ID: 1018221261

View in Genome Browser
Species Human (GRCh38)
Location 6:161582066-161582088
Sequence GCATGACTGAATGGTGAATT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 164}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018221255_1018221261 3 Left 1018221255 6:161582040-161582062 CCAGCTCACCGTGCCCAGAGCTC 0: 1
1: 0
2: 1
3: 16
4: 206
Right 1018221261 6:161582066-161582088 GCATGACTGAATGGTGAATTTGG 0: 1
1: 0
2: 0
3: 12
4: 164
1018221254_1018221261 4 Left 1018221254 6:161582039-161582061 CCCAGCTCACCGTGCCCAGAGCT 0: 1
1: 1
2: 0
3: 12
4: 181
Right 1018221261 6:161582066-161582088 GCATGACTGAATGGTGAATTTGG 0: 1
1: 0
2: 0
3: 12
4: 164
1018221257_1018221261 -10 Left 1018221257 6:161582053-161582075 CCCAGAGCTCCACGCATGACTGA 0: 1
1: 0
2: 0
3: 7
4: 95
Right 1018221261 6:161582066-161582088 GCATGACTGAATGGTGAATTTGG 0: 1
1: 0
2: 0
3: 12
4: 164
1018221256_1018221261 -5 Left 1018221256 6:161582048-161582070 CCGTGCCCAGAGCTCCACGCATG 0: 1
1: 0
2: 2
3: 20
4: 172
Right 1018221261 6:161582066-161582088 GCATGACTGAATGGTGAATTTGG 0: 1
1: 0
2: 0
3: 12
4: 164
1018221253_1018221261 5 Left 1018221253 6:161582038-161582060 CCCCAGCTCACCGTGCCCAGAGC No data
Right 1018221261 6:161582066-161582088 GCATGACTGAATGGTGAATTTGG 0: 1
1: 0
2: 0
3: 12
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018221261 Original CRISPR GCATGACTGAATGGTGAATT TGG Intronic