ID: 1018214930

View in Genome Browser
Species Human (GRCh38)
Location 6:161517790-161517812
Sequence TAGCTCTACTTATCACAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 114}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018214930_1018214933 16 Left 1018214930 6:161517790-161517812 CCTACCTGTGATAAGTAGAGCTA 0: 1
1: 0
2: 0
3: 10
4: 114
Right 1018214933 6:161517829-161517851 CAAAGTCAATTTCCTGGTTTTGG No data
1018214930_1018214932 10 Left 1018214930 6:161517790-161517812 CCTACCTGTGATAAGTAGAGCTA 0: 1
1: 0
2: 0
3: 10
4: 114
Right 1018214932 6:161517823-161517845 CTGTAGCAAAGTCAATTTCCTGG 0: 1
1: 2
2: 15
3: 131
4: 478

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018214930 Original CRISPR TAGCTCTACTTATCACAGGT AGG (reversed) Intronic
902685306 1:18072822-18072844 TGGCTCTGCTGATCACAGGTTGG - Intergenic
905464951 1:38146122-38146144 TAGATCTACTCATCCCAGCTGGG + Intergenic
918291256 1:183110288-183110310 TAGCTTTACTTAACAGGGGTAGG - Intronic
919018896 1:192077702-192077724 AAGCTCTAGACATCACAGGTTGG - Intergenic
920041628 1:203101527-203101549 AAGCTCTACTTTCAACAGGTGGG + Intronic
921671186 1:217925401-217925423 TGGCTCTTCTAATCCCAGGTGGG + Intergenic
1064983612 10:21188423-21188445 TAGCTAGACTTGTCACAGTTTGG + Intergenic
1068313900 10:55317082-55317104 TAGCTCTACTGCACACTGGTTGG + Intronic
1068540657 10:58291363-58291385 GAACTCTACTTTTCACAGCTGGG - Intergenic
1069013937 10:63406278-63406300 GAGCTTAACTAATCACAGGTCGG + Intronic
1070355795 10:75639152-75639174 TAAGTTTACGTATCACAGGTGGG - Intronic
1070938451 10:80320887-80320909 TTGCTCTATTTATCAGAGTTTGG - Intergenic
1071943043 10:90609755-90609777 TAGATCTACTCATCCCAGGTAGG - Intergenic
1072209529 10:93233664-93233686 TAGACCTACTCATCCCAGGTAGG - Intergenic
1080272327 11:30463623-30463645 GAGCTCCATTTCTCACAGGTTGG - Intronic
1082664757 11:55962102-55962124 TAGTTCTATTTATCACAGACAGG - Intergenic
1082999355 11:59277548-59277570 TAGACCTACTTATCCCAGCTGGG + Intergenic
1086278365 11:85158472-85158494 TAGATCTACTCATCCCAGCTGGG + Intronic
1090429144 11:126631496-126631518 TAGCTCTGCTCAGGACAGGTGGG + Intronic
1091092492 11:132785286-132785308 GAGCTCTATTTATCACATGAGGG + Intronic
1094077948 12:26498675-26498697 CAGCTTTAGTTATTACAGGTGGG - Intronic
1094172816 12:27511845-27511867 CAACTCTTCTTATCACTGGTTGG - Intergenic
1102724387 12:115046709-115046731 CAGCTCTACTGATCTCAGCTGGG + Intergenic
1103356823 12:120327715-120327737 TAGCTGTGCTGCTCACAGGTAGG - Exonic
1103858817 12:123995201-123995223 TAGCTCTACTCAGCAGAGGATGG - Intronic
1109712932 13:66182889-66182911 TAGATCTACTCATCCCAGCTGGG - Intergenic
1110526401 13:76543323-76543345 TAGAGCTATTTTTCACAGGTAGG - Intergenic
1110583008 13:77153916-77153938 TAACTCATTTTATCACAGGTAGG + Intronic
1111016442 13:82387813-82387835 TAGATCTACTCATCCCAGCTGGG - Intergenic
1112102956 13:96210304-96210326 TCTCCCTAGTTATCACAGGTTGG - Intronic
1114847818 14:26345241-26345263 AAACTCTACTTATGACAGGGTGG - Intergenic
1115116812 14:29890268-29890290 TTGCTTTAATTATAACAGGTTGG - Intronic
1116352696 14:43885570-43885592 TAGCTACACTGCTCACAGGTGGG + Intergenic
1119059960 14:71464142-71464164 TAGACCTACTCATCACAGCTGGG - Intronic
1120320342 14:82951464-82951486 TAACTCTACCCATCACAGTTAGG - Intergenic
1121461976 14:94087380-94087402 TAGCTCTATTTGTCAGAGTTTGG + Intronic
1126171995 15:45702668-45702690 TAGCTCTACTTCCCCCAGTTTGG + Intergenic
1126647317 15:50887853-50887875 TAGTTTTACTTCTCACATGTAGG + Intergenic
1127608807 15:60617091-60617113 TAGCACAACTTATCAGAGGCAGG + Intronic
1132347440 15:101116774-101116796 TATCTCATCTTATCACAGGTAGG + Intergenic
1138805932 16:60088484-60088506 TTTCTCTACTTAAAACAGGTTGG + Intergenic
1140129650 16:72149157-72149179 TAGTTCTAATAGTCACAGGTTGG - Intronic
1140633227 16:76880157-76880179 CACTTCTACTTATCACAGTTTGG + Intergenic
1144365326 17:14538770-14538792 TAGCCCTACTTATCTCAAGGAGG - Intergenic
1146624718 17:34426528-34426550 TATTTCAACTGATCACAGGTGGG + Intergenic
1151098649 17:71529945-71529967 TAGTTCTGCTTATCAAAGTTAGG + Intergenic
1152462211 17:80447327-80447349 GAGCCCTACTTTTCACGGGTGGG + Intergenic
1154239270 18:12637657-12637679 TAGCTCTGCTCATCAAAAGTGGG + Intronic
1155766892 18:29647310-29647332 TAGCTGTACTTCTCACAAGTAGG - Intergenic
1156192309 18:34733706-34733728 TAGACCTACTCATCACAGCTGGG - Intronic
1156990547 18:43402695-43402717 TAGACCTACTTATCCCAGCTGGG - Intergenic
1157087316 18:44594350-44594372 TAGTTTTACCTTTCACAGGTGGG - Intergenic
1158463534 18:57668614-57668636 TAGCCCTTCTTTTTACAGGTTGG - Intronic
1158609614 18:58927302-58927324 CACCTCTACTTTGCACAGGTTGG + Intronic
1158869521 18:61671270-61671292 CAGCTCTCCTGATCACCGGTCGG - Intergenic
1167731922 19:51264697-51264719 TCGCTCTATTTAGAACAGGTAGG - Intronic
937800071 2:126072754-126072776 TAGATCTACTTATCCCAACTGGG + Intergenic
940606179 2:155926356-155926378 TAGACCTACTTATCCCAGTTGGG - Intergenic
940800462 2:158127082-158127104 TAGATCTACTTAGCACAAGGAGG + Intronic
943318102 2:186413650-186413672 TAGACCTACTTATCCCAGCTGGG - Intergenic
944884991 2:204053663-204053685 TAGCTCCACTTTTCAAAGGCTGG + Intergenic
948859221 2:240744876-240744898 TAGCTTTCCTTATCACCGTTAGG + Intronic
1182965627 22:34518805-34518827 TAGATCTACTCATCTCAGCTGGG - Intergenic
953939513 3:47080264-47080286 GAGTTCAACTTATCACATGTAGG + Intronic
954845152 3:53549169-53549191 TAGCTCTACAGATCAGAGGATGG + Intronic
956591686 3:70922080-70922102 TAGCTCTGCTTCTCACTGGCTGG - Intergenic
960513412 3:118577083-118577105 TAGCTTTAGTTATCTAAGGTAGG - Intergenic
964054017 3:152429892-152429914 TAGCTCTACTTATCGAAAGAGGG + Intronic
964716202 3:159725044-159725066 TAGGTTTACTTATTACAGTTAGG - Intronic
968116319 3:196092907-196092929 TAACTCTCCTTATCAAAGGTAGG - Intergenic
968206877 3:196810884-196810906 TCCCTCTAATTATCACAGATGGG - Intronic
971187542 4:24394973-24394995 TAGCTCTAGTTATATCAGGAAGG - Intergenic
972355141 4:38273638-38273660 TAGCTCCTCTTATCAAAGGATGG - Intergenic
975728897 4:77318963-77318985 TAGCGCTACAACTCACAGGTGGG - Intronic
976214000 4:82698549-82698571 TTGTTCTACATATCACAGGAAGG - Intronic
979211121 4:118104449-118104471 TAGCTTTACTTATCAGAAGTAGG + Intronic
979581214 4:122363442-122363464 TAGCTATAATTACCTCAGGTTGG + Intergenic
979766767 4:124472802-124472824 TAGACCTACTCATCCCAGGTGGG + Intergenic
980124909 4:128765025-128765047 TAACTCAACATATCAGAGGTCGG + Intergenic
980601906 4:135037472-135037494 TAGATATACTTATCCCAGCTGGG + Intergenic
981825662 4:148938138-148938160 AAACTCTACTTATGACATGTTGG + Intergenic
983359103 4:166705799-166705821 TAGACCTACTTATCCCAGCTGGG + Intergenic
985296779 4:188444661-188444683 AAGCTCTACAAAGCACAGGTTGG + Intergenic
986276809 5:6282268-6282290 TAGCGCTATTTAACTCAGGTTGG + Intergenic
987657379 5:20823642-20823664 TAGACCTACTTATCCCAGCTGGG - Intergenic
988766165 5:34380304-34380326 TAGACCTACTTATCCCAGCTGGG + Intergenic
991017414 5:61946661-61946683 TAGCACTAATTAGCACAGGTAGG + Intergenic
991264747 5:64704354-64704376 TACCTATCCTCATCACAGGTAGG - Intronic
991958998 5:72022819-72022841 CAACTCTACATATCACAGCTTGG - Intergenic
992888777 5:81185119-81185141 TACCTCAACTTCCCACAGGTGGG - Intronic
994291637 5:98033972-98033994 TAGACCTACTCATCCCAGGTTGG - Intergenic
994582576 5:101664248-101664270 GAACTTTACTTATCACAGGGTGG + Intergenic
996165207 5:120214539-120214561 TAGATCCACTTATCACAGTTGGG - Intergenic
1001451283 5:171826596-171826618 TAACTCTACTTAATACAGCTGGG + Intergenic
1011039614 6:83015257-83015279 TAGATCTACTCATCCCAGCTGGG - Intronic
1012062319 6:94504123-94504145 TTGCTCCACTTATCACAGCAAGG + Intergenic
1012864204 6:104597928-104597950 TAGCTCTGCTTGTTACAAGTTGG - Intergenic
1014396794 6:120933347-120933369 TTGGTCTTCATATCACAGGTAGG + Intergenic
1015467189 6:133560232-133560254 TAGACCTACTTATCCCAGCTGGG - Intergenic
1018214930 6:161517790-161517812 TAGCTCTACTTATCACAGGTAGG - Intronic
1024954876 7:54906961-54906983 TAGCTTTCCTTAGCACAGGTGGG - Intergenic
1025924489 7:65945940-65945962 TAGCCCTACTCATCCCAGGCAGG - Intronic
1025931810 7:66001169-66001191 TAGCCCTACTCATCCCAGGCAGG - Intergenic
1027426023 7:78062239-78062261 AAGCTCTAGTTATCCGAGGTGGG + Intronic
1030367319 7:108660240-108660262 TGGCACTATTTGTCACAGGTGGG + Intergenic
1032153375 7:129448937-129448959 TAGATCTACTCATCCCAGCTGGG - Intronic
1033603152 7:142903963-142903985 GTTCTTTACTTATCACAGGTTGG + Intergenic
1037264916 8:17048087-17048109 AAGTTTTACTTATCACATGTAGG - Intronic
1037541089 8:19872088-19872110 CAGCTCTACTCCTCACAGATGGG + Intergenic
1039600908 8:38836369-38836391 TGGCTCAAGTTATCACAGGCTGG + Intronic
1041538831 8:58959562-58959584 TAGCTTTAATTATCAATGGTTGG - Intronic
1042001321 8:64125968-64125990 TAGACCTACTTATCCCAGCTGGG - Intergenic
1043842670 8:85126816-85126838 TGGCTCTACTTACCACAGATAGG + Exonic
1044487422 8:92769130-92769152 TAGACCTACTTATCCCAGCTGGG - Intergenic
1046230523 8:111349584-111349606 TAGCCCTACTGGTAACAGGTTGG - Intergenic
1046586033 8:116149625-116149647 TAGACCTACTCATCACAGCTGGG - Intergenic
1054918475 9:70518193-70518215 GAGCTCCACTTATCACTGATAGG + Intergenic
1056270232 9:84940281-84940303 CAGCTCTTCTCATCACAGGGAGG - Intronic
1059023573 9:110601320-110601342 TGGCTCTACTCATCTCAGCTGGG - Intergenic
1189913180 X:45831374-45831396 TAGCTTTACCTATCTCATGTGGG - Intergenic
1192661822 X:73049762-73049784 TAGACCTACTCATCCCAGGTGGG - Intergenic
1193586502 X:83328615-83328637 TAGGTCTACTTATGACTGGAAGG + Intergenic
1196010163 X:110878326-110878348 TGACTCAACTTATCACAGGCAGG - Intergenic
1197591601 X:128417338-128417360 TAGATCTACTCATCCCAGCTGGG + Intergenic
1199851878 X:151729641-151729663 CAGCTCACCTTATCACAGCTGGG + Intergenic