ID: 1018221257

View in Genome Browser
Species Human (GRCh38)
Location 6:161582053-161582075
Sequence TCAGTCATGCGTGGAGCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 95}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018221257_1018221261 -10 Left 1018221257 6:161582053-161582075 CCCAGAGCTCCACGCATGACTGA 0: 1
1: 0
2: 0
3: 7
4: 95
Right 1018221261 6:161582066-161582088 GCATGACTGAATGGTGAATTTGG 0: 1
1: 0
2: 0
3: 12
4: 164
1018221257_1018221262 12 Left 1018221257 6:161582053-161582075 CCCAGAGCTCCACGCATGACTGA 0: 1
1: 0
2: 0
3: 7
4: 95
Right 1018221262 6:161582088-161582110 GAATCATTGCTTTCATCTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018221257 Original CRISPR TCAGTCATGCGTGGAGCTCT GGG (reversed) Intronic