ID: 1018214033

View in Genome Browser
Species Human (GRCh38)
Location 6:161509480-161509502
Sequence GCACCTGTGCTGTTTAAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 119}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018214030_1018214033 4 Left 1018214030 6:161509453-161509475 CCAGGTGGGCATGGTGGCAGATT 0: 1
1: 0
2: 1
3: 48
4: 437
Right 1018214033 6:161509480-161509502 GCACCTGTGCTGTTTAAAGGAGG 0: 1
1: 0
2: 0
3: 16
4: 119
1018214024_1018214033 23 Left 1018214024 6:161509434-161509456 CCTGGAGAATAGGGGGCAGCCAG 0: 1
1: 1
2: 1
3: 31
4: 250
Right 1018214033 6:161509480-161509502 GCACCTGTGCTGTTTAAAGGAGG 0: 1
1: 0
2: 0
3: 16
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018214033 Original CRISPR GCACCTGTGCTGTTTAAAGG AGG Intronic
900836811 1:5011088-5011110 GCACCGGCCCTGTTTAAACGCGG + Intergenic
901786540 1:11628673-11628695 CCACCTGTGATGTTAAAAAGTGG + Intergenic
902004984 1:13225165-13225187 ACACCTGTGCTGTACTAAGGTGG - Intergenic
902024208 1:13370959-13370981 ACACCTGTGCTGTACTAAGGTGG - Exonic
902334463 1:15747094-15747116 GCTCCTGGGCTGTTTGAAGCAGG - Intronic
904495028 1:30881736-30881758 GCAGTTGTGATGCTTAAAGGAGG - Intronic
908074926 1:60506201-60506223 GTACCTCTGCTGATGAAAGGTGG + Intergenic
909206379 1:72762820-72762842 TCACATATACTGTTTAAAGGGGG - Intergenic
910241747 1:85094023-85094045 GCTGCTGAGCTCTTTAAAGGAGG - Intronic
915661797 1:157411113-157411135 GGACCTGAGCTGCTTTAAGGAGG + Intergenic
918231302 1:182535191-182535213 GCATCTGTGATGGGTAAAGGGGG - Intronic
921508220 1:216000464-216000486 GCAGCTGTGCTGTGTACAGTAGG + Exonic
923291212 1:232547941-232547963 ACATCTGTGCTGTGCAAAGGTGG + Intronic
923624280 1:235601516-235601538 GCACCTGAGCTCTTTGAGGGCGG - Intronic
1062761791 10:28133-28155 GCAGCTGTGCTGTGTTATGGGGG - Intergenic
1065224380 10:23528109-23528131 GCAAATGGGCTGTATAAAGGAGG - Intergenic
1065409237 10:25404930-25404952 CCACATGTGCTGTCCAAAGGTGG - Intronic
1067384236 10:45804090-45804112 GCACCTGTGCAGGTTAAGAGAGG - Intergenic
1069292517 10:66798425-66798447 GCACAGGTGGTGTTTAAAGGTGG + Intronic
1073956354 10:108875903-108875925 GCAGCTCTGCTGTTTTAAGATGG + Intergenic
1076278655 10:129226210-129226232 CCATCTCTTCTGTTTAAAGGAGG + Intergenic
1077815919 11:5685179-5685201 GTAGCTGTGCTGTTCACAGGAGG + Intronic
1078151726 11:8765273-8765295 GCACTTGCTCTGTTTAAAGGAGG - Intronic
1078326065 11:10381814-10381836 CCACATGTACTGCTTAAAGGAGG + Intronic
1080888463 11:36388015-36388037 GCACCTGCCCTGGCTAAAGGAGG - Intronic
1082100431 11:48168978-48169000 ACACCTGTCCTGTTTACAGCAGG - Intronic
1084206773 11:67599293-67599315 GGACCTGTGGTTTTTAATGGTGG + Intergenic
1085721511 11:78916083-78916105 GCCACTGTGCTGTTTGAATGAGG - Intronic
1092753502 12:11741223-11741245 GCACCTGTGCCATTTTAAAGGGG - Intronic
1093093763 12:14949769-14949791 ACATCTGTACTGTTCAAAGGGGG - Intronic
1095062800 12:37721058-37721080 GCTGCTGTGCTGTTTTAATGTGG - Intergenic
1099162188 12:79256261-79256283 ACACCTGTGCTGTTGAAAATTGG - Intronic
1099375155 12:81889770-81889792 GCACCTGCACTGCTTAAATGAGG - Intergenic
1101815410 12:108142334-108142356 GTACCTGTGGTGTTTTGAGGAGG - Intronic
1111380779 13:87448275-87448297 GCATATGTGCTGTATAAATGGGG - Intergenic
1115322058 14:32092621-32092643 GCACCCATGTGGTTTAAAGGCGG - Exonic
1120130899 14:80806558-80806580 GCAACTCTGATGTTTAAAGTAGG + Intronic
1121956754 14:98220268-98220290 GCACATGTTCTGTCTAAATGGGG + Intergenic
1121994059 14:98588333-98588355 GCTGCTGTGCTGATTAAATGAGG - Intergenic
1122875925 14:104664827-104664849 GCACCTGTGCTGGCTAAAAGGGG + Intergenic
1128449736 15:67798346-67798368 GCCACTGGCCTGTTTAAAGGGGG - Intronic
1129094000 15:73183357-73183379 ACCCCTGTGCTGCTTAGAGGAGG + Intronic
1131081724 15:89542190-89542212 GCCCCTGGGCTGATGAAAGGGGG + Intergenic
1131423718 15:92328381-92328403 ACACCTGTGTTGTGTAAGGGAGG - Intergenic
1140278263 16:73530396-73530418 ACACCTGAGCTGCTTAGAGGAGG - Intergenic
1141496088 16:84410666-84410688 TCAGATGTGCTGTTTAAAGGTGG - Intronic
1144849404 17:18236437-18236459 GTACCTGTGCTGTCTACAGTAGG + Intronic
1145214667 17:21042742-21042764 GCACCTGGGCAGCTTCAAGGTGG - Exonic
1147713372 17:42486630-42486652 GCACCTGTGATCTTTACAGGGGG - Intronic
1149547426 17:57514145-57514167 GCCCCTGTACTATTTCAAGGGGG + Intronic
1151384113 17:73744695-73744717 GCACCTGTGCTGTGCAGAGCTGG - Intergenic
1152954698 18:28463-28485 GCAGCTGTGCTGTGTTATGGGGG - Intergenic
1153070072 18:1095536-1095558 CCATCTGTGCTGTTTGTAGGGGG + Intergenic
1153136421 18:1922678-1922700 GCTGCTGCTCTGTTTAAAGGAGG - Intergenic
1153897164 18:9575351-9575373 GCCACTGTGCTATTTAAGGGAGG + Intronic
1157323878 18:46655566-46655588 GCACATGTACTGTTAGAAGGTGG + Intronic
1159335698 18:67062810-67062832 GCATCTGTTCTGACTAAAGGTGG + Intergenic
925148302 2:1597458-1597480 GCATCTGTGCTGTTTGCATGTGG - Intergenic
926074952 2:9935100-9935122 GAACCTATGATCTTTAAAGGTGG - Intergenic
927662042 2:25001434-25001456 ACACCTGTCCTGTTGAAAAGGGG + Intergenic
933025077 2:77246425-77246447 GCATCTGTGCTGTTCAAAATTGG + Intronic
933913803 2:86968250-86968272 TCACCTGTACTTTTTAAAGTAGG + Intronic
934009190 2:87801648-87801670 TCACCTGTACTTTTTAAAGTAGG - Intronic
935772776 2:106442354-106442376 TCACCTGTACTTTTTAAAGTAGG - Intronic
935907294 2:107853571-107853593 TCACCTGTACTTTTTAAAGTAGG + Intronic
935993692 2:108745730-108745752 TCACCTGTACTTTTTAAAGTAGG + Intronic
936075442 2:109398707-109398729 GCCCCTGAGCTGCTTAAAGTGGG - Exonic
936129084 2:109818713-109818735 TCACCTGTGCTTTTTAAAGTAGG + Intronic
936215613 2:110552772-110552794 TCACCTGTGCTTTTTAAAGTAGG - Intronic
936247260 2:110839090-110839112 ACAGCTGTGCTGGTTAAAGGGGG - Intronic
936424750 2:112407345-112407367 TCACCTGTGCTTTTTAAAGTAGG - Intronic
937349840 2:121153844-121153866 GCACCTCTGCTGTGTGAAGTGGG + Intergenic
937607588 2:123820091-123820113 GGAACTGTGCTGGTTAAAAGTGG + Intergenic
938015719 2:127865441-127865463 GCACGTGTAGTGTTTCAAGGTGG - Intronic
939290504 2:140188350-140188372 GCAAATGTGGTGTTTAATGGAGG - Intergenic
940235278 2:151504828-151504850 GCACCTGTGCAGTTTATTGCAGG - Intronic
1172505670 20:35460474-35460496 GCACATGCCCTGTCTAAAGGGGG + Intronic
1180633572 22:17246727-17246749 GCACCAGCTCTGTCTAAAGGGGG - Intergenic
1181733657 22:24865700-24865722 ACACCTGTGCAGGTTAAGGGAGG + Intronic
1182658236 22:31906507-31906529 GCACCTGTGCTGGGGGAAGGTGG + Exonic
1184881260 22:47305740-47305762 TCACCAGTGGTGTTTAGAGGGGG - Intergenic
952645272 3:35649721-35649743 GCACCTGTTCTGCTTAAAGCAGG - Intronic
956201019 3:66706032-66706054 GCATCTGCGCTGTTTTAAGGGGG + Intergenic
956344934 3:68268284-68268306 GCACCATTTCAGTTTAAAGGAGG + Intronic
957165368 3:76665531-76665553 GCATCTGTGCTGTTGAAATCTGG - Intronic
957347393 3:78979703-78979725 GGAGCTCTGCTGTTTTAAGGGGG + Intronic
957962626 3:87278363-87278385 ACACCTGTTCTGTTAAAATGAGG + Intergenic
958002582 3:87769851-87769873 GCTCCTGTGCTTTTTTGAGGAGG + Intergenic
959256278 3:104019159-104019181 GCAGCTGTGCTGTATTATGGGGG - Intergenic
961049967 3:123737692-123737714 GCCCCTGAACTGTTTAAAGTTGG - Intronic
961392010 3:126557858-126557880 ACACCAGTGCTGGCTAAAGGGGG + Intronic
963044500 3:141092822-141092844 ACACCTGTGCTGCTGCAAGGAGG + Intronic
964674403 3:159261558-159261580 GCACCTCTTCTGAGTAAAGGGGG - Intronic
967803876 3:193695983-193696005 GCATCTGTGCTGCTTAAGGCTGG - Exonic
968359022 3:198133675-198133697 GCAGCTGTGCTGTGTTATGGGGG + Intergenic
969437405 4:7196305-7196327 GCAGCGGTGCTATTTGAAGGTGG + Intronic
970653602 4:18205274-18205296 GCACCTTTGCTGTTAAATGATGG + Intergenic
978143889 4:105349253-105349275 GCAGTTGTGGTGTTTAGAGGTGG - Intergenic
984665595 4:182425155-182425177 GCTGCTGTGCTGTTTAAAAATGG + Intronic
987072001 5:14346522-14346544 GCACTTGTGCTTTTTAAAGAAGG + Intronic
994361884 5:98861142-98861164 GGACCTGAACTGTTTAAAAGAGG - Intronic
994943386 5:106354391-106354413 GTACAAGTGCTGTTTAAAAGTGG - Intergenic
1000045203 5:157516585-157516607 CCAGCTGCTCTGTTTAAAGGTGG - Intronic
1000509611 5:162165108-162165130 GCAGCTGTGCTGTGCAGAGGTGG - Intergenic
1006604678 6:35247691-35247713 GCAGCTGTTCTGATTAAAGTGGG + Intronic
1008337176 6:50321617-50321639 GCACCTTGGCTATTTAAAAGGGG - Intergenic
1008537292 6:52516435-52516457 TCCCATGTGCTGATTAAAGGAGG + Intronic
1013408715 6:109865473-109865495 GCACCTGTCCTGTGCAAAGCAGG + Intergenic
1014095673 6:117457936-117457958 GCACCTGAGGTAATTAAAGGAGG - Intronic
1017711185 6:157169818-157169840 GCTCCTGTGCTATTTATAGGTGG - Intronic
1018214033 6:161509480-161509502 GCACCTGTGCTGTTTAAAGGAGG + Intronic
1019430162 7:995376-995398 GCATCTGTGCTGTCGAAGGGAGG + Intergenic
1020398011 7:7739511-7739533 GCACCTTTGCTGTCTAAAAATGG + Intronic
1020434729 7:8150793-8150815 GCAGCTGTATTTTTTAAAGGTGG + Intronic
1028159731 7:87472161-87472183 GCACCTGTGCTGTATAAGTTTGG - Intronic
1029177430 7:98674916-98674938 GCACCTGGGCTGGTTAAACAAGG - Intergenic
1031067081 7:117116643-117116665 GGACCTCTGCTGTGTACAGGGGG - Intronic
1031205437 7:118751259-118751281 ACACCTGTGCAGCTTAGAGGAGG - Intergenic
1032223154 7:130009324-130009346 GCACCTGTGCTGTCTGATGGTGG + Intergenic
1033717034 7:144012994-144013016 CCACCTCTGCTGTTTGAAGTAGG - Intergenic
1035077274 7:156189027-156189049 GCACCTTTGCTGCTTTAAGTTGG + Intergenic
1035288226 7:157819646-157819668 GCACCTGCGCTGCCAAAAGGAGG - Intronic
1038018838 8:23536288-23536310 GAACATGTGTTGTTTTAAGGAGG - Intronic
1038536181 8:28354237-28354259 GCAGATGTGCTGTTTAAAAACGG - Intronic
1042837494 8:73091822-73091844 GCCTCTGTGCTGTTTGAAGAGGG - Intronic
1044100110 8:88124591-88124613 GCAGCTGTGTTCTTTGAAGGTGG - Intronic
1044478235 8:92653779-92653801 ACACCAGTGCTGTTGGAAGGTGG + Intergenic
1046633515 8:116645979-116646001 GGACCTCTCCTGCTTAAAGGTGG + Intronic
1048938946 8:139380128-139380150 ACACCTGAGCTGTTTAGGGGAGG + Intergenic
1057528441 9:95823231-95823253 GCATCTGTGCTTCTTACAGGAGG - Intergenic
1062743155 9:138192809-138192831 GCAGCTGTGCTGTGTTATGGGGG + Intergenic
1062743403 9:138194810-138194832 GCAGCTGTGCTGTGTTATGGGGG + Intergenic
1062743652 9:138196811-138196833 GCAGCTGTGCTGTGTTATGGGGG + Intergenic
1186485915 X:9934146-9934168 TCACCTGTGCTGTGTAAATGTGG + Intronic
1193081909 X:77414476-77414498 GCACATTTGCTCTTAAAAGGAGG - Intergenic
1201671637 Y:16528200-16528222 GCACATGTGCTGTTGCAAGGAGG - Intergenic