ID: 1018215009

View in Genome Browser
Species Human (GRCh38)
Location 6:161518284-161518306
Sequence CCTGCTTTCCAGAAGATGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 239}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018215003_1018215009 25 Left 1018215003 6:161518236-161518258 CCACCCTGCATATCTGCTGGCGC 0: 1
1: 0
2: 1
3: 3
4: 108
Right 1018215009 6:161518284-161518306 CCTGCTTTCCAGAAGATGAGAGG 0: 1
1: 0
2: 1
3: 19
4: 239
1018214999_1018215009 28 Left 1018214999 6:161518233-161518255 CCCCCACCCTGCATATCTGCTGG 0: 1
1: 0
2: 1
3: 27
4: 263
Right 1018215009 6:161518284-161518306 CCTGCTTTCCAGAAGATGAGAGG 0: 1
1: 0
2: 1
3: 19
4: 239
1018215004_1018215009 22 Left 1018215004 6:161518239-161518261 CCCTGCATATCTGCTGGCGCTGA 0: 1
1: 0
2: 0
3: 3
4: 97
Right 1018215009 6:161518284-161518306 CCTGCTTTCCAGAAGATGAGAGG 0: 1
1: 0
2: 1
3: 19
4: 239
1018215005_1018215009 21 Left 1018215005 6:161518240-161518262 CCTGCATATCTGCTGGCGCTGAA 0: 1
1: 0
2: 0
3: 6
4: 70
Right 1018215009 6:161518284-161518306 CCTGCTTTCCAGAAGATGAGAGG 0: 1
1: 0
2: 1
3: 19
4: 239
1018215001_1018215009 27 Left 1018215001 6:161518234-161518256 CCCCACCCTGCATATCTGCTGGC No data
Right 1018215009 6:161518284-161518306 CCTGCTTTCCAGAAGATGAGAGG 0: 1
1: 0
2: 1
3: 19
4: 239
1018215002_1018215009 26 Left 1018215002 6:161518235-161518257 CCCACCCTGCATATCTGCTGGCG No data
Right 1018215009 6:161518284-161518306 CCTGCTTTCCAGAAGATGAGAGG 0: 1
1: 0
2: 1
3: 19
4: 239

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018215009 Original CRISPR CCTGCTTTCCAGAAGATGAG AGG Intronic