1186117717 X:6322360-6322382 CATTCCTTTTGGAGGCTCTAGGG - Intergenic
1186125050 X:6404347-6404369 CATTCCTTCTGGAAGTTCTAAGG - Intergenic
1186130011 X:6456304-6456326 GGTTCCCTCTGGAGGCTCTGAGG + Intergenic
1186169802 X:6864640-6864662 CGTTCATTCTGGAGGCTCTGGGG + Intergenic
1186197109 X:7120420-7120442 GTTCCTTTCTGGAGGCTGTGGGG - Intronic
1186200354 X:7149725-7149747 AATTCCTTCTGAGGGCTGTGAGG + Intergenic
1186292798 X:8118810-8118832 CCTTCCTTCTAGAGGCTCTAGGG - Intergenic
1186501614 X:10055347-10055369 CATTCCTTCTGGAGGTTCTGGGG - Intronic
1186577154 X:10778781-10778803 CCTTCCTTCTGGATGCTCTAGGG - Intronic
1186583875 X:10850636-10850658 GATTCTTTCTGGAGGCTCTAGGG - Intergenic
1186650252 X:11551853-11551875 GGTTCCTTCTGAAGGCTGTGGGG - Intronic
1186661450 X:11671639-11671661 GGTTCCTTCTGGAGGCTCTAAGG - Intergenic
1186703181 X:12113405-12113427 CATTCCTTCTGGAGGCTCTCAGG + Intergenic
1186730766 X:12406941-12406963 AGTTCCTTCTGGAGGCTCTAGGG + Intronic
1186765123 X:12762935-12762957 GAATCCTTCTGAAGGCTGTGAGG - Intergenic
1186769414 X:12803134-12803156 TATTCCTTTTGGAGGCTGCAGGG + Intronic
1186891296 X:13961535-13961557 TATTCCTTCTGGAGGCTTCAGGG - Intergenic
1186997412 X:15138758-15138780 CATTCCTTCTGGAAACTTTAGGG + Intergenic
1187024276 X:15417660-15417682 TATTCTTCCTGGAGGCTGTAGGG + Intronic
1187186515 X:16991892-16991914 CGTTCCTTCTAAGGGCTGTGAGG - Intronic
1187203782 X:17161574-17161596 GATACTTTCTGGAGGCTCTGGGG - Intergenic
1187333884 X:18365022-18365044 CATTCCTTTTGGAGGCTCTAGGG + Intergenic
1187468432 X:19546740-19546762 CATTCATTTTGGAGTCTGTATGG + Intronic
1187576866 X:20566110-20566132 CATTCCTTCTGGAGGCTCTAGGG + Intergenic
1187583844 X:20638249-20638271 CATTTCTTCTGGAGGCTTTAGGG - Intergenic
1187811975 X:23189517-23189539 GCTTCCTTCTAGAGGCTCTGAGG + Intergenic
1187971013 X:24658468-24658490 CATTTCTTCTGGAGGCTCTAGGG + Intronic
1188059661 X:25585432-25585454 TGTTTCTTCTGGAGGCTCTGAGG - Intergenic
1188092975 X:25986219-25986241 ATTTCCTTCTGGAGGCTGTAAGG - Intergenic
1188266860 X:28087667-28087689 AATTCCTTCTAGAGCCTCTGGGG + Intergenic
1188268938 X:28114522-28114544 TATTCCTTCTGGAGACTGGAGGG - Intergenic
1188277137 X:28214357-28214379 CATTCCTTCTGGAGACTCTAGGG - Intergenic
1188355271 X:29183006-29183028 CTTTCCTTCTGGAGGCTCTAAGG - Intronic
1188962789 X:36513241-36513263 CGTTCCTTCTGAAGATTGTGAGG - Intergenic
1189220789 X:39369935-39369957 GGTTCCTTCTGGAGGCTCTGAGG - Intergenic
1189230297 X:39447003-39447025 GGTTTCTTCTGAAGGCTGTGAGG + Intergenic
1189249222 X:39587171-39587193 GGTTCCTTCTGAGGGCTGTGAGG + Intergenic
1189302748 X:39964369-39964391 GGTTCCTTCTGAGGGCTGTGAGG + Intergenic
1189355494 X:40307177-40307199 GATTCCTTCAGGAGGCTCTGGGG - Intergenic
1189360313 X:40344870-40344892 CATTCCTCCTGGAGGCTCTAGGG + Intergenic
1189380210 X:40497319-40497341 CACTCCATCTGGAGGCTCTAGGG - Intergenic
1189559527 X:42177806-42177828 GGTTCCTTCTGAAGGCTGTGCGG + Intergenic
1189682413 X:43530193-43530215 CCTTCCTTCTGAAGGCTCTTAGG - Intergenic
1189708241 X:43781090-43781112 GACTTCTTGTGGAGGCTGTGTGG - Intronic
1189900554 X:45701797-45701819 AGTTTCTTCTGGAGGCTGTCAGG - Intergenic
1189947566 X:46194749-46194771 GGTTCCTTCTGGAGGCTCTGAGG - Intergenic
1189958585 X:46303259-46303281 CATTCTTTCCGGAGGCTCTGGGG - Intergenic
1190102093 X:47529615-47529637 GGTTCCTTCTGGGGGCTGTGAGG + Intergenic
1190118623 X:47642185-47642207 CGTTCCTTCTGGAGGCTCTAGGG - Intronic
1190133619 X:47773720-47773742 GATTCCTTTTAGAGGCTCTGGGG - Intergenic
1190143758 X:47871844-47871866 CAGTTCTTCTGGATGCTGTTGGG - Intronic
1190250595 X:48721581-48721603 CATTACTCCTGGAGGCTCTAGGG + Intergenic
1190284041 X:48950425-48950447 CACTCCTTCTGGAAGCTCTCAGG - Intronic
1190299645 X:49049508-49049530 CACTCCCTCTGGAGGCTATAAGG - Intergenic
1190359447 X:49635215-49635237 GATTCCTTCTGAGGGCTATGAGG + Intergenic
1190373691 X:49767225-49767247 CATTCCTAATGGGGGCTGAGGGG + Intergenic
1190517007 X:51234255-51234277 CATTCCTTCTGGAGGCTCTAGGG - Intergenic
1190528579 X:51352467-51352489 CATTTCTTCTGGAGGCTTCTGGG + Intergenic
1190576685 X:51846450-51846472 CATTACTTCTGGAGGCTTTTGGG - Intronic
1190622673 X:52303608-52303630 GGTTCCTTTTGGAGGCTCTGAGG + Intergenic
1191870894 X:65743927-65743949 CATTTCTTCTGGAGGCTCTAGGG - Intergenic
1191882633 X:65857851-65857873 CATTCCTTCTTGAAGCTCTAGGG + Intergenic
1192360509 X:70435812-70435834 CCATCCTTATGAAGGCTGTGGGG - Intergenic
1192456387 X:71279628-71279650 TATTCCTTCTAGAGGCTCTAGGG - Intergenic
1192531328 X:71889351-71889373 TGTTCCTTCTGGAGGCTCTAGGG - Intergenic
1192534062 X:71912530-71912552 CAGTCCTTCTGGAAGGGGTGGGG - Intergenic
1192607076 X:72529506-72529528 CATTTTTTCTGGAGGCTCTAGGG - Intronic
1192617554 X:72643517-72643539 GATTCCTTCTGGAGGCTCCAGGG + Intronic
1193212119 X:78819654-78819676 GGTTCCTTCTGGGGGATGTGAGG + Intergenic
1193525618 X:82584524-82584546 GGTTCCTTCTGAAGGCTCTGAGG + Intergenic
1194017427 X:88640612-88640634 GCTTCTTTCTGGAGGCTCTGAGG - Intergenic
1194185189 X:90766376-90766398 CATTCCTTCCGGTGGGTTTGTGG - Intergenic
1195027243 X:100889694-100889716 TGTTCCTTTTGGGGGCTGTGAGG - Intergenic
1195381486 X:104275137-104275159 GATTTCTTCTGGAAGCTGTGGGG + Intergenic
1195970918 X:110472336-110472358 TATTCCTTCTGGAGGTTCTAGGG - Intergenic
1196323446 X:114371820-114371842 CATTCCTTCTAGAGGCTCTAGGG + Intergenic
1196367159 X:114936053-114936075 GGTTCTTTCTGGAGGTTGTGAGG - Intergenic
1197140412 X:123111647-123111669 CATTCCTTCTGGAGGTTCTAGGG + Intergenic
1197286669 X:124603117-124603139 CACTCCCTCTGGAGACTCTGGGG - Intronic
1197721319 X:129746632-129746654 GATTCCTGCTGGAGGGCGTGTGG + Exonic
1197863746 X:130996892-130996914 GGTTCCTTCTGGAGGCTCTGAGG - Intergenic
1198686573 X:139233853-139233875 GGTTCCTTCTGAAGGCTCTGAGG + Intergenic
1198692772 X:139302431-139302453 TGTTCCTTCTGGAGGCTCTAGGG - Intergenic
1198813206 X:140557826-140557848 CACTCCTTCTGGAGCCCTTGGGG - Intergenic
1198874432 X:141207788-141207810 GCTTCCTTCTGGGGGTTGTGAGG - Intergenic
1198959231 X:142166453-142166475 GATTCCTTCTGAGGGCTGTGAGG + Intergenic
1199115679 X:143989291-143989313 GGTTCCTTCTAGAGGCTCTGAGG + Intergenic
1199297403 X:146174679-146174701 TTTTCCTTCTGGAGGCTCTAGGG + Intergenic
1199510026 X:148611509-148611531 CATTCCTTCTGGAGGCTCTAGGG + Intronic
1199670988 X:150148159-150148181 GATTTCTTCTGAAGGCTGTGAGG + Intergenic
1199675670 X:150187237-150187259 CATTCCTTCTAGAGGCTCTAGGG + Intergenic
1199703079 X:150399717-150399739 GATTCCTTCTGGAGGCTCTGAGG - Intronic
1199750254 X:150809120-150809142 CATTCCTTTTGGAGACTCTAGGG - Intronic
1199764318 X:150929876-150929898 CATTCCTGCTGGAGGCCTAGGGG + Intergenic
1199809963 X:151339410-151339432 CATTCCCTCTGAAGGCTCTAGGG + Intergenic
1199981253 X:152921674-152921696 GGTTCCTTCTGGAGGCTTTGAGG + Intronic
1199990000 X:152982136-152982158 GGTTCCTTCTGAGGGCTGTGAGG + Intergenic
1200254638 X:154573567-154573589 GGTTCCTACTGGAGGCTCTGTGG + Intergenic
1200263131 X:154630841-154630863 GGTTCCTACTGGAGGCTCTGTGG - Intergenic
1200275164 X:154725131-154725153 GGTTCCTTCTCAAGGCTGTGAGG - Intronic
1200325133 X:155230127-155230149 GATTCCTTCTGAGAGCTGTGAGG + Intronic
1200393356 X:155967074-155967096 CATGCCATCTGGTGGCTGTCAGG - Intergenic
1200531809 Y:4348463-4348485 CATTCCTTCCGGTGGGTTTGTGG - Intergenic
1200782387 Y:7228446-7228468 GGTTCTTTCTGGAGGCTGTGGGG + Intergenic
1200784345 Y:7246611-7246633 TCTTCCTTCTGGAGGGTTTGTGG + Intergenic
1200875941 Y:8154966-8154988 CCTTCCTTGTGGAGGATGTTAGG - Intergenic
1201429328 Y:13889091-13889113 CATTCCTCCTGGTGGGTTTGTGG - Intergenic
1201560147 Y:15307210-15307232 CATTTATTCTGGAGGATCTGTGG + Intergenic
1201606772 Y:15794483-15794505 CATTCCTTCTGGAAGTTCTAAGG - Intergenic
1201907462 Y:19100358-19100380 CATTCCTTCTGGTGGGTTTGTGG + Intergenic
1202090565 Y:21184051-21184073 CATTCCTTCTGGTGGGTTTGTGG - Intergenic
1202379539 Y:24263349-24263371 CATTCTGTCTTGGGGCTGTGAGG - Intergenic
1202491243 Y:25406772-25406794 CATTCTGTCTTGGGGCTGTGAGG + Intergenic