ID: 1018221262

View in Genome Browser
Species Human (GRCh38)
Location 6:161582088-161582110
Sequence GAATCATTGCTTTCATCTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018221256_1018221262 17 Left 1018221256 6:161582048-161582070 CCGTGCCCAGAGCTCCACGCATG 0: 1
1: 0
2: 2
3: 20
4: 172
Right 1018221262 6:161582088-161582110 GAATCATTGCTTTCATCTACTGG No data
1018221255_1018221262 25 Left 1018221255 6:161582040-161582062 CCAGCTCACCGTGCCCAGAGCTC 0: 1
1: 0
2: 1
3: 16
4: 206
Right 1018221262 6:161582088-161582110 GAATCATTGCTTTCATCTACTGG No data
1018221253_1018221262 27 Left 1018221253 6:161582038-161582060 CCCCAGCTCACCGTGCCCAGAGC No data
Right 1018221262 6:161582088-161582110 GAATCATTGCTTTCATCTACTGG No data
1018221258_1018221262 11 Left 1018221258 6:161582054-161582076 CCAGAGCTCCACGCATGACTGAA 0: 1
1: 0
2: 1
3: 7
4: 82
Right 1018221262 6:161582088-161582110 GAATCATTGCTTTCATCTACTGG No data
1018221260_1018221262 3 Left 1018221260 6:161582062-161582084 CCACGCATGACTGAATGGTGAAT No data
Right 1018221262 6:161582088-161582110 GAATCATTGCTTTCATCTACTGG No data
1018221254_1018221262 26 Left 1018221254 6:161582039-161582061 CCCAGCTCACCGTGCCCAGAGCT 0: 1
1: 1
2: 0
3: 12
4: 181
Right 1018221262 6:161582088-161582110 GAATCATTGCTTTCATCTACTGG No data
1018221257_1018221262 12 Left 1018221257 6:161582053-161582075 CCCAGAGCTCCACGCATGACTGA 0: 1
1: 0
2: 0
3: 7
4: 95
Right 1018221262 6:161582088-161582110 GAATCATTGCTTTCATCTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018221262 Original CRISPR GAATCATTGCTTTCATCTAC TGG Intronic