ID: 1018215009

View in Genome Browser
Species Human (GRCh38)
Location 6:161518284-161518306
Sequence CCTGCTTTCCAGAAGATGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 239}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018215004_1018215009 22 Left 1018215004 6:161518239-161518261 CCCTGCATATCTGCTGGCGCTGA 0: 1
1: 0
2: 0
3: 3
4: 97
Right 1018215009 6:161518284-161518306 CCTGCTTTCCAGAAGATGAGAGG 0: 1
1: 0
2: 1
3: 19
4: 239
1018215001_1018215009 27 Left 1018215001 6:161518234-161518256 CCCCACCCTGCATATCTGCTGGC 0: 1
1: 0
2: 2
3: 21
4: 241
Right 1018215009 6:161518284-161518306 CCTGCTTTCCAGAAGATGAGAGG 0: 1
1: 0
2: 1
3: 19
4: 239
1018215002_1018215009 26 Left 1018215002 6:161518235-161518257 CCCACCCTGCATATCTGCTGGCG 0: 1
1: 0
2: 0
3: 8
4: 80
Right 1018215009 6:161518284-161518306 CCTGCTTTCCAGAAGATGAGAGG 0: 1
1: 0
2: 1
3: 19
4: 239
1018215003_1018215009 25 Left 1018215003 6:161518236-161518258 CCACCCTGCATATCTGCTGGCGC 0: 1
1: 0
2: 1
3: 3
4: 108
Right 1018215009 6:161518284-161518306 CCTGCTTTCCAGAAGATGAGAGG 0: 1
1: 0
2: 1
3: 19
4: 239
1018214999_1018215009 28 Left 1018214999 6:161518233-161518255 CCCCCACCCTGCATATCTGCTGG 0: 1
1: 0
2: 1
3: 27
4: 263
Right 1018215009 6:161518284-161518306 CCTGCTTTCCAGAAGATGAGAGG 0: 1
1: 0
2: 1
3: 19
4: 239
1018215005_1018215009 21 Left 1018215005 6:161518240-161518262 CCTGCATATCTGCTGGCGCTGAA 0: 1
1: 0
2: 0
3: 6
4: 70
Right 1018215009 6:161518284-161518306 CCTGCTTTCCAGAAGATGAGAGG 0: 1
1: 0
2: 1
3: 19
4: 239

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018215009 Original CRISPR CCTGCTTTCCAGAAGATGAG AGG Intronic
900915994 1:5639027-5639049 TCTGCTTTCCACAAGAGTAGTGG - Intergenic
902491091 1:16781216-16781238 TCTGCTTTCCAAAGGATGAGTGG + Intronic
902684307 1:18066042-18066064 CCTCCTTCCAAGAAGATGGGTGG - Intergenic
903564633 1:24255551-24255573 CCTGCTCTTAAGATGATGAGCGG + Intergenic
904285825 1:29452758-29452780 GCTGCTTTCAAGAAGAAGAGAGG + Intergenic
904313750 1:29646495-29646517 GCTCCTTTCCAGAAGCTCAGAGG + Intergenic
905699028 1:39998104-39998126 CCTGCTTTAGAGATGATGAAGGG + Intergenic
907314941 1:53562294-53562316 CCTGCTTTCAAGGAGCTGAGTGG + Intronic
908646826 1:66287515-66287537 CCTGCTTTAAAGGAGCTGAGAGG + Intronic
910433002 1:87177311-87177333 CCTCCTTTCCAGAAGACAAGTGG - Intergenic
912159761 1:106967472-106967494 CCTGCTTTCCAGACCATGCCTGG - Intergenic
912950300 1:114116122-114116144 CCTGCGTTACAGACTATGAGAGG + Intronic
913516826 1:119612101-119612123 CATGCTTTCCAGAAGGCGAGGGG - Intergenic
915544615 1:156589785-156589807 CCTGCTTTCAGGAAGAAAAGGGG + Intergenic
915588398 1:156857551-156857573 TCTGCTGTGCAGAAGAGGAGGGG + Intronic
916549497 1:165836540-165836562 CCTGCTTTCTACAAAATTAGAGG - Intronic
916785822 1:168086457-168086479 CCTACTTTCCAGAAAATGTAAGG - Intronic
920373979 1:205496990-205497012 CCTGCCTTCAAGAAGTTCAGAGG + Intergenic
921300060 1:213743659-213743681 CCAGCTTTTCTGTAGATGAGAGG - Intergenic
922192040 1:223327869-223327891 GCTGCTTTCCAAATGATTAGAGG - Intronic
923529352 1:234801318-234801340 TCTGCTTTCCAAAGGATGAGTGG - Intergenic
924369181 1:243329350-243329372 AATGCTTTCCAGATGAAGAGAGG + Intronic
1063018347 10:2101091-2101113 CCTTCTCTCCAGAACATGACTGG - Intergenic
1063415202 10:5867617-5867639 TCTGATTTCCATAAGATTAGAGG - Intronic
1067358273 10:45551566-45551588 CCTGCTTTCCATAATGTGCGTGG + Intronic
1069823657 10:71242423-71242445 GCTTCTTTCCAGCAGCTGAGTGG + Intronic
1070325778 10:75388006-75388028 CTTGGTTTCCAGCAGAGGAGAGG + Intergenic
1070724358 10:78778188-78778210 CCTGCAGTGCTGAAGATGAGAGG + Intergenic
1071941325 10:90594735-90594757 CCTGCTCTCCTGAAGCTGGGGGG - Intergenic
1072741253 10:97911282-97911304 CCTGCTTTGTAGAAAATGAAGGG - Intronic
1073233626 10:101994344-101994366 CCTCCTTTTCACAAGATTAGGGG - Intronic
1073339803 10:102735973-102735995 CCTGCTGTCCAGAAGGAGACAGG + Intronic
1074228853 10:111513812-111513834 CCTGCTTTCAGGAAGATAACGGG - Intergenic
1074435819 10:113433321-113433343 CCTCCTTTCCAGAAGCTTTGGGG + Intergenic
1075906675 10:126087720-126087742 CTTGCTTTCCTGAAAATCAGTGG - Intronic
1076018018 10:127044685-127044707 CTTGAATTTCAGAAGATGAGAGG + Intronic
1076264789 10:129101179-129101201 CCTGCCTCCCAGGAGATTAGAGG - Intergenic
1077464101 11:2725382-2725404 CCTGCCTTCCAAAACAGGAGAGG + Intronic
1077756885 11:5040584-5040606 CATGCTTTCCAAAGAATGAGGGG - Intergenic
1078485792 11:11722182-11722204 CCTCCTGCCCAGAAGATAAGGGG + Intergenic
1079579108 11:22040013-22040035 TCTGCTTTCCAGAGGATTTGGGG + Intergenic
1080420371 11:32104786-32104808 CCTGTTCTTCAGAAGGTGAGTGG + Exonic
1080480825 11:32648046-32648068 CCTACTTTGCAGAAGATTGGAGG - Intronic
1080896749 11:36454348-36454370 ACTGCTTTCCAGATAAAGAGAGG + Intronic
1080918524 11:36685257-36685279 CCTGCTTTTCAGAAAATCCGAGG + Intergenic
1081150700 11:39627285-39627307 CCTGCTTTCCAGCTGAGGTGGGG - Intergenic
1083065239 11:59916952-59916974 CCTACATTTCAGAAGATGTGTGG - Intergenic
1085255559 11:75170726-75170748 CCAGCCTTCCAGAAGGAGAGTGG - Intronic
1085708395 11:78807455-78807477 AGTGCTTTGCAGAAGATTAGAGG - Intronic
1086105044 11:83138328-83138350 CCTGCTGTCTAGATGATGATAGG + Intergenic
1087640898 11:100753001-100753023 TCTGGTTTCCAGATGATGATTGG + Intronic
1094044259 12:26149982-26150004 CCTACCTTTCAGAAGATGTGAGG - Intronic
1094045691 12:26163934-26163956 CCTGCTGTCAAGAAGCTTAGAGG + Intronic
1096344548 12:50834172-50834194 CCTGGATTTCAGAAGATGTGTGG + Intergenic
1096394496 12:51255504-51255526 CCTGCCTGCTAGAGGATGAGAGG + Intronic
1096453941 12:51769971-51769993 CCTGCTTCACAGAAGGTGAAAGG + Exonic
1101195525 12:102378024-102378046 CATGATTTCCAGAAGATGCTTGG + Intergenic
1102960996 12:117093171-117093193 CCTGCCCTCCAGAAGCTCAGGGG - Intronic
1103383843 12:120516095-120516117 CTTTCTTTACAGGAGATGAGAGG + Intronic
1104597935 12:130132657-130132679 CCTCCTTCCCAGAACATGGGTGG + Intergenic
1105253071 13:18718392-18718414 CATGATTTACAGAAGCTGAGTGG + Intergenic
1106256341 13:28025712-28025734 CCTCTGTTCCAGAATATGAGTGG + Intronic
1106597022 13:31152922-31152944 CCTTCTTTACAGATGCTGAGAGG - Exonic
1107942837 13:45390012-45390034 CCTGTTCTTCAGAAGTTGAGTGG - Intergenic
1108556187 13:51595200-51595222 CCTGCTGTCCAGGAGACCAGTGG - Intronic
1111984392 13:95051181-95051203 CCTGCTTTCCAGCAACTGTGGGG - Intronic
1113566435 13:111322334-111322356 CCATCTTGCCAGAATATGAGAGG - Intronic
1113822263 13:113222943-113222965 GCTGCTGTCAGGAAGATGAGAGG + Intronic
1115134332 14:30090867-30090889 CCTAGTTTACAGAAGATGTGTGG - Intronic
1116372062 14:44148859-44148881 CATGATTTCCAGAGGATAAGTGG + Intergenic
1116590113 14:46761207-46761229 CCTGGATTTCAGAAGATGTGTGG - Intergenic
1117398287 14:55334182-55334204 CCTGCTTTCTCTGAGATGAGCGG - Intronic
1119550656 14:75511173-75511195 ACTGCTTTCCAAGAGCTGAGGGG + Intergenic
1119644077 14:76336095-76336117 CCTGCTTTCCACATGGTAAGAGG - Intronic
1120435242 14:84473517-84473539 CCAGCTTCCCAGAACAAGAGAGG - Intergenic
1121564898 14:94901884-94901906 TCTGCTTTGCAGAAGCTGGGAGG + Intergenic
1123066383 14:105621516-105621538 CATGGTTTCCAGATGGTGAGTGG - Intergenic
1123070523 14:105640568-105640590 CGTGGTTTCCAGATGGTGAGTGG - Intergenic
1123089762 14:105737356-105737378 CGTGGTTTCCAGATGGTGAGTGG - Intergenic
1123095553 14:105765516-105765538 CGTGGTTTCCAGATGGTGAGTGG - Intergenic
1123911002 15:24966956-24966978 CCTGCTTACCAGTAGATGATTGG + Intronic
1124157008 15:27234850-27234872 CCTGCTGCCCAGATGGTGAGAGG + Intronic
1125205804 15:37152607-37152629 CATGCATTCCAGAAGGTGGGAGG + Intergenic
1125426227 15:39552397-39552419 CCTGCTTGGCAGAGGAGGAGAGG - Intergenic
1128501671 15:68231039-68231061 TCTGCTTCCCAGACCATGAGGGG + Intronic
1129540904 15:76346522-76346544 CCGGCTCTCCAGAGGCTGAGGGG - Intergenic
1131861713 15:96660843-96660865 CTTGCTGTGCAGAACATGAGAGG - Intergenic
1132222565 15:100115981-100116003 CAAGCTGTGCAGAAGATGAGAGG - Intronic
1132599313 16:766955-766977 CTTGCTTTCCAGAACATGAACGG + Exonic
1139514946 16:67447321-67447343 CCTCTTTTTCAGGAGATGAGAGG + Intronic
1140661698 16:77195324-77195346 CCTGCTGTCCACCAGAAGAGGGG - Intronic
1140924965 16:79573481-79573503 AATGCTTTCCAGAAGATATGGGG - Intergenic
1143039735 17:4025000-4025022 GCTGCTTTGCAGAAGGTGACTGG + Exonic
1143873726 17:9976221-9976243 GCTGCTTTCCAGGACATCAGAGG + Intronic
1144613410 17:16745912-16745934 CCGGCTTTCCAGAAGGAGTGAGG - Intronic
1147331513 17:39701891-39701913 CCTTCTCATCAGAAGATGAGAGG - Intronic
1148839502 17:50485727-50485749 TCTGGTTTCCCGAAGATAAGAGG - Exonic
1149017419 17:51924609-51924631 CCTTCTTTCCATAAGAGGGGAGG + Intronic
1149383984 17:56123996-56124018 CCTGCTGACCAGTAGACGAGGGG + Intronic
1149685602 17:58532772-58532794 CCTGCTTGTCAGAGGAAGAGTGG - Intronic
1151128305 17:71869010-71869032 CCTGCATTAAAGAAGAAGAGAGG + Intergenic
1151486780 17:74406011-74406033 CATGTTTTCCAGAGGAAGAGGGG + Intergenic
1151944589 17:77312448-77312470 CCTGCTTTCCAGAGGACAAGTGG - Intronic
1152700003 17:81814009-81814031 CCTGCTTTCCAGGACATGCACGG - Exonic
1153843511 18:9028297-9028319 CTTGCTGTCCTGAAGATGGGAGG - Intergenic
1154150276 18:11901108-11901130 CTGGCTTTTCAGAAGATGAAAGG + Intronic
1154335119 18:13458836-13458858 CTGGCTTTCCAGATGATGAAGGG + Intronic
1156350713 18:36298592-36298614 CCTGCTTCTCAGAAGAAAAGGGG - Intronic
1156516842 18:37687421-37687443 CCTGCTCTCCAGAAGCTGTAGGG - Intergenic
1158618528 18:59010009-59010031 CCTGCTTCCTGGCAGATGAGTGG + Intergenic
1160350391 18:78173490-78173512 CCTGTTTTCCAGCAGACGGGTGG + Intergenic
1161582191 19:5087050-5087072 CCTGCTCTGCAGAAGACGGGAGG - Intronic
1163223544 19:15938809-15938831 CCTGCTTTACAGAATATTAGAGG + Intergenic
1165362720 19:35346588-35346610 CAGATTTTCCAGAAGATGAGGGG + Exonic
1165804040 19:38569570-38569592 CCTGCTTTACAGAAGATGAAAGG - Intronic
925006853 2:450069-450091 CCTGCTTCCCACTAGAAGAGTGG + Intergenic
926082880 2:10003054-10003076 CCTGCTCTCCAGGAAACGAGAGG - Intergenic
927458857 2:23280260-23280282 CCTGGTTTCCTTAAGCTGAGGGG - Intergenic
928075758 2:28263034-28263056 CTTGCCTTCCAGTAGATGAAAGG + Intronic
929027009 2:37614577-37614599 CCTCCTCTCCAGAGGAGGAGTGG + Intergenic
931397322 2:61899195-61899217 CCTGCTTTAAAGAAGAAAAGGGG - Intronic
932794070 2:74680049-74680071 CCCCCTCTCCTGAAGATGAGCGG + Exonic
933175780 2:79171056-79171078 CCTGCTATACAGAAAATGAGGGG + Intergenic
934843654 2:97647254-97647276 CCTACCTTCCAGAAGCTCAGGGG - Intronic
935224025 2:101037975-101037997 CCTCCTGTCCATAAGCTGAGGGG - Intronic
937091509 2:119209442-119209464 AGTGCTTTCCAGATGCTGAGTGG + Intergenic
937207518 2:120246080-120246102 CCTGCTCTCTAGCAGATGCGGGG + Intronic
937672251 2:124550605-124550627 CCTGCTTCCTAGTAGATGTGAGG + Intronic
938981799 2:136534170-136534192 CCTGCCTTCCAGTAGGGGAGTGG + Intergenic
939962642 2:148579029-148579051 CCTGGTTTCTGGAGGATGAGTGG - Intergenic
939984169 2:148813966-148813988 CGTGGTTTCCAGGGGATGAGCGG - Intergenic
942168610 2:173267034-173267056 CCTGCTAACCAGAATATCAGTGG - Exonic
942224779 2:173805429-173805451 CCTGGTTTCCAGATGATGTCTGG + Intergenic
942257797 2:174123396-174123418 TCTTCTTTCCAAAAGATTAGTGG + Intronic
943262151 2:185679760-185679782 CCTGCTTTCCTGATGATGGAAGG - Intergenic
944398105 2:199292726-199292748 ACTGCTTTCCAGATGCTGAGTGG - Intronic
946165551 2:217861487-217861509 CATGGTTTCCAGAAAATGGGAGG - Intronic
946358962 2:219207407-219207429 TCTGCTTACCAAAAGGTGAGGGG + Exonic
946730314 2:222703334-222703356 CCTGCTTTCAGGAAGAAAAGGGG + Intronic
947807395 2:232977957-232977979 CCTGCTTCCCAGACCAGGAGTGG - Intronic
948654683 2:239469307-239469329 CCTCCTATCCGGAGGATGAGAGG - Intergenic
949049954 2:241892339-241892361 CCGGCTTTCCAGGAGAGGAGAGG - Intergenic
1169274008 20:4221149-4221171 CCTATTTCCCAGAAGAGGAGGGG + Exonic
1169725830 20:8729117-8729139 CCTGCATTCCAGAAGAGCTGAGG - Exonic
1169799406 20:9499732-9499754 CATGAGTTCCAGAAGATAAGTGG + Intergenic
1170077533 20:12436002-12436024 CCTGGTTAACAGAAGATGACTGG - Intergenic
1170491544 20:16880827-16880849 CCTGCTTTCCAAAAGTGTAGGGG + Intergenic
1174279556 20:49429232-49429254 ACTGGTTGCCAGGAGATGAGGGG + Intronic
1175791125 20:61740545-61740567 CCTGCTTTCCAGGAGAAGAAAGG - Intronic
1175870102 20:62205193-62205215 ACTGGCTTCCAGAAGATAAGAGG - Intergenic
1176677961 21:9798699-9798721 CCTGCTTTCCAAAACATGTGTGG + Intergenic
1176838576 21:13818277-13818299 CATGATTTACAGAAGCTGAGTGG + Intergenic
1178587384 21:33881533-33881555 GCTGCTTTCCAGAAGCTCAAAGG + Intronic
1179062944 21:37996467-37996489 CCTGCTTTTCAGATGAGGAAAGG - Intronic
1179174613 21:38999416-38999438 CGTGGTTACCAGGAGATGAGAGG + Intergenic
1183330004 22:37214290-37214312 CCTGCTTTCAGGAAGAAAAGGGG - Intergenic
1184983344 22:48112179-48112201 AGTGCTTTCCAGGAGCTGAGAGG + Intergenic
1184993008 22:48183239-48183261 CCTGACTTCCAGAAGCTCAGAGG + Intergenic
949882439 3:8672399-8672421 CCTACTATCCAGAAGAAAAGAGG - Intronic
952326502 3:32325031-32325053 CCTGCTTTCAGGAAGAAAAGGGG + Intronic
956429045 3:69166007-69166029 CCTGCTTTCCTGAAGCTTACAGG - Intergenic
957749518 3:84395123-84395145 GCAGCTTTCCTGAAGGTGAGGGG + Intergenic
959027564 3:101257937-101257959 CCTCCTTCCCAGAGAATGAGGGG + Intronic
960752395 3:120970495-120970517 CCTGCTGTCCAGATGATAATGGG - Intronic
962589331 3:136872899-136872921 CCTGCATTTCAGAAGATGTATGG + Intronic
962835088 3:139182855-139182877 CCTGCTCTCCTGAAGAACAGAGG + Intronic
963587427 3:147210322-147210344 CGTGCTTTCAAGATGATTAGTGG - Intergenic
964320745 3:155494349-155494371 CCTGCGTTCCAGTAGGGGAGAGG + Exonic
966229811 3:177639901-177639923 CTTGATTTCCAGAAGTTGTGGGG + Intergenic
967155503 3:186688036-186688058 CTTCATTTCCAGAAAATGAGAGG + Intergenic
967156780 3:186700179-186700201 CTTCATTTCCAGAAAATGAGAGG + Intergenic
967932498 3:194700476-194700498 CCTGCTTTCCAGATGAGAGGGGG + Intergenic
968085292 3:195871389-195871411 CCTGCTTTCCAGAACCAGAGTGG - Intronic
969266712 4:6069149-6069171 CCTGCTTCTCAAGAGATGAGGGG + Intronic
969468144 4:7369920-7369942 CCTGCCTTCCAGAAGGGAAGGGG - Intronic
970712928 4:18885206-18885228 GGTGCTTGCCAGAAGATGTGGGG - Intergenic
974695935 4:65371064-65371086 CATCATTTCCAGAAAATGAGAGG - Intronic
975800969 4:78058661-78058683 CCTGCTTCCCAGAACAAAAGTGG + Intronic
976112855 4:81695023-81695045 CTTGATTTCCTGAAGATGTGAGG + Intronic
977331785 4:95645564-95645586 CATGGTATCCAGAAGATAAGAGG + Intergenic
978143213 4:105341451-105341473 ACTGCTTTCCAGAAGCTCTGGGG + Intergenic
980974800 4:139600265-139600287 CTTTGTCTCCAGAAGATGAGAGG - Intronic
981946019 4:150345069-150345091 CATGTTTTCCAGAGAATGAGAGG - Intronic
982085255 4:151829186-151829208 CCTGCCTTTTATAAGATGAGAGG - Intergenic
985730707 5:1546719-1546741 CCTGCTTTGCAGAGGATGGAAGG - Intergenic
986331664 5:6720899-6720921 TTTGCTTTGCAGAAGATGTGGGG + Intronic
986599321 5:9455908-9455930 CCTGCTTCCCCGAAGAAGAAGGG - Intronic
986766126 5:10929329-10929351 GTTGCTTTCCAGAAGATAATAGG + Intergenic
987390306 5:17369045-17369067 CCTCCTTTTCAGAAAATGACAGG - Intergenic
987938723 5:24504191-24504213 CCTGCTTTCAGGAAGAAAAGGGG - Intronic
988941146 5:36149549-36149571 CCTGCTGTCTAGATGATGATAGG - Intronic
989043492 5:37251991-37252013 CCTGCTTTCAAGAATATCACAGG + Intergenic
993893700 5:93505545-93505567 CCTGGATTTCAGAAGATGTGTGG - Intergenic
996944654 5:129052202-129052224 ACTGTTTTCCAGAAAATGGGGGG + Intergenic
997150801 5:131492775-131492797 TCTGCTTAACAGAAGATGAATGG - Exonic
997266758 5:132499318-132499340 CCTACTTTCCAGGAGAGGAATGG - Intergenic
999831583 5:155325345-155325367 CTTACTTTCCAGATGATGCGGGG + Intergenic
1000263332 5:159611221-159611243 CCTGCTGAAAAGAAGATGAGCGG + Intergenic
1001974339 5:175984573-175984595 CCTGCTTCCCAGAGAATGGGTGG + Intronic
1002243095 5:177859206-177859228 CCTGCTTCCCAGAGAATGGGTGG - Intergenic
1002703475 5:181143731-181143753 CCTGCTTCCCTGAAGATGGAAGG + Intergenic
1003804403 6:9710352-9710374 CTTGCTTTCCATTAGGTGAGGGG - Intronic
1004566847 6:16806049-16806071 CCTGATTTCCGGATCATGAGAGG - Intergenic
1007363938 6:41376761-41376783 GCTGCTTTCCTGAAGAGCAGTGG - Intergenic
1007703154 6:43775943-43775965 TCTGCTTTCCAGAAGAATAAAGG - Intronic
1009226530 6:61024968-61024990 CATGATTTCCAGAAGGGGAGAGG + Intergenic
1009600764 6:65794853-65794875 GATGCATACCAGAAGATGAGTGG - Intergenic
1014691682 6:124570635-124570657 CCTAGATTTCAGAAGATGAGTGG + Intronic
1018215009 6:161518284-161518306 CCTGCTTTCCAGAAGATGAGAGG + Intronic
1018412036 6:163559606-163559628 CCTACTTTGCAGAAGATTACAGG - Intronic
1018606015 6:165598866-165598888 CCTGCCTTCTGCAAGATGAGGGG + Intronic
1018777838 6:167034609-167034631 CTTGCTTTCCAGAACATGGTGGG + Intronic
1019219930 6:170465078-170465100 CCTGCTTTCCACAAGCTGACTGG + Intergenic
1019414736 7:922082-922104 ACTGGTTTTCAGGAGATGAGGGG - Intronic
1021010380 7:15456530-15456552 CCTGCTATCCACAAGATCAGGGG + Intronic
1021134442 7:16948514-16948536 CCTGGATTTCAGAAGATGTGTGG + Intergenic
1022557243 7:31310806-31310828 CCAGCTTTTCAGAAGCAGAGAGG + Intergenic
1023730199 7:43184613-43184635 TCTGCTCCCCAGAAGTTGAGGGG - Intronic
1026621750 7:71955716-71955738 CCTGAGTTCCAGAACATCAGGGG - Intronic
1027869171 7:83684955-83684977 TCTGTTTCCCAGAAGATGAAGGG + Intergenic
1031136227 7:117887194-117887216 CCTGCTTCTCAGGAGAGGAGTGG + Intergenic
1032072536 7:128817451-128817473 CCTGCTTGACAGGATATGAGAGG + Intronic
1032948470 7:136879475-136879497 CATGATTTCCAGAAGATATGGGG - Intronic
1034079205 7:148261112-148261134 CCTGCTTTCAGGAAGAAAAGGGG + Intronic
1035832721 8:2714999-2715021 CCTACTTTCCAGGAGAAGACTGG - Intergenic
1036020620 8:4841362-4841384 CCTGCCTTCAAGAAGCTCAGTGG - Intronic
1036451426 8:8871186-8871208 CCTGGTTTACAGATGAGGAGTGG - Intronic
1039778121 8:40757008-40757030 CCTGCGTTCCAAAACACGAGAGG - Intronic
1043503946 8:80884554-80884576 GCTGCTTTCCAGAACTTAAGAGG + Intergenic
1044302293 8:90598712-90598734 ACAGCTTCCCAGGAGATGAGTGG + Intergenic
1044900112 8:96935095-96935117 CCAGGTTTCCAGAAGATGTCAGG + Intronic
1045870030 8:106915925-106915947 CCTCCTTTACACAAGATGGGTGG - Intergenic
1047467103 8:125127583-125127605 GCTCCATTCCAGAAGAAGAGAGG - Intronic
1048980381 8:139700578-139700600 CTTTCTTTCCAGAAAATCAGTGG + Intronic
1049393241 8:142382732-142382754 CCAGCTTTCCAGGAGAGAAGGGG + Intronic
1050151031 9:2620014-2620036 ACTGCTTTACAGAAGAGGAAAGG - Intergenic
1052637550 9:31123485-31123507 CCTGAGTGCCAGAAGATGGGTGG + Intergenic
1053416211 9:37948422-37948444 CTGCCCTTCCAGAAGATGAGGGG - Intronic
1053830709 9:42077249-42077271 CCTGCCTTCTAGAATATCAGGGG - Intronic
1053840258 9:42184308-42184330 TCTGCTTCCCAGAAGACCAGAGG - Intronic
1054097307 9:60915056-60915078 TCTGCTTCCCAGAAGACCAGAGG - Intergenic
1054118713 9:61190685-61190707 TCTGCTTCCCAGAAGACCAGAGG - Intronic
1054599850 9:67110188-67110210 CCTGCCTTCTAGAATATCAGGGG + Intergenic
1055711547 9:79067427-79067449 CCAGCTTTCCAGAATATGTTTGG + Intergenic
1056533155 9:87505084-87505106 ACTTCTTTCCAGATGATTAGGGG + Intronic
1056829061 9:89899624-89899646 AAAGCATTCCAGAAGATGAGGGG - Intergenic
1058219565 9:102280581-102280603 CCTGCTTTCAAGAAGAAAAAGGG - Intergenic
1058521250 9:105815848-105815870 CCTGATATCCAGAAGGGGAGAGG - Intergenic
1061590681 9:131595666-131595688 CCTCCTTTCCAGAGCATGACTGG + Intronic
1203663109 Un_KI270754v1:1191-1213 CCTGCTTTCCAAAACATGTGTGG + Intergenic
1189724413 X:43954224-43954246 CCTGGGTCCCTGAAGATGAGCGG - Intronic
1193459723 X:81775867-81775889 CCTGGATTCCAGAAGATGTATGG - Intergenic
1195085865 X:101413219-101413241 CCTGCTAGCCAGCAGCTGAGTGG + Exonic
1196328221 X:114434237-114434259 GCAGCTTTCCTGAAGGTGAGGGG - Intergenic
1196932759 X:120697355-120697377 ACAGCTTTCCAGCAGCTGAGAGG - Intergenic
1199301720 X:146221124-146221146 CCTGGATTCCAGAAGATGTATGG - Intergenic
1200824904 Y:7627374-7627396 CCTGCCTTCCAGAGGAGGAATGG + Intergenic
1202235151 Y:22703713-22703735 CCTGCCTTCCAGAGGAGGAATGG - Intergenic
1202308008 Y:23492455-23492477 CCTGCCTTCCAGAGGAGGAATGG + Intergenic
1202562793 Y:26178131-26178153 CCTGCCTTCCAGAGGAGGAATGG - Intergenic