ID: 1018222347

View in Genome Browser
Species Human (GRCh38)
Location 6:161593600-161593622
Sequence CAGACAAAGGAAAAGGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 938
Summary {0: 1, 1: 0, 2: 9, 3: 83, 4: 845}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018222340_1018222347 11 Left 1018222340 6:161593566-161593588 CCAGCAGGTCTTGCTGGTGGGCT 0: 1
1: 0
2: 0
3: 19
4: 208
Right 1018222347 6:161593600-161593622 CAGACAAAGGAAAAGGAGGCAGG 0: 1
1: 0
2: 9
3: 83
4: 845

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018222347 Original CRISPR CAGACAAAGGAAAAGGAGGC AGG Intronic
900153791 1:1195286-1195308 AACAGAAAGAAAAAGGAGGCCGG - Intronic
900369737 1:2326351-2326373 CAGCCTAAGAGAAAGGAGGCAGG + Intronic
900780084 1:4612270-4612292 CAGAAAAGGGGAGAGGAGGCGGG - Intergenic
901382219 1:8882044-8882066 AAGAAAAAAGAAATGGAGGCCGG + Intergenic
901594220 1:10372080-10372102 CTGACACAGGCAAAGGTGGCTGG + Intronic
901854569 1:12036407-12036429 CAGAAAAAGAAAAAAGAGGCTGG + Intergenic
901923659 1:12552792-12552814 CAGACACACGGAAGGGAGGCCGG + Intergenic
902608751 1:17584562-17584584 TAGAGAAAGGTAAAGTAGGCAGG + Intronic
903185895 1:21628887-21628909 CAGAAAAAAAAAAAGGAGGGGGG + Intronic
904484069 1:30813476-30813498 CAGAGAAAGGAAAACAAGGTGGG - Intergenic
905952527 1:41964260-41964282 CAGAGCGAGGAAAAGCAGGCTGG + Intronic
906176283 1:43775986-43776008 AAGAAAAAGGAATAGAAGGCAGG - Intronic
906686161 1:47764745-47764767 CAGAACAGGGAACAGGAGGCAGG + Exonic
906748993 1:48242158-48242180 CAGACTGAGGCAAATGAGGCTGG - Intronic
906803089 1:48754577-48754599 GAGAAAAAGGAAAAGGGGACTGG + Intronic
906884700 1:49631690-49631712 AAGACTAAGGGAAAGGAAGCAGG + Intronic
907099057 1:51811176-51811198 CAGGGAAAGGTAAAGGAGGAAGG - Intronic
907231270 1:53001272-53001294 GAGAAAAAGGGAAAGGAGGATGG + Intronic
907618317 1:55948161-55948183 CACAGTAAGGAAATGGAGGCAGG - Intergenic
908679439 1:66643400-66643422 CATACAAAAGTAAAGGAGGAAGG - Intronic
908879231 1:68711933-68711955 CAAACAATTGAAAAGGAGACTGG + Intergenic
909091911 1:71236586-71236608 AAGAGAAAGGAAAGGGAGACAGG - Intergenic
909421508 1:75471445-75471467 AGGACAAAAGAAAAGGAGGGAGG + Intronic
909493286 1:76248795-76248817 CAAACAAAGGAAAAGAAAGAGGG - Intronic
909975926 1:82046154-82046176 GTGAAAAAGGAAGAGGAGGCAGG - Intergenic
910054011 1:83009844-83009866 CAGAGAAAGGAAAGGAAGGATGG - Intergenic
910214191 1:84825758-84825780 CAGAGAAAGGCCCAGGAGGCCGG + Intronic
910505793 1:87948994-87949016 AAGCAAAAGGAAGAGGAGGCAGG + Intergenic
910874959 1:91869753-91869775 TCCTCAAAGGAAAAGGAGGCAGG + Intronic
911991741 1:104706897-104706919 CAGAAAAAGGAAAAGGGGAGGGG - Intergenic
912416589 1:109512451-109512473 CAGAAAGAGGAAAGGGAGGCCGG - Intergenic
912579556 1:110707799-110707821 CAGAGAAGAGAAAAGGAGGCAGG - Intergenic
912968443 1:114257892-114257914 CAGAGAAAGGAACTGGATGCTGG + Intergenic
912972671 1:114298730-114298752 CAGAGAAACCAAAAGGAGGCTGG - Intergenic
913120443 1:115735863-115735885 CAGTCAAAGAAAGAGCAGGCCGG + Intronic
913530167 1:119728293-119728315 CAGACAAAACAAAAGCAGGAAGG - Intronic
914840128 1:151241504-151241526 AAGAAAAAGAAAAAGGGGGCAGG + Intronic
914932742 1:151949472-151949494 CAGCCACAGGAGCAGGAGGCTGG + Intergenic
915046045 1:153018114-153018136 GAGAGCAAGGAAAAGCAGGCTGG + Intergenic
915489047 1:156241469-156241491 CAGGCACAGGGAAGGGAGGCAGG - Intronic
915622491 1:157094323-157094345 GAGACAGAGAAGAAGGAGGCTGG - Intronic
916001538 1:160621187-160621209 CAGGCAGAGGCAATGGAGGCTGG + Intronic
916472731 1:165139776-165139798 AAGAAAAAAGAAAAGGAGGTGGG + Intergenic
916486313 1:165262785-165262807 CAGATAAATGAAAAGGTAGCTGG - Intronic
916506720 1:165434796-165434818 CAGACAAAGAAAAACAAGCCAGG - Intronic
916914931 1:169396255-169396277 TAGAAAAACAAAAAGGAGGCTGG + Intronic
917310018 1:173669305-173669327 TAAACAAAGGGCAAGGAGGCAGG + Intronic
917454481 1:175174289-175174311 CAGACAAATGATAAGGATGAGGG + Intronic
918038250 1:180896195-180896217 CAGATCAGGGATAAGGAGGCTGG + Intergenic
918126503 1:181588644-181588666 CAGACAAAAGACTAGGAGACTGG - Intronic
918129776 1:181616734-181616756 CAAACAAAAAAAAAGGAGGTGGG + Intronic
918350682 1:183652725-183652747 CAGACAAAGCAAAAGGAAAAGGG - Intronic
918445315 1:184611462-184611484 AATACACAGGAAGAGGAGGCTGG - Intronic
918546210 1:185687452-185687474 GAGAGAAAAGAAAAGGAGGAAGG - Intergenic
918611712 1:186499871-186499893 AAGACAAGGGAAAAAGAAGCAGG - Intergenic
920528666 1:206685879-206685901 CAGAGAGAGAAAAAGGAGGGAGG - Intronic
920549322 1:206845446-206845468 AAGAGAAAGGAAAAGTAGACGGG - Intergenic
920827997 1:209440013-209440035 TAGACAAGGGAAAAGGAGTTTGG - Intergenic
921037530 1:211396085-211396107 TAGAAAATGGAAAAGGAGGACGG - Intergenic
921112663 1:212054290-212054312 AAGAACAAGGAAAAGGAGACTGG - Intronic
921131225 1:212221695-212221717 AAGACAATGGAGAAGGTGGCTGG + Intergenic
921279860 1:213555853-213555875 AAGATGAAGGAAAAGGAGCCAGG - Intergenic
921686085 1:218090743-218090765 AGGTCAAAGGTAAAGGAGGCAGG + Intergenic
922213263 1:223501200-223501222 GAGGGAAAGGAAAAGGAGGAGGG - Intergenic
922226848 1:223652871-223652893 CTGCCAATGGAGAAGGAGGCTGG - Intronic
922721519 1:227902470-227902492 GAGACAAAGGCCCAGGAGGCCGG - Intergenic
923694536 1:236234557-236234579 GAGACAAAGGATAAGAAGCCAGG + Intronic
924082779 1:240416566-240416588 CAAAGAATGGAAAGGGAGGCTGG - Intronic
924554111 1:245103944-245103966 AAGACAGAGTAAAAAGAGGCGGG + Intronic
924586238 1:245363490-245363512 AAGAAAAGAGAAAAGGAGGCCGG - Intronic
924659100 1:246000341-246000363 AGGAGAAAGGAAAAGGAGACAGG + Intronic
1062879422 10:966156-966178 GAGAAAAAGAAGAAGGAGGCTGG + Intergenic
1063173371 10:3529760-3529782 CAGTCAGAGGAAGAGGAGGAGGG - Intergenic
1063446113 10:6118462-6118484 AAGAAAAAAAAAAAGGAGGCCGG - Intergenic
1063661653 10:8038269-8038291 AAGATAAATGAAAAGGAGGGTGG - Intergenic
1063686438 10:8241232-8241254 CAGACATGGGAAACCGAGGCAGG + Intergenic
1063721679 10:8588658-8588680 CCGGCAAAGGAGAAAGAGGCAGG + Intergenic
1063963786 10:11328858-11328880 CAGAAAACAGAAAAGGGGGCTGG - Intronic
1064443772 10:15375569-15375591 CACACAGAGGAAAAAGAGGAGGG - Intergenic
1064494232 10:15890976-15890998 GAGACAAAGAAAAAGGAGGAAGG + Intergenic
1064695530 10:17961457-17961479 AACAGAAAGGAAAAGCAGGCAGG - Intronic
1064814461 10:19242748-19242770 CAAACAAATGAAAAGCAAGCAGG - Intronic
1065095124 10:22272798-22272820 CAAACAAAAAAAAAGGAGGGTGG - Intergenic
1065334944 10:24647476-24647498 AAGACAAAAGAAAAGTAGGAGGG + Intronic
1065414125 10:25466076-25466098 CAGAAAAAGGAAAAGGGGAGGGG + Intronic
1065483744 10:26217399-26217421 CAGATAAAGGAAATGAGGGCTGG + Intronic
1066022133 10:31314387-31314409 CAGAGAAAGGAAAAAGAGAGAGG - Intergenic
1066379285 10:34887658-34887680 CAGAAATAGCAAAAGCAGGCAGG - Intergenic
1066444416 10:35468887-35468909 AACCCAAATGAAAAGGAGGCTGG - Intronic
1066782144 10:38963069-38963091 AAGACAAATGAGAAGGGGGCAGG + Intergenic
1067293496 10:44960949-44960971 CACACAGAGGAACAGAAGGCAGG - Intronic
1068015403 10:51510093-51510115 CAGTGAAAGGAAAGGGAGGTTGG - Intronic
1068513791 10:58000674-58000696 AAGAAAGAGGAAAAGGAGGCAGG + Intergenic
1069221276 10:65886615-65886637 CAAACAAACCAAAAGCAGGCAGG - Intergenic
1069374944 10:67784247-67784269 GAGAAAGAAGAAAAGGAGGCAGG + Intergenic
1069694400 10:70376213-70376235 CAGTCAAAGGACAAGCAGGCAGG + Intronic
1070118413 10:73551536-73551558 GAAACAAAGGAAAAGGAAGGGGG + Intronic
1070326122 10:75390395-75390417 GAGAAAAAGGAAGAGGAGGAGGG - Intergenic
1070363819 10:75716698-75716720 GAGACACATGAGAAGGAGGCAGG - Intronic
1070478986 10:76862567-76862589 CAGACAAAGCAAAAGTGGACTGG + Intergenic
1070955568 10:80461216-80461238 CAGCCTCAAGAAAAGGAGGCAGG - Intronic
1070991644 10:80738705-80738727 GAGAAAAAGGAAAAAGGGGCGGG - Intergenic
1071288159 10:84167846-84167868 CAGACAAAGGAGCAGTAAGCAGG + Intergenic
1071674878 10:87646270-87646292 AAGACAAAGGAAAAGGGGCTTGG + Intergenic
1071710858 10:88047833-88047855 CAGAGAAAGGAAAAGGAAAGGGG - Intergenic
1072136628 10:92553125-92553147 AAGAAAAAGAAAAAGCAGGCTGG + Intronic
1072197483 10:93128796-93128818 GAGAGAAAGGAAAAGAAGGAAGG - Intergenic
1072841355 10:98777750-98777772 AAGAAGAAGGACAAGGAGGCAGG - Intronic
1073416957 10:103391802-103391824 CAAAAAAAAGAAAAAGAGGCTGG - Intronic
1073451692 10:103613395-103613417 CAGGCAAAGAAAAAGGAGCATGG - Intronic
1073570892 10:104580356-104580378 TTGACAAAGGAATGGGAGGCCGG - Intergenic
1074374517 10:112928273-112928295 CTGACAAAGGAGCTGGAGGCGGG - Intergenic
1074841240 10:117353735-117353757 CAGACAAAGCAAGATGAGGGAGG + Intronic
1075085610 10:119412524-119412546 CAGACCAAAGGAAAGAAGGCAGG - Intronic
1075106867 10:119544971-119544993 CAAAAAAAGGAAAAAAAGGCCGG + Intergenic
1075382664 10:122031702-122031724 TCGAAAAAGAAAAAGGAGGCTGG - Intronic
1075591244 10:123693161-123693183 CATACAAAGTAAAAGGAGTCTGG - Exonic
1075651349 10:124129792-124129814 TGGACAGAGGCAAAGGAGGCTGG + Intergenic
1075762701 10:124869059-124869081 CAGACGGAGGAAAAGAAGGAAGG - Intergenic
1076466641 10:130687361-130687383 CAGTCAAAGGCTGAGGAGGCAGG + Intergenic
1076565783 10:131398184-131398206 GAGAAAAGGGAAAATGAGGCAGG - Intergenic
1076637823 10:131893881-131893903 CAGAAAAAAGAAAGGGAGGTAGG - Intergenic
1078173541 11:8950137-8950159 AAGAAAAAAAAAAAGGAGGCAGG + Intronic
1078255626 11:9656101-9656123 AAGAAAAAGGAAAAGGTGGAGGG + Intergenic
1078640521 11:13091353-13091375 CAGACAAAGGAATAAAAGTCAGG + Intergenic
1078824966 11:14920760-14920782 CAGGCAAAGGAAAAAGGGGAGGG - Intronic
1079285471 11:19126644-19126666 CAAAGAAAGGAACAGCAGGCTGG - Intronic
1079724568 11:23865126-23865148 CAGAAGAAGGAAAAGGAGTAGGG - Intergenic
1080585191 11:33675385-33675407 CAGACACAGGCACAGGAAGCTGG + Intergenic
1080657524 11:34269418-34269440 GAAACAAAGGAAAAGAAGGGAGG + Intronic
1081959777 11:47127046-47127068 TAGACGAAGGAAAAGCAGGTTGG + Intronic
1081976644 11:47239591-47239613 CAGACACAGGGAAATGTGGCTGG + Exonic
1082040513 11:47681031-47681053 CAGTAAAAGGAAAATGAGGCTGG + Intronic
1082263239 11:50093861-50093883 TACAAAAAAGAAAAGGAGGCTGG + Intergenic
1082679213 11:56148078-56148100 CAGACAAAGCAAAAGCAGACAGG - Intergenic
1082850693 11:57761820-57761842 CAGCCAAAGGCAAGGGAGCCTGG - Exonic
1082920952 11:58493263-58493285 GAAAAAAAGAAAAAGGAGGCTGG + Intergenic
1083048419 11:59755984-59756006 CAGGAAAGGGAGAAGGAGGCTGG - Intronic
1083386003 11:62310863-62310885 CAGACACAGAAAAAAGAGCCTGG - Intergenic
1084483413 11:69434791-69434813 CAGACAAAGGCAAAGGCAGGAGG + Intergenic
1084860508 11:72014930-72014952 GAGGCAAAGGAGAAGGTGGCAGG - Exonic
1084870076 11:72092637-72092659 GACAGAGAGGAAAAGGAGGCAGG - Intronic
1084918358 11:72448756-72448778 CAAACAAATGAAAGGGAGGAAGG + Intergenic
1084941977 11:72617829-72617851 CAGAGAGAGGGAAAGGGGGCAGG - Intronic
1084976760 11:72804721-72804743 CAAACAAAAGCAAAGTAGGCCGG - Intergenic
1085532341 11:77199375-77199397 CAGGCAAAGGAGAAGTAGGCCGG + Intronic
1085954421 11:81374034-81374056 GAGACAAAGGAAAGGAAGGAAGG - Intergenic
1085973135 11:81618261-81618283 CTGAGAAAGGTAAAGGATGCAGG + Intergenic
1086165219 11:83769916-83769938 CAGACTTAGGAAGAGGAAGCAGG - Intronic
1086487635 11:87325546-87325568 CAGAGAATGGACAAGGTGGCAGG - Intergenic
1086570617 11:88279867-88279889 TAGACCCAGGAAAATGAGGCAGG - Intergenic
1086734847 11:90293766-90293788 CAGTCAAAGCACAAGCAGGCTGG - Intergenic
1086990271 11:93295208-93295230 CAGACAAAACAAAAACAGGCCGG - Intergenic
1087079181 11:94153218-94153240 CATACAAAGAAAAAGGAAGCAGG - Intronic
1087419420 11:97901963-97901985 AAGACAAAGGAAGAGGAGAAAGG - Intergenic
1087811487 11:102613248-102613270 CACACAAAGGAAAGGCAGGGAGG + Intronic
1088070178 11:105773627-105773649 CAGACAAAGCAAAAGGAAAAGGG + Intronic
1088086259 11:105984267-105984289 GAGAAAATGGACAAGGAGGCAGG - Intergenic
1088840125 11:113619832-113619854 CAGTCAAAGTAAAAGCAGACTGG + Intergenic
1089265361 11:117255819-117255841 TAGACAATGAGAAAGGAGGCAGG - Intronic
1090026936 11:123175617-123175639 AAGATAAAGGAAAAGCAAGCTGG - Intronic
1090121991 11:124039628-124039650 AAGACAAAGGAACAGAAGACCGG - Intergenic
1090377882 11:126304150-126304172 AGCACAGAGGAAAAGGAGGCAGG + Exonic
1090461997 11:126899431-126899453 CTGACAAAGGAAAGGAAGGAGGG + Intronic
1090828415 11:130404099-130404121 CAGCTAAACTAAAAGGAGGCAGG + Intergenic
1090840559 11:130484212-130484234 AAGAAAAACGAAAAGGAGGAAGG + Intergenic
1090861429 11:130656205-130656227 GTGACAAAGGAAAAGTAGGAGGG + Intergenic
1091383241 12:76535-76557 CAGAGAAAGGAAAAGGAACTGGG - Intronic
1091629270 12:2146964-2146986 CAGACACAGGCAAAGGAGAGAGG + Intronic
1091662521 12:2395185-2395207 TAGAGAAAAGAAAAGAAGGCTGG - Intronic
1091751852 12:3027260-3027282 CAAAGAAAGGAGCAGGAGGCTGG - Intronic
1092614392 12:10203187-10203209 GAGAGATAGGAAAAGGGGGCAGG - Intergenic
1093262567 12:16957310-16957332 TAAATAAAGAAAAAGGAGGCTGG - Intergenic
1093364083 12:18271090-18271112 CATACCAAGGAATAGGAGACAGG + Intronic
1093643059 12:21550638-21550660 AAGACAAAGAAAAAGGAGACAGG + Intronic
1094074040 12:26452740-26452762 TGGAGAAAGGAAAAGGAAGCAGG - Intronic
1094169220 12:27474436-27474458 CATAAAAAAGAAAAGGTGGCAGG - Intronic
1094401518 12:30066085-30066107 TATACAAAAGGAAAGGAGGCCGG + Intergenic
1094639560 12:32260931-32260953 CAGACAAGGGAAAAGTCAGCGGG - Intronic
1094681252 12:32669233-32669255 CACACACAGGAAGAAGAGGCTGG + Intergenic
1095357747 12:41296327-41296349 CAGCCAAAGCAAAAGTAGACAGG + Intronic
1095472130 12:42548639-42548661 CAGTCAAAAGAAGAGGAGGTGGG + Intronic
1095610523 12:44122338-44122360 CACAAAAAAGAAAAAGAGGCTGG - Intronic
1095611023 12:44128218-44128240 CAGACAAAGGAAGAGAAGGCTGG - Intronic
1095694476 12:45129192-45129214 AAGAAAAAAGAAAAGGAGGCCGG + Intergenic
1095710969 12:45287623-45287645 GAGAATAAGGAAAAGGAGTCAGG + Intronic
1096139329 12:49229554-49229576 AAGACAAAGGAAAAGTCTGCCGG + Intronic
1096151901 12:49319363-49319385 CAAAAAAAGTAAAAGCAGGCTGG + Intergenic
1096705036 12:53415405-53415427 CAGGGAAAGGAAAAGAAGGGGGG + Intronic
1097032225 12:56097948-56097970 GACACAAAGGGTAAGGAGGCGGG + Intronic
1097177804 12:57153324-57153346 GAGCCAAAGGAAAGAGAGGCAGG - Intronic
1097285560 12:57874386-57874408 CGGAAAAAGGAAAAGGAGCCTGG - Intergenic
1097420505 12:59372804-59372826 GTTAAAAAGGAAAAGGAGGCCGG - Intergenic
1097457440 12:59817201-59817223 AAGACAAAAGAAAAGGAGTTTGG + Intergenic
1097498174 12:60369501-60369523 CAGTCAAAGCAAAAGTAGACTGG - Intergenic
1097594866 12:61616658-61616680 CAGGCAAAGGAGAAGGAGATTGG - Intergenic
1097973092 12:65656069-65656091 CAGAGAAAGGAATTCGAGGCAGG - Intergenic
1098085861 12:66842459-66842481 CACCCAAAGGAAACTGAGGCAGG - Intergenic
1098270180 12:68762388-68762410 CAGAGGAAGGAGGAGGAGGCGGG + Intronic
1098971244 12:76859028-76859050 CCTACAAAGGAAAGGGAGGAAGG + Exonic
1099010398 12:77284761-77284783 CTCAGAGAGGAAAAGGAGGCAGG + Intergenic
1099162410 12:79259435-79259457 ATGACAAAAGAAAAGAAGGCCGG + Intronic
1099305411 12:80948562-80948584 CATATAAAGGAAAAGGATCCAGG + Intronic
1099734913 12:86555069-86555091 CCTTAAAAGGAAAAGGAGGCAGG - Intronic
1100282719 12:93133531-93133553 CAGTCAAAGAAAAAGCAGACTGG + Intergenic
1100455973 12:94752136-94752158 AAGAAAAAGGAAAGGAAGGCCGG - Intergenic
1100778116 12:97994544-97994566 GAGAGAAAGAAAAAGGAGCCTGG - Intergenic
1102259780 12:111436921-111436943 CATACACGGGAAAAGCAGGCTGG + Intronic
1102387593 12:112523002-112523024 CAGTCAAAGCAAAAGCAGACCGG + Intergenic
1102513217 12:113429372-113429394 CATCGAAAGGAAAAGGAGACAGG - Intronic
1103710939 12:122912192-122912214 CAGAAAAAGGAAAAGCAAGAGGG - Intergenic
1103949467 12:124543113-124543135 CAGACCAAGGCCAAGGGGGCTGG + Intronic
1104889723 12:132134484-132134506 CACACAAAGGAAGAGGTGGGAGG - Intergenic
1105352915 13:19632106-19632128 CAGTTAAAGGAAAAAGAGGGAGG - Intergenic
1105977873 13:25489259-25489281 CAGACACAGGAAGAGGAGCCTGG - Intronic
1106030577 13:25998510-25998532 CAGACAAAGGAACAGGAAAGGGG - Intronic
1106402676 13:29444890-29444912 CAGGCAAAGGCAAAGGAAGGAGG - Intronic
1106513978 13:30436805-30436827 AAGAAAGAGGAAAAGGAGGCTGG - Intergenic
1106517239 13:30465672-30465694 CACACAAAGGCAAATGAGGGGGG - Intronic
1106666863 13:31860433-31860455 CAGAAGAAAGAAAAGGAGGATGG - Intergenic
1107316767 13:39140874-39140896 CAGACAAAGGAAAAAGAATAGGG - Intergenic
1107470676 13:40688377-40688399 CAAAAAAAGAAAAAAGAGGCCGG - Intergenic
1107735064 13:43390843-43390865 CCGAAAAAGGGAAGGGAGGCAGG - Intronic
1107971907 13:45651256-45651278 CAGTCAAGGGAAAAGGAGGTTGG - Intergenic
1108134022 13:47335459-47335481 AAGAAATAGGAAAAGGGGGCCGG - Intergenic
1109164171 13:59012781-59012803 CAGTCAAGTGAAAAGGAAGCAGG + Intergenic
1109968969 13:69739528-69739550 CAGACAAAATAAAAGGATGGAGG + Intronic
1110490332 13:76096051-76096073 AAGAAAAAGGGAAGGGAGGCAGG - Intergenic
1111377297 13:87397260-87397282 AAAACAAACAAAAAGGAGGCTGG + Intergenic
1111826067 13:93269560-93269582 CAGAAAAAGCAAAAGAAGGTGGG - Intronic
1112350984 13:98632823-98632845 AAGAAACAGAAAAAGGAGGCCGG - Intergenic
1112371971 13:98802160-98802182 CAGACAAAGCAAAAGGAGACTGG - Intronic
1112404611 13:99107889-99107911 GAGAAAGAGGAAAAGGAGGAAGG + Intergenic
1112480048 13:99766965-99766987 CAGACAGAGGCAAAGCAGGGAGG - Intronic
1112579876 13:100669459-100669481 CATACAAAGGAAAGGAAGGGAGG + Intronic
1113242680 13:108355989-108356011 CAGTCAAAGCAAAAGCAGACAGG - Intergenic
1114164300 14:20203301-20203323 GAAACAAAGGAAAAAGAGGATGG - Intergenic
1115090734 14:29571459-29571481 CACACAAAGTAAAAGGAGCTGGG + Intergenic
1115163717 14:30424593-30424615 CAGAGAAGAGAAAATGAGGCAGG + Intergenic
1115365132 14:32549378-32549400 CAGATAAAGGAAAAGGAAGGTGG + Intronic
1115425238 14:33251263-33251285 CAGACAAAGTGAAAGGACACTGG - Intronic
1116149133 14:41116230-41116252 CAGACAGACAAAAAGGAGGAGGG + Intergenic
1116692090 14:48121167-48121189 AAAACTAAGGAAGAGGAGGCAGG - Intergenic
1117275019 14:54184694-54184716 CAGCAAAAGGAAAAGGAGAAAGG + Intergenic
1117689177 14:58287771-58287793 CAGTCAAAGCAAAAGCAGGCTGG - Intronic
1118070202 14:62238343-62238365 CAGACAAAGCCAGAGGAGACAGG - Intergenic
1118205599 14:63720324-63720346 GAGAAAAAGGAAAAGAAGGATGG + Intronic
1119072026 14:71596154-71596176 GAGACAAAGGAAGATTAGGCAGG + Intronic
1119463168 14:74829131-74829153 CACACAGGGGAAAAGAAGGCTGG - Intronic
1119865034 14:77966298-77966320 CAGGCAAAGGGGAGGGAGGCAGG - Intergenic
1120106521 14:80501761-80501783 CACACCAAAGAAAAGGAGGTGGG - Intronic
1120228923 14:81821778-81821800 TAGACAAAGGAAAAGAAGTTTGG + Intergenic
1120397570 14:83987060-83987082 AAAACAAAGGAAAAGGAGTTTGG + Intergenic
1120556526 14:85934546-85934568 CAGAAAAAGGAAAAGGGGAGGGG + Intergenic
1120816822 14:88869583-88869605 CACACGAAGGTAAATGAGGCTGG - Intronic
1120818715 14:88891919-88891941 CAGTGAAGGGGAAAGGAGGCTGG - Intergenic
1121039458 14:90733357-90733379 CAGATGAAGGAGAAGGAGCCGGG - Intronic
1121160451 14:91734425-91734447 CATAAAAAGGATAAGAAGGCTGG - Intronic
1121510459 14:94509410-94509432 CCGAAAAAGGACTAGGAGGCTGG - Intronic
1121553831 14:94821482-94821504 AAGTCAAAAGAAAAGAAGGCTGG - Intergenic
1121798777 14:96756264-96756286 CAGCCACATGACAAGGAGGCAGG + Intergenic
1122200415 14:100119156-100119178 CAGACAAATGAAAAAGAGAAAGG - Intronic
1122621645 14:103061128-103061150 AAGAAAAAGAAAAAGAAGGCCGG + Intergenic
1122730363 14:103792772-103792794 CAAAAAAAAGAAAAAGAGGCTGG + Intronic
1123821133 15:24031522-24031544 CAGAAAAAGGAAAAGGACTCAGG + Intergenic
1123899147 15:24858863-24858885 GAGAAAAAGGAAAAGGGGGTGGG - Intronic
1124512200 15:30336845-30336867 CAGGGAAAGTAAGAGGAGGCAGG + Intergenic
1124730714 15:32193906-32193928 CAGGGAAAGTAAGAGGAGGCAGG - Intergenic
1124904708 15:33857742-33857764 CAGAGAAAGGAAAAGGAGTGGGG - Intronic
1125065894 15:35486134-35486156 AAGGCAAAGGAGAAGCAGGCAGG + Intronic
1125198388 15:37075033-37075055 CACACACAGGTAAAGGAGCCTGG - Intronic
1125397919 15:39270186-39270208 CAGACAAAAGAAGAAGGGGCTGG - Intergenic
1125538340 15:40455640-40455662 CAGAGTAAGGAGAAGGCGGCTGG - Intronic
1126176805 15:45743399-45743421 CAGAAATTGGGAAAGGAGGCAGG - Intergenic
1126551890 15:49940590-49940612 TAGACAAAGAAAAATGAGGGTGG + Intronic
1127149770 15:56061243-56061265 TAAAAAAAGGAAAAGAAGGCTGG + Intergenic
1127676339 15:61242828-61242850 ATCACAAAGGAAATGGAGGCAGG + Intergenic
1128610643 15:69070431-69070453 GAGAGAAAGAAAAGGGAGGCAGG + Intergenic
1128818648 15:70632195-70632217 CTGACAAAGGAAAAGGAAGCTGG - Intergenic
1129785903 15:78309895-78309917 ATGACGAAGGAAAAGGAGGTGGG + Intergenic
1130079496 15:80720094-80720116 CAACAAAAAGAAAAGGAGGCTGG - Intronic
1130110342 15:80958925-80958947 CAGGCTAAGGAAGAGAAGGCTGG + Intronic
1130224163 15:82045282-82045304 CAGACAAAGAAAGTGCAGGCAGG - Intronic
1130226000 15:82058839-82058861 TAGAGAAAGGAAGAGGAGGGAGG - Intergenic
1130392592 15:83472296-83472318 AAGAGAAGGGAAAAGAAGGCAGG - Intronic
1130659110 15:85816007-85816029 CAGACAAAGAAAATGGAGTGTGG + Intergenic
1130886460 15:88096548-88096570 TAGGCAAAGAAAAAGGATGCAGG - Intronic
1131211134 15:90497898-90497920 CACACAAAGCTAAAGGAGTCTGG - Intronic
1132298983 15:100764918-100764940 GAGAAGGAGGAAAAGGAGGCCGG - Intergenic
1133169943 16:3976479-3976501 CAGACACAGAAACAGGAGTCAGG - Intronic
1133181067 16:4055095-4055117 CAGACAGAGGCAGAGGAGGTGGG + Intronic
1133217875 16:4304390-4304412 CAGGGAAAGGAAAACAAGGCAGG + Intergenic
1133323298 16:4928139-4928161 CAAAAAATGAAAAAGGAGGCTGG - Intronic
1133388894 16:5393153-5393175 CAGAGAAAGGATGAGGGGGCAGG - Intergenic
1133458283 16:5962448-5962470 CACATAATGGGAAAGGAGGCAGG - Intergenic
1133634107 16:7649988-7650010 GGGAGAAAGGAAAAGGAGGAGGG + Intronic
1133757155 16:8770430-8770452 AAAACAAAAGAAAAGAAGGCCGG - Intronic
1134377864 16:13695169-13695191 CAGACTAAGGAAAAAGAGGAGGG + Intergenic
1135066247 16:19312619-19312641 TAGACAAAGGAAAAGAGGGTTGG + Intronic
1135190329 16:20349020-20349042 CAGACGCAGGAGAAGGAGCCTGG + Exonic
1135218507 16:20593019-20593041 AAGAGAAAGGAAAAGAAGGAAGG - Intergenic
1135470591 16:22726268-22726290 AAGAAAAAGAAAAAGGAAGCGGG - Intergenic
1135472569 16:22744490-22744512 CAGAGAAAGGAAGAGGATGGAGG + Intergenic
1135488001 16:22882734-22882756 CAAACAAACAAAAAAGAGGCTGG + Intronic
1135520108 16:23169968-23169990 CAGACAATGGAAATGCAGGCTGG - Intergenic
1135731303 16:24897248-24897270 CTTAAAAAGGCAAAGGAGGCTGG - Intronic
1135879953 16:26245530-26245552 CATAGAGAGGAGAAGGAGGCTGG + Intergenic
1136536545 16:30902970-30902992 CAGGCAAAGCAAAGAGAGGCTGG - Exonic
1137382108 16:48009133-48009155 CTGACAAAGAAAAAGGAAGCAGG + Intergenic
1137550865 16:49436698-49436720 GAGAGAAAGAAACAGGAGGCAGG - Intergenic
1137612804 16:49830184-49830206 CAGAAGAAGGAGAAGGAGCCAGG + Intronic
1137754850 16:50893102-50893124 CAGACATAGGAGGAAGAGGCAGG + Intergenic
1137766917 16:50984978-50985000 GAGCCAATGAAAAAGGAGGCTGG - Intergenic
1137827305 16:51510164-51510186 CTGACAAAGGAGAAGGAAGATGG - Intergenic
1138300667 16:55926848-55926870 CAGTCAAAGCAAAAGCAGACTGG - Intronic
1138396589 16:56709343-56709365 GAGACAAAGGGAAAGGTGGAGGG + Intronic
1138901964 16:61283090-61283112 AAAACAAAGAAAAAGGAGGAGGG - Intergenic
1138945660 16:61846514-61846536 TGGACAAAGGAAAAGAAGACAGG - Intronic
1138958099 16:61995671-61995693 CATAAAAAGTAAAAGTAGGCCGG - Intronic
1139232192 16:65294432-65294454 CAGAAAACGGAAAAGGAGAGTGG + Intergenic
1139381855 16:66537444-66537466 CAGAGGCAGGAAACGGAGGCAGG - Intronic
1139449578 16:67018736-67018758 AAGAAAAAAGAAAAGGAGGCAGG + Intergenic
1139718591 16:68834376-68834398 CAAAAAAATAAAAAGGAGGCTGG - Exonic
1140014572 16:71169127-71169149 CATACAAAGAAAATGTAGGCTGG + Intronic
1140297531 16:73724080-73724102 CAGACAAAAGAATAGGAAGGAGG - Intergenic
1140468260 16:75199358-75199380 CTGAAAAAGTAAAAAGAGGCCGG - Intergenic
1140570908 16:76104968-76104990 GATACAAAGCAAAAGGGGGCAGG - Intergenic
1140639928 16:76959983-76960005 CAGACAAGGGAATATGAGGGAGG - Intergenic
1140814181 16:78605269-78605291 GAGACAGAGGAAGAGGAAGCAGG - Intronic
1140826168 16:78708914-78708936 CAGAAAAATAAAAAGAAGGCAGG + Intronic
1141220585 16:82065733-82065755 CAGATGAAGGAGAAGGTGGCTGG + Intronic
1141493508 16:84390815-84390837 AACACAAAAGAAAAGGGGGCCGG + Intronic
1141549614 16:84796766-84796788 AAAAAAAAGAAAAAGGAGGCTGG - Intergenic
1142872726 17:2831371-2831393 AAGAAAAAGAAATAGGAGGCTGG - Intronic
1142883965 17:2901365-2901387 CAGAGAAGGGAAAAGGAGGATGG - Intronic
1143254629 17:5546520-5546542 CAGACAAAGGAGAAATTGGCGGG - Intronic
1143476763 17:7207600-7207622 CAGAAAATGGAAATGGAGGTTGG + Intronic
1143500426 17:7335617-7335639 CAAACAATGGAAAATGGGGCTGG + Intergenic
1143529879 17:7496599-7496621 CTGACCAAAGAAAAGGTGGCTGG + Exonic
1144212320 17:13025916-13025938 AAGAGAAAGGAAAAAGAGGAAGG - Intergenic
1144796419 17:17894406-17894428 CAGACAAGGGAGGAGCAGGCAGG - Intronic
1145324032 17:21783580-21783602 AAGACAAATGAGAAGGGGGCAGG - Intergenic
1145326580 17:21835215-21835237 AAGACAAATGAGAAGGGGGCAGG + Intergenic
1145375969 17:22349055-22349077 CATATAAAGGAATAGAAGGCTGG - Intergenic
1145721172 17:27074425-27074447 CAGACAAAGGGAAGGTAGCCTGG + Intergenic
1145991721 17:29083062-29083084 CAGAGAAAGGAAAAGGGGCGGGG + Intronic
1146314809 17:31798422-31798444 CAGCCAAGGGAGAGGGAGGCAGG + Intergenic
1147051367 17:37797121-37797143 CAGGCAAGGGAAGGGGAGGCGGG + Intergenic
1147115550 17:38296803-38296825 TTAAAAAAGGAAAAGGAGGCCGG - Intergenic
1148118443 17:45192425-45192447 AAGAAAAAAGAAAAGGAGGAAGG - Intergenic
1148121295 17:45213587-45213609 CAAAAAAATGAAAAGGTGGCTGG - Intergenic
1148414128 17:47492817-47492839 TTAAAAAAGGAAAAGGAGGCCGG + Intergenic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148791747 17:50177092-50177114 GAGGAAAAGGAGAAGGAGGCTGG - Intergenic
1149045287 17:52238039-52238061 CAGGCAAAGGAAACTGAGTCTGG - Intergenic
1149309487 17:55380133-55380155 AAGAAAAAGGAAAAGAAGGTAGG + Intergenic
1149333098 17:55606727-55606749 CTGACGAAGGAAGAGGAGGGAGG - Intergenic
1149681663 17:58511923-58511945 CAGAGCTAGGAAAATGAGGCAGG + Intronic
1149726056 17:58895807-58895829 CTCAAAAAAGAAAAGGAGGCCGG + Intronic
1150060230 17:62061670-62061692 CAATGAAAGAAAAAGGAGGCTGG + Intronic
1150156144 17:62855056-62855078 GAGACAAATTAAAAGGAGTCAGG + Intergenic
1150430350 17:65110689-65110711 AAGACAAAAAAGAAGGAGGCCGG - Intergenic
1150464623 17:65381558-65381580 CAGAAAAGAGAAAATGAGGCAGG + Intergenic
1150562853 17:66309809-66309831 CAGAGAAAGGAGAAGAAGACAGG + Intronic
1151331341 17:73411046-73411068 CAGAGGAAGGAAGGGGAGGCCGG - Intronic
1151383570 17:73741756-73741778 GAGAAAAAGAAAAAGGAGGCAGG - Intergenic
1151390608 17:73784477-73784499 CAGAGAAAGGAACTGGAGACAGG - Intergenic
1152688176 17:81704936-81704958 CTGAGAGAGGAAAAAGAGGCTGG + Intronic
1203190770 17_KI270729v1_random:185806-185828 AAGACAAATGAGAAGGGGGCAGG + Intergenic
1153118368 18:1688872-1688894 CAGAAAAAGAAATAGGAGACAGG - Intergenic
1153224023 18:2884250-2884272 CAAAAAAAAGAAAAAGAGGCTGG - Intronic
1153655799 18:7281046-7281068 TAGACAAAGAGGAAGGAGGCAGG + Intergenic
1153806470 18:8712519-8712541 AAGAGAAAGGAGGAGGAGGCGGG - Intronic
1155560591 18:27072209-27072231 CAGACACAAGGAAATGAGGCTGG - Intronic
1155788606 18:29934142-29934164 CAGAAAAAGGAAAATAAGACAGG + Intergenic
1155865184 18:30956186-30956208 CAGAGAAGGTAAAAAGAGGCTGG - Intergenic
1157355529 18:46930517-46930539 TAGAAAAAAGAAAAGCAGGCCGG + Intronic
1157638607 18:49188411-49188433 CAGACAATGGAAAAGGAAAATGG + Intronic
1157849485 18:51034545-51034567 AAGAAAAAGGAAAAAAAGGCTGG - Intronic
1158950783 18:62492920-62492942 CATACAAAAGAACAGGAAGCTGG - Intergenic
1159303618 18:66611319-66611341 AACACAAAGAATAAGGAGGCCGG + Intergenic
1159595156 18:70376146-70376168 CTGACAAAGGGAAGGGAGGATGG - Intergenic
1159686217 18:71424068-71424090 CACACAAGGCAAATGGAGGCAGG - Intergenic
1159981734 18:74789550-74789572 CAGACAGAGGAAAAGACGACTGG - Intronic
1160261193 18:77295763-77295785 CAGGCAAGGGAGAAGGTGGCTGG + Intergenic
1160278804 18:77466887-77466909 CAGAAGAAGGAAGAGGAGGAGGG - Intergenic
1160510101 18:79448651-79448673 CAGAGAAATAAAAAGGGGGCAGG + Intronic
1161016137 19:1984626-1984648 CAGGCAATGGAGATGGAGGCTGG - Intergenic
1161307194 19:3574569-3574591 CAGCCAACGGAAAAGCAGGTGGG + Exonic
1161458279 19:4381026-4381048 CAGAGAGAGGGAGAGGAGGCCGG - Intronic
1161612138 19:5249013-5249035 TATAAAAAGGAAATGGAGGCAGG + Intronic
1161693625 19:5752729-5752751 CATGGAAAGGAAAAGGGGGCCGG + Intronic
1161822259 19:6537066-6537088 CATAAAAAGGAAGAAGAGGCCGG - Intergenic
1161884049 19:6979678-6979700 CAGATACAGGAAGAGGAGGGGGG + Intergenic
1162475085 19:10895043-10895065 CAGATAGAGAATAAGGAGGCCGG - Intronic
1162553141 19:11369543-11369565 GAGACAGAAGAAAAGGAGGCTGG + Intergenic
1162768756 19:12936793-12936815 CTGACACAGGAACAGGAGGAAGG + Intergenic
1163054336 19:14706851-14706873 CAGTCAGAGGAAATGCAGGCAGG - Intronic
1163504251 19:17695484-17695506 GAAACAAAGAAAAAGGAGGGAGG + Intergenic
1163945979 19:20535066-20535088 CAAACAAATGAAAAGCAGCCTGG + Intergenic
1163998570 19:21076136-21076158 AAGAAAAAAGAAAAAGAGGCCGG - Intergenic
1164258935 19:23552536-23552558 AAGAGAAAGCAAAAAGAGGCTGG - Intronic
1164587441 19:29484866-29484888 CAGGGAAAAGAAAAGGGGGCTGG - Intergenic
1164845004 19:31424554-31424576 CAGACATAGGCAGAGGAGCCAGG - Intergenic
1165895718 19:39139708-39139730 CAGCCAAAGGATAAGGAGATTGG - Intronic
1165936670 19:39393390-39393412 AAAAAAAAAGAAAAGGAGGCTGG - Intronic
1166164372 19:40976990-40977012 GAGAGAAAGGAAAAGGAAGGAGG - Intergenic
1166197137 19:41214480-41214502 AAGAAAAAGGAAAAGAAAGCAGG - Intergenic
1166514458 19:43435944-43435966 CAGATAAAGAAAAAGAAGGAAGG + Intergenic
1166881289 19:45931666-45931688 GAGACCAAGGCCAAGGAGGCTGG - Intergenic
1166965086 19:46524985-46525007 CAGAAAAAGAAAAAGAAGGAAGG - Intronic
1167026655 19:46924505-46924527 CAGGCAAAGGAAAATCAGACAGG - Intronic
1167315924 19:48762609-48762631 CAGAGAGAGGAAAGGCAGGCAGG + Intergenic
1167726094 19:51213830-51213852 AAGAAAAAGAAAAATGAGGCTGG - Intergenic
1167871839 19:52377161-52377183 CATACACAGGTCAAGGAGGCAGG - Intronic
1168236745 19:55068537-55068559 CAAAAAAAGAAAGAGGAGGCCGG + Intronic
1168320249 19:55504791-55504813 CAGAGAAAGAAACAGGTGGCCGG - Intronic
1168565532 19:57419175-57419197 CAGTAAAAGGAACAGGTGGCTGG - Intronic
925466537 2:4111108-4111130 GAGAGAAAGGAAACGGAGGGAGG - Intergenic
925515087 2:4673221-4673243 CAGAAAAAGGAAAAGGGGAGGGG - Intergenic
926209311 2:10857525-10857547 GAGACGAAGGAAGAGGAGGAGGG - Intergenic
926753212 2:16216114-16216136 CAGACAAAGGAACATGTGTCAGG - Intergenic
926934315 2:18072066-18072088 GAGAGAAAGGAAAAGGAACCAGG - Intronic
927061509 2:19427161-19427183 CAGAGAGAAGAAAAGGAGGTAGG + Intergenic
927716528 2:25356716-25356738 AAGGCAAAGGAAGAGCAGGCAGG - Intergenic
927971541 2:27308571-27308593 CTGACACACGAAAGGGAGGCGGG + Intergenic
928655554 2:33447262-33447284 TAGCCCAAGGAACAGGAGGCTGG + Intronic
929105635 2:38362825-38362847 GAGCCAAGGGAAATGGAGGCAGG + Intronic
929389362 2:41451401-41451423 CAGGCAAAGCAAAAGCAGGCTGG + Intergenic
930643513 2:53878866-53878888 ATCACAAAGGAAATGGAGGCAGG - Intronic
930791909 2:55341441-55341463 CAGAAAAAAAAAAAGGGGGCGGG - Intronic
930989717 2:57638315-57638337 AAGATGAAGGAAAAGGAGGTAGG + Intergenic
931102421 2:59017387-59017409 CAGAAAAGGGGAAAGGAGGGAGG + Intergenic
931691470 2:64837990-64838012 AAGGGAAAGGAAAAGGAAGCAGG + Intergenic
931764414 2:65442210-65442232 TAGAAAAAGGAATAGAAGGCCGG + Intergenic
931965721 2:67532006-67532028 CAGACCAAAGGAAAGGAGACTGG + Intergenic
932155799 2:69416020-69416042 CAGAAAAAAGGAAAGGAGGAAGG + Intronic
932600081 2:73117879-73117901 AAGAAAAAGAAAAAGAAGGCCGG + Intronic
932615907 2:73231413-73231435 CAAAAAAAAGAAAAAGAGGCCGG - Intronic
932672321 2:73748962-73748984 AAGAAAAAGAAAAAGGACGCTGG - Intergenic
932928087 2:76000298-76000320 CAGACAGAGGAAACTGAGGCAGG - Intergenic
933030846 2:77326818-77326840 CAGAGGAAGGGAAAGTAGGCTGG - Intronic
933161106 2:79026140-79026162 CTGACACAGGAGAATGAGGCAGG - Exonic
933513967 2:83277669-83277691 CAAACAAAAGAAAAGTAGCCAGG + Intergenic
933895373 2:86806437-86806459 CAGGCCAAGGACAAGGAGGAAGG - Intronic
934046492 2:88176988-88177010 AAGACAAGGGAGTAGGAGGCAGG - Intronic
934962339 2:98687688-98687710 GAAACAAAGAAAAAGGAGACAGG - Intronic
936589081 2:113785724-113785746 CAGAAGAAGGAAAAGGAGTGAGG - Intergenic
936950011 2:117968229-117968251 CAGAAGAAAGAAAAGGAAGCTGG - Intronic
936981090 2:118266123-118266145 TGGAGAAAAGAAAAGGAGGCAGG + Intergenic
937099230 2:119255917-119255939 ATGATAAAGGAAACGGAGGCAGG + Intronic
937734087 2:125268622-125268644 GTGATAAAGGAAAAGGAGACAGG - Intergenic
937877695 2:126837656-126837678 CAGGCAGAGGAAAAGGTGCCAGG + Intergenic
937912419 2:127082001-127082023 CAGACAGAGGACAGGCAGGCGGG + Intronic
938057593 2:128228356-128228378 CAGAGAAAGGAAAAAGAGAGAGG + Intergenic
938099708 2:128490439-128490461 CAGGCAAAGGAGAAGGAGGAAGG + Intergenic
938145587 2:128832499-128832521 AAGAAAAAAGAAAAGGAGGGAGG - Intergenic
938295915 2:130179415-130179437 CAAAAAAAGAAAAAAGAGGCTGG - Intronic
938419949 2:131137241-131137263 CAAAAAAAGTAAAAAGAGGCCGG - Intronic
938676066 2:133635207-133635229 CAGACAGAGGAAAAGGAAGGGGG + Intergenic
938709140 2:133960404-133960426 AAGAAAAAGAAAAAAGAGGCTGG - Intergenic
939028130 2:137038697-137038719 CAGAAAAGGGTCAAGGAGGCAGG + Intronic
939136065 2:138295781-138295803 AAGAAAAAGGAAGAGGAGGAGGG - Intergenic
939603470 2:144222807-144222829 CAGAAAAAAGAAAAGAAAGCTGG + Intronic
940528600 2:154849425-154849447 CAGACAGAGAAAAAAGAGACAGG - Intronic
941474365 2:165931496-165931518 CAGACAAAGGAAATAGAAGGTGG - Intronic
941613830 2:167695891-167695913 CAACCAGAGGGAAAGGAGGCAGG + Intergenic
942044028 2:172088639-172088661 CAGACAGAGCAAAAGGAGACAGG - Exonic
942083647 2:172425229-172425251 CAGATAAAGAAAAACAAGGCTGG - Intergenic
942295893 2:174516883-174516905 AAGAGAAAGGTAAAGAAGGCAGG - Intergenic
943308127 2:186292529-186292551 CAAAAAAAGAAAAAGGATGCAGG + Intergenic
943556237 2:189407801-189407823 AAAACAAAGGAAATGGAGCCTGG - Intergenic
943920195 2:193697671-193697693 CAGACTAATGAAAAGAAAGCAGG - Intergenic
943976915 2:194493655-194493677 CAGAGAAAAGAGAAGGAAGCTGG + Intergenic
944711462 2:202338506-202338528 AAAACAAAGAAAAAGGAGGGAGG - Intergenic
945582377 2:211611312-211611334 CAGAAAAAGGAAAAGGGGAGGGG + Intronic
945755094 2:213836179-213836201 CAGACATAGGAAATGGGGGGGGG - Intronic
946106135 2:217371586-217371608 CAGACAAAAAAAATTGAGGCTGG + Intronic
946189923 2:218002755-218002777 CAGCAAAAGGATAAGGTGGCAGG + Intronic
946243267 2:218369780-218369802 AAGAAAAAGGAAATTGAGGCTGG - Intergenic
947032244 2:225809869-225809891 CAGTCAAAGCAAAAGCAGACCGG - Intergenic
947229760 2:227872839-227872861 CAGCCAAAGGGAATGGTGGCTGG - Intronic
947455828 2:230253060-230253082 AAGACATAGAAACAGGAGGCAGG + Intronic
947504258 2:230694809-230694831 CAGACGAAGGTAAAAGAGGGAGG + Intergenic
948125676 2:235563276-235563298 CAGACACAGCAAAGGGGGGCAGG - Intronic
948169157 2:235887386-235887408 CAGAGGAGAGAAAAGGAGGCAGG - Intronic
948264934 2:236629231-236629253 GAGACACAGGAAAAGGGAGCAGG - Intergenic
948444268 2:238019953-238019975 AAGAGAAGGGAACAGGAGGCTGG - Intronic
948568443 2:238901270-238901292 GAGCAAAAGGCAAAGGAGGCCGG - Intronic
948978237 2:241477422-241477444 CACAAAAAGGAACATGAGGCCGG - Intronic
1169676033 20:8156119-8156141 CAGACAAAGCAAAAGAATGCAGG - Intronic
1169792364 20:9425025-9425047 AAGACAAAGGAGAAGGAGGAAGG - Intronic
1170716171 20:18832935-18832957 GAGAGAAAGGAGAGGGAGGCTGG + Intergenic
1171094619 20:22319493-22319515 GAGAAAGAGGAAAAGGAGGAGGG + Intergenic
1171161187 20:22925202-22925224 GACACAAAGGAAAAGGAGAGGGG - Intergenic
1171283896 20:23922368-23922390 GAGACAAAGGAAAAAGAGGAGGG - Intergenic
1171339920 20:24419817-24419839 CAGACCTAGTAGAAGGAGGCAGG + Intergenic
1172392367 20:34574595-34574617 CAGGCAGAGGAGAAGGGGGCCGG - Intronic
1172589246 20:36105891-36105913 CAGAATAGGGAAAAGGTGGCAGG - Intronic
1172760921 20:37321009-37321031 CAAAAAAAAAAAAAGGAGGCCGG - Intergenic
1173150280 20:40561456-40561478 CAGTCTCAGGCAAAGGAGGCTGG - Intergenic
1173408192 20:42785792-42785814 GAGACAAAGGGGAAGGAGGAAGG - Intronic
1173594629 20:44250785-44250807 CCCACAAAGGAGGAGGAGGCTGG - Intronic
1173677262 20:44846793-44846815 CAGTCAATGCAAAAGCAGGCTGG + Intergenic
1173952772 20:47006326-47006348 TTCACAAAGGAGAAGGAGGCAGG + Intronic
1174485194 20:50856575-50856597 CACAAAAGGGACAAGGAGGCTGG - Intronic
1174571322 20:51503739-51503761 CAAACACAGGGAGAGGAGGCTGG + Intronic
1174602523 20:51736226-51736248 AAGATAAAGGACAAGGAGGGAGG + Intronic
1174795885 20:53522339-53522361 CAAACAAAGGAAAAGAATGATGG - Intergenic
1174908858 20:54584309-54584331 CACACAAAAGAAAATGAGGAAGG - Intronic
1175505518 20:59481694-59481716 CAGGCTCAGGAAAAGGAGGGGGG + Intergenic
1176281938 20:64318252-64318274 CAGAGAAAGGAAAAGGAACCGGG + Intergenic
1176952894 21:15065865-15065887 AAGACAAGGGAAAAGGAGCAGGG + Intergenic
1177182517 21:17758461-17758483 GAGACAGAGGAACAGGAGGATGG - Intergenic
1177538420 21:22460080-22460102 AGGAAAAAGGAAAAGGAAGCAGG + Intergenic
1178424927 21:32471620-32471642 AAAAAAAAGGAAATGGAGGCTGG - Intronic
1178676480 21:34635547-34635569 CACCCAAAGGGTAAGGAGGCAGG + Intergenic
1179360942 21:40708192-40708214 TAGACAAAATATAAGGAGGCTGG + Intronic
1179768476 21:43594249-43594271 CAGAAAAAGGAAAATGACGTTGG + Intronic
1181091930 22:20479389-20479411 CAAACAAACAAAAAGTAGGCCGG + Intronic
1181469662 22:23130157-23130179 AAGAAAAAGAAAAAGAAGGCCGG + Intronic
1181473434 22:23154464-23154486 CAGTCAAGAGCAAAGGAGGCTGG + Intronic
1181879731 22:25968604-25968626 CAAAGAAAGGAAATGGAGGCCGG + Intronic
1182541276 22:31043909-31043931 CCGAAAAAAGAAAAAGAGGCTGG + Intergenic
1183031697 22:35111241-35111263 CAGAGACAGGAAGAGAAGGCTGG + Intergenic
1183257335 22:36770968-36770990 AAGAAAAAGGAGAAGCAGGCGGG - Intronic
1183312203 22:37116442-37116464 CATAAAAAGGATAAGGAGTCTGG + Intergenic
1183389003 22:37533135-37533157 AAGAAAAAAGAAAAGAAGGCGGG + Intergenic
1183691707 22:39393563-39393585 TAAAGAAAAGAAAAGGAGGCTGG - Intergenic
1184697906 22:46150237-46150259 CAGCCAAGGGAAACTGAGGCCGG - Intergenic
1185304942 22:50109852-50109874 AAGAGAAAGGAAAAGGAGGCTGG + Intronic
1185336163 22:50271734-50271756 CAGCTAAAGGAGGAGGAGGCCGG + Intergenic
1185362189 22:50414969-50414991 CTGGCAGGGGAAAAGGAGGCAGG - Intronic
950071779 3:10158444-10158466 AAAAAAAAAGAAAAGGAGGCCGG - Intergenic
950131591 3:10550935-10550957 CAGCCACAGGAACAGCAGGCCGG - Intronic
950403923 3:12792763-12792785 AAGAAAAAAGAAAAAGAGGCTGG - Intergenic
950727147 3:14923827-14923849 CAGACAAAGGCTATGGGGGCTGG - Intronic
950727203 3:14924130-14924152 CTGACAGAGGTAAAGCAGGCAGG + Exonic
951073925 3:18366293-18366315 AATACAAAGGAAAAGGAAGCAGG - Intronic
952130157 3:30352774-30352796 CAGAAAGAGGAAAATGAGACAGG + Intergenic
953164234 3:40450245-40450267 CAGAAAAATAAAAAGGAGGATGG - Intergenic
953472130 3:43176721-43176743 CGGAGAAAGGAAATGGAGGAAGG + Intergenic
953604746 3:44404433-44404455 CAGAAAAAGGCTAAGGAAGCAGG - Intronic
954553454 3:51500792-51500814 AAGACAGAGAAAAAAGAGGCTGG - Intergenic
954788836 3:53115537-53115559 GAGAGAAAGGAAAAGGTGGCGGG - Intronic
954933099 3:54301300-54301322 CAGAAAAAAAAAAAAGAGGCCGG + Intronic
955307450 3:57848549-57848571 AAGAAAAAGGAGAAGGAGGGAGG - Intronic
955756299 3:62228224-62228246 AAAACAAAGAAAAAGGAGGCTGG + Intronic
955909709 3:63847439-63847461 CAGAAGAATGAAAAGAAGGCCGG + Intronic
956058224 3:65323000-65323022 TAGAAAAAGAAAAAGGAGGCCGG - Intergenic
956682275 3:71791880-71791902 CAGACCTAGGAAAAGGAGGTGGG - Intergenic
956768556 3:72505293-72505315 AGGACAAAGGAGAAGGAGGAAGG + Intergenic
957539894 3:81554166-81554188 CACACAAAGGAAATGGTGGGGGG + Intronic
959007113 3:101032396-101032418 CAGTCAAAGCAAAAGTAGACTGG + Intergenic
959248367 3:103904963-103904985 CAGAAAAAGGAAAAGTAAGAAGG + Intergenic
959932087 3:111996172-111996194 CATAGAAAGAAAAATGAGGCTGG - Intergenic
960096535 3:113695984-113696006 CAGGAAAAGGTGAAGGAGGCGGG + Intronic
960097127 3:113699291-113699313 CAGGAAAAGGTGAAGGAGGCGGG - Intergenic
960164286 3:114384292-114384314 GGGAAAAAGGAAAAGGGGGCTGG + Intronic
960320598 3:116230973-116230995 AACACAAAGGAAAAAGAGTCAGG - Intronic
960333240 3:116388287-116388309 CACCCAAAGGAAAAGGTGGAGGG + Intronic
960496369 3:118380345-118380367 TAGAAAAAGGAAAAGGAAGGGGG + Intergenic
960540064 3:118851904-118851926 CAGAAAAAGGAAAAGGGGAGGGG + Intergenic
960630413 3:119725153-119725175 CAGGTAAAGGAAAGGGAGGCTGG - Intronic
960942027 3:122941164-122941186 CAGGCAGAAGAAAAGGAGGAAGG + Intronic
961588028 3:127950733-127950755 CAAATAAAGAAAAATGAGGCCGG + Intronic
961834907 3:129649602-129649624 TTGCCAAAGCAAAAGGAGGCTGG + Exonic
962129881 3:132660796-132660818 CAGACCAAGAAAAGGGTGGCGGG - Intronic
962231047 3:133665646-133665668 TATAGAATGGAAAAGGAGGCCGG + Intergenic
962876577 3:139539832-139539854 CCTACAAAGGAAGAGGAGACCGG + Intergenic
962952186 3:140229486-140229508 GAGAAAAAGGAAAAGGAGGGTGG - Intronic
963594751 3:147311865-147311887 TAGACAAAGCAAATGGAGCCTGG + Intergenic
963844047 3:150136969-150136991 CAGACCAAGGAAGAGCAAGCTGG + Intergenic
964081634 3:152765869-152765891 CAAACAACTGAAAAGGAGGGAGG + Intergenic
964236002 3:154528592-154528614 AAGAAAAAGGAAAAGGAGGAAGG - Intergenic
964420626 3:156498964-156498986 CAGTCAAAGAAAAAGCAGACTGG + Intronic
965781321 3:172289205-172289227 CAGACAAAGCCAAGGGATGCAGG - Intronic
965888099 3:173474129-173474151 AAGGAAAAGGAAAAGGAGGAGGG - Intronic
966260221 3:177968527-177968549 AAGACTAATGAAAAGAAGGCTGG + Intergenic
966428064 3:179802236-179802258 AAGAAAAAAGAAAAGCAGGCTGG + Intronic
966480678 3:180404926-180404948 CACCCAACTGAAAAGGAGGCTGG + Intergenic
966636341 3:182138165-182138187 TAGAGGAAGGAAAAGGAGGGAGG + Intergenic
966902047 3:184493617-184493639 CAGACCAAGAAAAAGCAGCCAGG - Intronic
967069752 3:185952475-185952497 CAGAGAAAGGGAGAAGAGGCGGG + Intergenic
967401673 3:189069808-189069830 AATACAAAGGAAAAACAGGCTGG + Intronic
967465286 3:189798016-189798038 CAGTCAAAGGATAGGGAGGAAGG - Intronic
967664799 3:192158294-192158316 GAGAAAAGGGAAAAGCAGGCAGG - Intronic
967735093 3:192943361-192943383 GAGACTTAGAAAAAGGAGGCTGG + Intergenic
968041419 3:195592257-195592279 GAGAGAAAGGAGAAGGAGGGAGG + Intergenic
968075969 3:195816307-195816329 CTGTGTAAGGAAAAGGAGGCCGG - Intergenic
968186375 3:196635710-196635732 CAAAGAAAGGAGGAGGAGGCCGG - Intergenic
968893459 4:3385055-3385077 GGGACCAAGGAAAAGGAGCCAGG - Intronic
969273177 4:6116643-6116665 CAGACAAACGACTTGGAGGCTGG - Intronic
969273419 4:6118408-6118430 CAGACAAATGACATGGAGGCTGG + Intronic
969296102 4:6271294-6271316 CAGACACAGGAAAAGTTGGCTGG + Intronic
969512244 4:7625363-7625385 CAGACAAAGAAACAGAAGCCTGG - Intronic
970168119 4:13261578-13261600 CAGACACAGGAAGAACAGGCAGG + Intergenic
970571979 4:17392373-17392395 CAGACAAAGGGAAGGAAGGAAGG + Intergenic
970735781 4:19165870-19165892 CAGACAAATCAGAAGGAGTCTGG + Intergenic
970852535 4:20618170-20618192 CAGACAAAGGAGAAGGAGGAAGG - Intronic
971204219 4:24547641-24547663 AAGACAAATGAAAACTAGGCAGG + Intronic
971919800 4:32923107-32923129 AAGACAAAGGAGCAGGTGGCTGG - Intergenic
972518801 4:39834233-39834255 CAGTGAAAGGAAAAGCAGACTGG + Intronic
972610593 4:40652172-40652194 CACAAAAAGAAAAAAGAGGCCGG + Intergenic
972652191 4:41028908-41028930 TAGAAAAGGGAAAAGGAGGAGGG - Intronic
973246049 4:48012510-48012532 CAGCAAAAGGAAAAAGAGGAAGG - Intronic
974005454 4:56551981-56552003 CAAACAACTGCAAAGGAGGCTGG + Intronic
974348443 4:60713329-60713351 CAGTGAAAGGAAAAGGAAACAGG + Intergenic
974921161 4:68240773-68240795 GAAACAAAGGAAAAGAAGCCAGG + Intronic
975063103 4:70028172-70028194 CAGACAACGGAAAAGCACGCTGG - Intergenic
975065009 4:70050172-70050194 CAGACAACGGAAAAGCACGCTGG - Intergenic
975590173 4:75991686-75991708 CATACAAGGGAAAAGAGGGCTGG + Intergenic
975659746 4:76676639-76676661 CAGACAAAGGAAAATGGAGGAGG + Intronic
976038350 4:80852119-80852141 CAGAAAAGGGAAGAGAAGGCGGG - Intronic
976211213 4:82672307-82672329 CAGACTAAGAAAAAAGAGGTAGG + Intronic
976352065 4:84070867-84070889 GAGAGAAAAGAAAAGGATGCTGG + Intergenic
976375576 4:84342025-84342047 GAGACCAAGGAAAAGCAGGGTGG + Intergenic
976536065 4:86218910-86218932 GAGATAAGTGAAAAGGAGGCTGG + Intronic
976890416 4:90039766-90039788 CAGACAAAGAGAGAGGAGGAAGG - Intergenic
976987892 4:91325794-91325816 CAGACAAAGAAAAAAGAGTTTGG + Intronic
977566872 4:98589457-98589479 CAGACAAAGGAAAGGGAAGGAGG + Intronic
978844638 4:113258194-113258216 GAGAAAAAGGAAAGGGAGGAAGG - Intronic
979111874 4:116768745-116768767 GAGACACAGGAAAATGAGGTAGG - Intergenic
979282522 4:118883747-118883769 CAAATAAAATAAAAGGAGGCGGG + Intronic
979286329 4:118929115-118929137 GAGATAAAGGAAAAGTAGGAAGG + Intronic
979792845 4:124807736-124807758 AAGACAAAGGAAAAGGACTTTGG + Intergenic
980073424 4:128267042-128267064 CAAACAAAGGAACAGTAAGCAGG - Intergenic
981123915 4:141083939-141083961 CAGACATAGGATTGGGAGGCAGG - Intronic
981166998 4:141572141-141572163 TAGACAAAAGAAAGGGAGGACGG - Intergenic
981816426 4:148835877-148835899 CCCAGAAAGGAAAAGGAGGATGG - Intergenic
982915443 4:161203226-161203248 AACACAAATGAAAAAGAGGCTGG - Intergenic
983019134 4:162653529-162653551 AAGAAAAAGGACAAGGAGGTTGG - Intergenic
983425507 4:167579305-167579327 AAAACAAAGGAAAAGGAACCAGG - Intergenic
983463785 4:168060354-168060376 CACACAAAGAAAAAGAAGACTGG - Intergenic
984001429 4:174251457-174251479 GAGAAAAGGGAAAAGGAGGGTGG + Intronic
984908780 4:184652849-184652871 AAGAAAAAAGAAAAGGAGGGAGG + Intronic
985034370 4:185823175-185823197 CATAAAGGGGAAAAGGAGGCCGG - Intronic
985509440 5:304278-304300 CAGACAAAGGAAACACAAGCGGG - Intronic
985583751 5:715362-715384 CACACAAAGGAAATGGTGGGAGG + Intronic
985597259 5:799659-799681 CACACAAAGGAAATGGTGGGAGG + Intronic
985738836 5:1602612-1602634 CAGACAAAGGAAACACAAGCGGG + Intergenic
985927998 5:3032919-3032941 CGGACATAGGAAATGGAGGCAGG + Intergenic
986140542 5:5025963-5025985 CAGAAAAAGGAAAAGGGGAGGGG - Intergenic
986211595 5:5678730-5678752 GAGAGAAAGGAAAAGGATGAGGG + Intergenic
986232022 5:5874253-5874275 AACACACAGGAAAAAGAGGCTGG - Intergenic
986248050 5:6029019-6029041 AACAAAAAGCAAAAGGAGGCTGG - Intergenic
986536077 5:8788799-8788821 GAGACAAATAAAAAGGAGGGAGG - Intergenic
986566759 5:9123416-9123438 AAGAAGAAGGAAAAGGAGGAGGG + Intronic
987123949 5:14793584-14793606 CAGGCAAAGGACAAGCAGCCAGG + Intronic
987472491 5:18350551-18350573 CTGACGAAGGATTAGGAGGCAGG - Intergenic
987503954 5:18746306-18746328 CAGAAAAAGGAAAAGGGGAGGGG - Intergenic
988110406 5:26812712-26812734 CAGAGCAAGGAAAAGCAGGGTGG + Intergenic
988729460 5:33956408-33956430 CAGTCAAAGCAAAAGCAGACAGG + Intronic
989512697 5:42306533-42306555 CAGACAAAGGAGAAGTTGGAAGG + Intergenic
989786737 5:45341586-45341608 CAGTCAAAGCAAAAGCAGACTGG + Intronic
989972325 5:50539921-50539943 GAAACAAAGGAAGAGAAGGCAGG + Intergenic
990059967 5:51635717-51635739 CAGCAAAAGGAAAAAAAGGCAGG + Intergenic
990066728 5:51725619-51725641 CATAGAAAGGAAAAGGACACTGG + Intergenic
990503119 5:56416747-56416769 CAGAAAAGGGAATAGGAAGCAGG + Intergenic
991037455 5:62142272-62142294 CAGAGAAAAGAAAACAAGGCAGG + Intergenic
991669965 5:69037800-69037822 GAGAAAAAGGAAAATGAGGCTGG + Intergenic
991927115 5:71716652-71716674 CAGATATAGAAAAGGGAGGCAGG - Intergenic
992170880 5:74100877-74100899 CAGTGAAAGGAAAAGCAGACTGG - Intergenic
992402736 5:76426610-76426632 AACACAAAGCAAAAGGAGCCAGG - Intronic
992595225 5:78339925-78339947 CAGACTCAGGAAAAAGAGGAAGG - Intergenic
992975324 5:82111100-82111122 CAGAAATAGGAAAGGGAGGAAGG - Intronic
993457236 5:88141201-88141223 CAGACGAGGGAAAGGGAGGAAGG - Intergenic
993765362 5:91849596-91849618 CAGAAAAAGGAAAAGCAAGATGG - Intergenic
993791816 5:92219176-92219198 CAGACTAGGGGAAAGAAGGCAGG - Intergenic
994173153 5:96680473-96680495 CAAACAAAGAAAAAAGATGCAGG - Intronic
995269096 5:110200706-110200728 CAGGCAAGGGGAAATGAGGCTGG + Intergenic
995497035 5:112757435-112757457 CAAAAAAGGCAAAAGGAGGCTGG + Intronic
996149443 5:120017420-120017442 CAGACAAAGGAAAGGAAAGGAGG + Intergenic
996630797 5:125629809-125629831 CAGCCCAGGGAAGAGGAGGCTGG + Intergenic
996650240 5:125867001-125867023 TAGACAAAAGAAAAGGTGGTTGG + Intergenic
996734690 5:126747868-126747890 CAGACAGAGGAAAAAGAGTTTGG + Intergenic
997439234 5:133897566-133897588 CAAGCCAAGGATAAGGAGGCAGG + Intergenic
998142637 5:139708989-139709011 CAGAAAAAGGAAGCTGAGGCTGG - Intergenic
998232753 5:140371758-140371780 AAGACAAAGAAAAAGATGGCAGG + Intronic
998278279 5:140779849-140779871 TAGTCAAAGTAAAAGCAGGCTGG + Intergenic
998453244 5:142250724-142250746 CAGACAAAGTAAGTGGAGGAAGG + Intergenic
998457896 5:142287821-142287843 CAGACACAGGAAAAGGCTGGCGG + Intergenic
998831882 5:146168399-146168421 CAGAAAACTGAAACGGAGGCTGG + Intronic
998910953 5:146959705-146959727 CAGGCAAGGGAAGAGGAGGATGG + Intronic
999041495 5:148418272-148418294 CAAGCAAAGGAAAATGAGGTAGG - Intronic
999375976 5:151086865-151086887 AAGACAGTGGAGAAGGAGGCTGG + Intronic
999517393 5:152314874-152314896 CAGCCAAAGCAAAAGGAGTCGGG + Intergenic
999592046 5:153158838-153158860 CAGGAAAAGGAAAAGCAGGCGGG - Intergenic
1000261383 5:159591717-159591739 CTGACAAGGGAAAAGGAGCAGGG - Intergenic
1000796519 5:165671339-165671361 CAAATAGAGGAAAGGGAGGCAGG + Intergenic
1000835904 5:166153854-166153876 TAGAAAAAGGAAAATGAGGCTGG - Intergenic
1000899069 5:166891220-166891242 AATAAAAAGGAAAACGAGGCCGG + Intergenic
1001972966 5:175971552-175971574 TAGAGAAAGCAAATGGAGGCTGG - Intronic
1002134426 5:177098978-177099000 CAGACAGAGGGATTGGAGGCTGG + Intergenic
1002189194 5:177470026-177470048 GGGACAAAGGAAATGAAGGCGGG + Intronic
1002198520 5:177513940-177513962 CAGACAAAGAAATAGGAAGGAGG - Intronic
1002244472 5:177872237-177872259 TAGAGAAAGCAAATGGAGGCTGG + Intergenic
1002255779 5:177957734-177957756 CAGTAAATGGAAAAGGAGCCAGG + Intergenic
1002663347 5:180805453-180805475 CAGTAAAAGTAAAAGCAGGCTGG + Intronic
1002917064 6:1538048-1538070 AAGACCAAAGAAAAGGAGGGAGG + Intergenic
1003123650 6:3338143-3338165 AAGACAAAGGAAAAGGCTTCGGG - Intronic
1003145184 6:3504425-3504447 CAGACACAGGGAAAGGAAGGTGG + Intergenic
1003158514 6:3616657-3616679 CAGGCACAGGAAAAGGATCCAGG + Intergenic
1003337159 6:5185045-5185067 AAGACAAAGGGCAAGGAGGAAGG - Intronic
1003844741 6:10161304-10161326 TAGATAAAGGTAAAGAAGGCAGG + Intronic
1003945537 6:11072103-11072125 CAGAGAAAGGGAAGGGAGGTGGG + Intergenic
1004313272 6:14564582-14564604 GAGTCAAAGTAAAAGGAGGATGG + Intergenic
1004360835 6:14969344-14969366 TAGACAAAGGAAAAGGGGTTTGG + Intergenic
1004455292 6:15786154-15786176 CTGAGAAAGGAACAGGATGCAGG - Intergenic
1004569932 6:16835237-16835259 AAAAAAAAAGAAAAGGAGGCTGG - Intergenic
1004740291 6:18453432-18453454 CAAACAAAAAAAAAGCAGGCTGG - Intronic
1004942109 6:20569699-20569721 CACACAAAGGAAAATGCTGCAGG - Intronic
1005045781 6:21640954-21640976 CAAAAAAAGGAAAAGATGGCCGG - Intergenic
1005083625 6:21981564-21981586 CAGAACAAGAAAGAGGAGGCAGG - Intergenic
1005159222 6:22838835-22838857 CATACAAAGGAGGAAGAGGCAGG + Intergenic
1005589753 6:27311651-27311673 CAGAAAAGGGAAAGGGAGGTTGG - Exonic
1005950029 6:30625116-30625138 AAGACAAAGAACAAGGAGACAGG - Intronic
1006179149 6:32143559-32143581 AAGAAAAAAGAAAAAGAGGCTGG + Intergenic
1006204481 6:32328236-32328258 CACACAAAAAAAAATGAGGCCGG - Intronic
1006364515 6:33607515-33607537 CAGACAAAGGCAGAGCAGCCCGG - Intergenic
1006575030 6:35038779-35038801 CAGAAAAAGGAAAAGTGGCCAGG - Intronic
1006912963 6:37576000-37576022 CAGACAAAGAAGAAGGAGTGTGG - Intergenic
1006914747 6:37587063-37587085 CAGACAAAGGGATAGTAGGAAGG - Intergenic
1007179506 6:39919067-39919089 TAGATAAAGGAAAATGAAGCAGG + Intronic
1007209089 6:40177273-40177295 AAGACGAAGGAAGAGCAGGCAGG + Intergenic
1007352124 6:41281668-41281690 AAGACAGAGGAAAGGGAAGCAGG - Intronic
1007394263 6:41568703-41568725 CAGACAAAGGCAGAGGAGCTTGG - Intronic
1007694662 6:43724683-43724705 GAGACTAAGGAGCAGGAGGCAGG - Intergenic
1007739187 6:44000719-44000741 CAGTCAAAGGAGAAGGGGGCAGG + Intronic
1007889485 6:45272890-45272912 CAGGCAAAGCAAAAGCAGACTGG - Intronic
1007992119 6:46267522-46267544 CAAACAAACGAAAACGAGGTGGG + Intronic
1008508602 6:52255374-52255396 CAGACAGAGGAAGAGCAGGCAGG - Intergenic
1008743152 6:54634935-54634957 AGGACAAAGGAAAAAGAGGTAGG + Intergenic
1008956882 6:57225082-57225104 AAGACAAAGGAAAAAGGGGTGGG - Intergenic
1009954264 6:70433421-70433443 CAGACAAATGAAAACCAGGATGG + Intronic
1009965083 6:70569258-70569280 CAAAGAAAGAAAAAAGAGGCCGG - Intronic
1010011487 6:71052245-71052267 CTAATAAAGGAAAAGGAGCCAGG + Intergenic
1010016293 6:71108275-71108297 CAGAGGAAGGAGCAGGAGGCAGG - Intergenic
1010295037 6:74185640-74185662 AAGTAGAAGGAAAAGGAGGCAGG + Intergenic
1010899481 6:81408501-81408523 TAGACAAAGGGAAAGAAGGAGGG + Intergenic
1011203796 6:84869178-84869200 GTGACAAAGGAGAAGAAGGCAGG - Intergenic
1011675742 6:89731805-89731827 GAGAAAAAGGAAAAGGTGGGGGG - Intronic
1012231718 6:96768259-96768281 CAGAGCAAGGAAAAGCAGGGTGG + Intergenic
1012576498 6:100807352-100807374 CAGACAAGGATAAAGGATGCTGG + Intronic
1012745627 6:103083518-103083540 CAGAAAAACTTAAAGGAGGCGGG - Intergenic
1012769261 6:103408021-103408043 CAGTCTCAGGAAAAGGAGACAGG - Intergenic
1013052162 6:106546903-106546925 CAGAGGAAGCAAAAGGATGCTGG + Intronic
1013172428 6:107648745-107648767 CAGAAATAGGAAAAGGTGGATGG - Intronic
1013527757 6:110990568-110990590 CAAACAAAAGAAAAGGTGGGGGG - Intronic
1013572715 6:111445805-111445827 CAGACATAGGAAAAGGAGACTGG + Intronic
1013760420 6:113511327-113511349 CAGACAGAGGAAAAGGAGCATGG - Intergenic
1013840476 6:114386641-114386663 CAAAGAGAGGAAAAGGAGGGAGG + Intergenic
1014066026 6:117126591-117126613 CAGTGAAAGGATATGGAGGCTGG + Intergenic
1014312231 6:119818428-119818450 CAGATAAAAGAAAAGAAGGGTGG + Intergenic
1014871709 6:126604014-126604036 TAGACAGAGGAGGAGGAGGCAGG - Intergenic
1014904706 6:127012023-127012045 AAGAAAAAGGGAAATGAGGCAGG - Intergenic
1015233078 6:130938901-130938923 CAGAGGAAGAAAAAGTAGGCAGG + Intronic
1015435586 6:133182751-133182773 CAAAAGAAGGAAAAGAAGGCAGG - Intergenic
1015528568 6:134197527-134197549 CATAAAAAGCAAAAGTAGGCCGG + Intronic
1016709396 6:147152840-147152862 CAAACAAAGGAGAAGAGGGCAGG - Intergenic
1016834134 6:148460054-148460076 CAGACAGAACAAAAGGAGGCAGG + Intronic
1016888887 6:148985917-148985939 CTGTGAAGGGAAAAGGAGGCAGG + Intronic
1016891693 6:149014105-149014127 CAGAGTGAGGAGAAGGAGGCAGG + Intronic
1016958981 6:149653547-149653569 GAGAACAAGGAAAAGAAGGCTGG + Intergenic
1017466731 6:154700969-154700991 CAAGCAAGGGAAAAGGATGCTGG + Intergenic
1017804198 6:157929209-157929231 CAAACAAAGGAGAAGGAGGGAGG - Intronic
1018222347 6:161593600-161593622 CAGACAAAGGAAAAGGAGGCAGG + Intronic
1018897069 6:168027154-168027176 TAGAAAAAGGGAAAGGTGGCCGG + Intronic
1019637172 7:2082150-2082172 CAGAGAAAGGGAAGGGAGGCAGG + Intronic
1019779294 7:2930105-2930127 CAGAGAAAGGAGAAGGGGGCCGG + Intronic
1020140534 7:5609142-5609164 AAAAAAAAGGAAAAAGAGGCCGG + Intergenic
1020865799 7:13560712-13560734 CAGACAAAGGAAAAGAAGGAAGG + Intergenic
1021197294 7:17687849-17687871 TAAACAAAGGAAAAGGAGTTTGG + Intergenic
1021432417 7:20575737-20575759 AAGGCAAGGGAAAGGGAGGCAGG - Intergenic
1022205208 7:28157240-28157262 CAGACAAAGTGAGAGGAGGCTGG + Intronic
1022495015 7:30847434-30847456 GGGTCAAAGGCAAAGGAGGCTGG + Intronic
1022555855 7:31295186-31295208 CAGACCAAGAGAAAGGAGGCAGG + Intergenic
1022846073 7:34211165-34211187 CTGACCAGGGAAAAGGAGGAAGG - Intergenic
1023155582 7:37248420-37248442 CAGAGAAAGCAAAAGGAGTGAGG + Intronic
1023187543 7:37547871-37547893 AAAAAAAAGGAAGAGGAGGCAGG + Intergenic
1023222906 7:37938608-37938630 CAGTTAAAGCAAAAGCAGGCTGG - Intronic
1023569836 7:41560654-41560676 AAGACAAAGGAATAATAGGCAGG + Intergenic
1023648218 7:42341441-42341463 CAGAAAAAGGATAAGGAAGAAGG - Intergenic
1024033375 7:45484112-45484134 AGGAAAGAGGAAAAGGAGGCAGG + Intergenic
1024656264 7:51453713-51453735 CACACAGAGAAAAAGGATGCAGG - Intergenic
1024912805 7:54465308-54465330 CATACAAACAAAAAGAAGGCAGG - Intergenic
1024919304 7:54541706-54541728 AAGATGAAGGAAAAGAAGGCAGG + Intergenic
1025602346 7:63012599-63012621 CAAAAAAAAAAAAAGGAGGCTGG + Intergenic
1026206234 7:68260278-68260300 GAGACAAAAGAGAAGGAGGAAGG - Intergenic
1026742060 7:72984966-72984988 CACACAGAGAAAGAGGAGGCGGG - Intergenic
1026801905 7:73405394-73405416 CACACAGAGAAAGAGGAGGCGGG - Intergenic
1027000732 7:74652323-74652345 CAAACAAAAGAAAAAGTGGCTGG + Intergenic
1027101675 7:75380111-75380133 CACACAGAGAAAGAGGAGGCGGG + Intergenic
1027134151 7:75612212-75612234 AAAACAAAGGCAGAGGAGGCCGG + Intronic
1027512549 7:79101426-79101448 TAGAAAAAGGAAAATGGGGCCGG + Intronic
1027533533 7:79366386-79366408 AAGACAAAGGGAAAGAGGGCAGG + Intronic
1027604212 7:80280121-80280143 CAGATCAAGGAAAGGGAGGGTGG + Intergenic
1027798043 7:82718399-82718421 TAAACAAAGGAAAAGGAGTATGG - Intergenic
1027924470 7:84443819-84443841 CAGTCAAAGCAAAAGTAGACTGG - Intronic
1028519311 7:91712250-91712272 CAGACAAAAAAGAGGGAGGCTGG + Intronic
1028877425 7:95839325-95839347 AAGAAAAAGAGAAAGGAGGCTGG - Intronic
1029065430 7:97843559-97843581 AAGACAAAGGAAAAGCAGGCAGG + Intergenic
1029112255 7:98218310-98218332 CAGAAAGAGGATCAGGAGGCCGG - Intronic
1029180759 7:98700053-98700075 AAGAAAAAGAAAAAGGAGGGAGG + Intergenic
1029978131 7:104852935-104852957 CAGGCACAGGGAAAGCAGGCTGG - Intronic
1030344340 7:108415583-108415605 CATAAAAAGGAGAAGAAGGCCGG + Intronic
1030540240 7:110821614-110821636 TAGAAAAAGGAAAGGTAGGCTGG + Intronic
1030574437 7:111268323-111268345 CAGAGATAGAAAAGGGAGGCAGG + Intronic
1030722179 7:112883297-112883319 CAGACAAAAGGAAAGAAGGATGG - Intronic
1030737131 7:113062563-113062585 CAGGCAAAGCAAAAGCAGGCTGG + Intergenic
1032522733 7:132558737-132558759 CAGGCAAAGGCGAAAGAGGCGGG - Intronic
1032866890 7:135934828-135934850 CAGAGAAAGTAAAGGAAGGCAGG - Intronic
1033993864 7:147321168-147321190 CAGAGAGAAGAAAAGGAGGGAGG - Intronic
1034672082 7:152866666-152866688 GAGAAAAAGGGAAGGGAGGCCGG - Intergenic
1035070413 7:156140568-156140590 CAGAGAGAGGAGAAAGAGGCAGG + Intergenic
1035761091 8:2069399-2069421 CAGAAAAGAGAAAAGGAGGCGGG - Intronic
1036286237 8:7446453-7446475 CAGACATAGGACAAGGACGCAGG + Intronic
1036335238 8:7865075-7865097 CAGACATAGGACAAGGACGCAGG - Intronic
1036511328 8:9403089-9403111 CACAAAAAAGAAAAGCAGGCAGG + Intergenic
1036644848 8:10606612-10606634 CAGACAAATAAATAGGAGCCGGG + Exonic
1037384473 8:18323026-18323048 AAGACAAAGGAAGCTGAGGCAGG - Intergenic
1037440356 8:18909947-18909969 CAGCGAAAGGAAAAAGTGGCAGG + Intronic
1038217820 8:25578680-25578702 TAGACAAGGGAAAAGGAGAAAGG + Intergenic
1038352752 8:26794685-26794707 CATACCAAAAAAAAGGAGGCAGG + Intronic
1038364653 8:26918916-26918938 CAAAAAAAGGAAAGGCAGGCCGG + Intergenic
1039195654 8:35028504-35028526 CAGAAAGAGGAAAAGGAGCAGGG + Intergenic
1039262585 8:35787987-35788009 AAGAAAAAAGAAAAGGAGGAAGG + Intronic
1039272765 8:35900825-35900847 CAGACAGAAGAAAAGAAGGAAGG - Intergenic
1039382952 8:37102877-37102899 CAGACATAATAAAGGGAGGCTGG - Intergenic
1039566734 8:38557391-38557413 CAAGCAAAGGAAAACCAGGCTGG - Intergenic
1039802529 8:40972191-40972213 CAGCCAAAGCAAAAGCAGACCGG + Intergenic
1039862300 8:41469255-41469277 CAGAAAGAAGAAAAGGAGGGAGG - Intergenic
1039897457 8:41726129-41726151 CAGAGAAAGGAAGTGGAGGCAGG - Intronic
1040365274 8:46709008-46709030 AAGACAAAGGAAAAGCAGGCAGG - Intergenic
1040506815 8:48056561-48056583 CAAAAAAAGGAAAAGGAGACAGG + Intronic
1040783024 8:51133509-51133531 CATACTAAGTAAAAGAAGGCAGG + Intergenic
1041027630 8:53703394-53703416 CAGGCTTAGGAAAAGCAGGCAGG + Intergenic
1041311173 8:56518108-56518130 CAGAAAAAGAAAATGGAGGCCGG - Intergenic
1043829408 8:84970000-84970022 CAGAGAGAGGAAGAGAAGGCTGG + Intergenic
1044422929 8:92019400-92019422 CAGAGAAAGGAAGAGCAGGAGGG + Intronic
1044540537 8:93404163-93404185 CCTACAAGGGAATAGGAGGCAGG + Intergenic
1044543286 8:93431369-93431391 CAGGCAAGGAAAAAGGAGGCAGG + Intergenic
1044706174 8:95010866-95010888 AAGACAAAGGGGAAGGAAGCAGG + Intronic
1044968687 8:97598520-97598542 CAGACAATGAAAAAGGAAGGAGG - Intergenic
1045097757 8:98816164-98816186 CAGGAAAAGGAAAAGGATGGAGG + Intronic
1045227521 8:100264089-100264111 CAGGCAATGGAAAAGGAGTTAGG - Exonic
1045595657 8:103651716-103651738 CAGAGAAAGGAATGGGAGGTGGG - Intronic
1045701292 8:104869873-104869895 CAGAGAAAGGAGCAGGAGCCAGG + Intronic
1045895487 8:107211027-107211049 CAGTCAAAGCAAAAGCAGACTGG + Intergenic
1046157098 8:110306214-110306236 GAGACAAAGGAAAAGGAAGAAGG - Intergenic
1046438337 8:114225401-114225423 CAGAGAAAGGAAAGGGAGGAAGG - Intergenic
1047384878 8:124399657-124399679 GAGACACAGAAAAGGGAGGCTGG + Intergenic
1047421046 8:124708509-124708531 CAGACCAAGGCAAAGGCAGCTGG + Intronic
1048306964 8:133291104-133291126 CAGATAAAGGGAGAGCAGGCGGG + Intronic
1048315669 8:133360018-133360040 CAGACAGAGGCAAAGCTGGCAGG - Intergenic
1049008049 8:139869259-139869281 CAGCCAAACAAAAAGAAGGCAGG + Intronic
1049377789 8:142297202-142297224 AGGACAAAGGAAAGGGATGCTGG + Intronic
1049433139 8:142574471-142574493 CAGAGAAAGGCAGCGGAGGCCGG - Intergenic
1049990180 9:982801-982823 AAGAGAAAGAAAGAGGAGGCGGG - Intronic
1050252332 9:3758001-3758023 TAGACAAAGGAAAAGGGGGTTGG - Intergenic
1050747374 9:8892036-8892058 CAGAGAAAAGAAAAGCAGGAAGG - Intronic
1051171030 9:14317505-14317527 CAGAAAAAGGAAAATGAGATAGG + Intronic
1051382475 9:16472194-16472216 AACACAAAGGGAAAGGAGTCTGG + Intronic
1051474493 9:17490093-17490115 TAGAAATAGGAAAAGTAGGCTGG + Intronic
1052036826 9:23692144-23692166 CAGAAAAAGGAAAAAAAGGGGGG + Exonic
1052560166 9:30075328-30075350 CAGAAAAAGGAAAAGGGGAGGGG - Intergenic
1052733633 9:32318309-32318331 CAGACAAAGGCAAAGCCTGCAGG + Intergenic
1052982915 9:34461893-34461915 CAGAAAAAGATAAAGGAGGATGG + Intronic
1053299344 9:36937569-36937591 CAAACACAGGAAGAGGAGCCTGG - Intronic
1053399397 9:37804478-37804500 AAGACAGAGGAAAAAGGGGCCGG + Intronic
1053420026 9:37971474-37971496 CAGACATGGGAAGAGAAGGCTGG + Intronic
1053467125 9:38316701-38316723 CTGTCAGAGGATAAGGAGGCAGG + Intergenic
1055187835 9:73476148-73476170 CTGACAAAAAAAAAGGAGGCTGG - Intergenic
1055977656 9:81970381-81970403 CAGACAAAGGAAAGTTAAGCTGG - Intergenic
1056645642 9:88409289-88409311 AAGAAAAAAGAAAAGCAGGCCGG - Intronic
1056911189 9:90702385-90702407 CAGACACAAAGAAAGGAGGCTGG - Intergenic
1056959995 9:91114756-91114778 TAGAGAGAAGAAAAGGAGGCTGG - Intergenic
1056962508 9:91138640-91138662 AAGAGAAAGGAAGGGGAGGCAGG - Intergenic
1057904636 9:98974494-98974516 CTGACAAAGGGCAAGGAGGAGGG + Intronic
1057997293 9:99829563-99829585 CAGAGAAGGGAGATGGAGGCAGG + Intronic
1058241953 9:102574373-102574395 CTAACAAAGGAAAACTAGGCAGG + Intergenic
1058931286 9:109721702-109721724 CAGACAATGGAGAAAGAAGCGGG - Intronic
1059142142 9:111863836-111863858 CAGAAATAGGAAGAGAAGGCAGG - Intergenic
1059588319 9:115630103-115630125 AAGCCTAAGGAAAAGGAGGGAGG + Intergenic
1060171077 9:121461560-121461582 AAGAGAAGGGAAAAGGGGGCTGG + Intergenic
1060677107 9:125525375-125525397 TAGAAAAAGTAACAGGAGGCCGG + Intronic
1060698620 9:125731396-125731418 GAGAGAGAGGAAAAGGAAGCAGG - Intergenic
1060716118 9:125930796-125930818 CAGACAAGGGATATGGAGGATGG - Intronic
1060724214 9:125996609-125996631 CAAAAAAAGTAAAAAGAGGCTGG - Intergenic
1061166626 9:128926534-128926556 AAGAAAAAGAAAAAGGAAGCTGG - Intronic
1061360456 9:130138550-130138572 CAGAGAAGGGAAGAGGAGGGAGG - Exonic
1061507196 9:131038101-131038123 CAGGCAGAGGAAGAGGGGGCGGG - Intronic
1061612803 9:131759542-131759564 CAGACAAGGAAAAAGAAGGGAGG + Intergenic
1061621353 9:131813220-131813242 CTGACAAAGGATGAGGTGGCAGG + Intergenic
1061728931 9:132598194-132598216 GGAACAAAGGAAAAGGAGACAGG - Intronic
1062338871 9:136084703-136084725 CAGTCAAAGGAAATGGCGGCGGG + Intronic
1062377897 9:136272178-136272200 CAGCAGAAGGAAAAGGATGCGGG + Intergenic
1062401579 9:136375123-136375145 GAGACAAAGGAAAGGGAGCTAGG + Intergenic
1062483857 9:136764626-136764648 CAAACAATGGACAAGGGGGCCGG - Intronic
1185509070 X:649332-649354 CAGAAAAAGAGAGAGGAGGCCGG - Intronic
1185611093 X:1394136-1394158 AAGAAAAAAGAAAAGGAGGCGGG - Intergenic
1185611105 X:1394206-1394228 AAGAAAAAGGAAAAGGAGGGAGG - Intergenic
1186628697 X:11324295-11324317 CAGTCAAAGTAAAAGCAGACTGG + Intronic
1187072872 X:15905660-15905682 CAGATAAAGGAGAAAAAGGCTGG - Intergenic
1187088400 X:16066572-16066594 CTGACACAGGATAAGGAGGAAGG - Intergenic
1187245332 X:17548804-17548826 CAGAGAGAGGAAAAGGAAGAGGG + Intronic
1187447672 X:19373147-19373169 GAGAGGAAGGAAAAGGAGGAAGG + Intronic
1187666208 X:21612976-21612998 CAGTCAAAGGAAAACAAGACAGG - Intronic
1187824210 X:23318445-23318467 CAGAGAAGGGAGAAGGAGGTTGG - Intergenic
1188266040 X:28076009-28076031 CAGTGAAAGCAAAAGGAGACAGG + Intergenic
1188292409 X:28405747-28405769 CAGACAAAGAAAAAGGATTTAGG + Intergenic
1188559173 X:31448273-31448295 GATAAAAAGGAAAAGGAGGCAGG + Intronic
1188697084 X:33207107-33207129 CAGACAAATGAGAATGAGGAAGG - Intronic
1189450277 X:41122703-41122725 CAGACACAGGAAAAGAACTCGGG - Intronic
1189649260 X:43171686-43171708 CACACAAAGGAAGAGGTGGGTGG - Intergenic
1189986103 X:46554653-46554675 TAGAAAATGGAAAAGGAGTCTGG + Intergenic
1190572640 X:51799806-51799828 TAGTCAAAGGAAAAGTAGACTGG - Intergenic
1190881320 X:54494876-54494898 CAGACAGAGGAGAAGGGGGTTGG + Intronic
1191650884 X:63536854-63536876 GAGACCAAGGAAAAGCAGGGTGG + Intergenic
1191857166 X:65636438-65636460 TAGAGAAATGAAAAGCAGGCTGG + Intronic
1192436443 X:71146103-71146125 AAGAAAAAGGAAGAGGAGGGAGG - Intronic
1193369445 X:80676942-80676964 GAGGCAGAGGAAGAGGAGGCAGG - Exonic
1194692157 X:97000202-97000224 CAAACAAAAGAAAAAGACGCAGG + Intronic
1194996418 X:100596025-100596047 AAGATTAAGGCAAAGGAGGCGGG + Intronic
1195097412 X:101516590-101516612 CTAATAAAGGAAAAGGAGTCAGG + Intronic
1195133867 X:101883677-101883699 CAGACAAAGGAAAAGAGAGGAGG - Exonic
1195591625 X:106634807-106634829 CAAACAAACAAAAAGGAAGCTGG - Intronic
1195619427 X:106938181-106938203 GAGACAAAGTATAAGTAGGCAGG + Intronic
1195681459 X:107550015-107550037 CAGGGAAAGGACAAGGAGACCGG - Intronic
1196177969 X:112661036-112661058 CAGACCAAGGCAAAAGAGGTTGG - Intronic
1196206128 X:112942081-112942103 AACAAAAAGGAAAAGGAGGAAGG - Intergenic
1197323664 X:125065158-125065180 CAGTCAAAGCAAAAGCAGACAGG + Intergenic
1197875169 X:131095269-131095291 CAAAGAATGGAACAGGAGGCAGG - Intergenic
1197967111 X:132076895-132076917 CAGAACATGGAAAAGGAGGGAGG - Intergenic
1197990652 X:132313244-132313266 CAGACACATGAAAGTGAGGCTGG + Intergenic
1198161995 X:134017224-134017246 GAGAGAAAAGAAAAAGAGGCTGG - Intergenic
1199201508 X:145095217-145095239 CAGACTTAGGAAGAGGAAGCAGG - Intergenic
1199887678 X:152037586-152037608 CAAACAAGGTAAAAGGAGCCAGG - Intergenic