ID: 1018222909

View in Genome Browser
Species Human (GRCh38)
Location 6:161599205-161599227
Sequence CAATCTGCCACAAGCTTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 123}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018222909_1018222917 20 Left 1018222909 6:161599205-161599227 CCATCCAAGCTTGTGGCAGATTG 0: 1
1: 0
2: 1
3: 5
4: 123
Right 1018222917 6:161599248-161599270 ACTAATACAATGGGTGACAATGG No data
1018222909_1018222913 10 Left 1018222909 6:161599205-161599227 CCATCCAAGCTTGTGGCAGATTG 0: 1
1: 0
2: 1
3: 5
4: 123
Right 1018222913 6:161599238-161599260 GCCCTAGGAAACTAATACAATGG 0: 4
1: 37
2: 82
3: 249
4: 481
1018222909_1018222915 11 Left 1018222909 6:161599205-161599227 CCATCCAAGCTTGTGGCAGATTG 0: 1
1: 0
2: 1
3: 5
4: 123
Right 1018222915 6:161599239-161599261 CCCTAGGAAACTAATACAATGGG 0: 3
1: 17
2: 80
3: 241
4: 595
1018222909_1018222912 -5 Left 1018222909 6:161599205-161599227 CCATCCAAGCTTGTGGCAGATTG 0: 1
1: 0
2: 1
3: 5
4: 123
Right 1018222912 6:161599223-161599245 GATTGTTTTTTGGCAGCCCTAGG 0: 1
1: 0
2: 1
3: 24
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018222909 Original CRISPR CAATCTGCCACAAGCTTGGA TGG (reversed) Intronic
900230683 1:1555527-1555549 GAGTGTGCCACAAGCGTGGACGG + Intronic
902642638 1:17776503-17776525 CAGTCTCCCAGGAGCTTGGACGG + Intronic
902708727 1:18224259-18224281 CACTCTGGCCCAAACTTGGAGGG + Intronic
903257768 1:22114288-22114310 CAAGGTGGCACAAGCTTGCATGG + Intergenic
903648897 1:24911233-24911255 TAGTCAGCCACAAGCTTGAAGGG + Intronic
906532550 1:46532068-46532090 CACTCAGCCACAGGCTGGGAGGG + Intergenic
908889627 1:68829917-68829939 CTATCTGCTACCAGGTTGGAGGG - Intergenic
915537394 1:156545261-156545283 TAATCCCACACAAGCTTGGAGGG - Intronic
916104288 1:161419674-161419696 CCATCTGCCACAGTCTTGCATGG - Intergenic
916538222 1:165725244-165725266 CATTTTGCCACAAACTAGGATGG - Exonic
917417884 1:174830239-174830261 CAATCTGCCACATTCATGCATGG + Intronic
920048522 1:203149297-203149319 CGCTCTGCCACAACCCTGGATGG - Intronic
921387680 1:214587339-214587361 CAAACTGCCAGAAGCTAGGAAGG - Intergenic
923317891 1:232799324-232799346 CAATGTGCCAGAAACTAGGATGG + Intergenic
1063553121 10:7052066-7052088 CAATCTGCTACCAGCATGGCTGG - Intergenic
1066305209 10:34133514-34133536 CATTCTGCTAGCAGCTTGGAGGG - Intronic
1066466083 10:35651620-35651642 CATTCTACCAAAAGCTTGTAGGG - Intergenic
1072278694 10:93846610-93846632 CAGCCTCCCAGAAGCTTGGATGG - Intergenic
1073207812 10:101777899-101777921 GTATCTGCCACAGGCTTGGCAGG + Intronic
1076107005 10:127831664-127831686 CAACCTGCCAAATGCTTGGAAGG + Intergenic
1079079825 11:17406512-17406534 CAACCTGTCACAAGCTTGTGGGG - Intronic
1079084917 11:17438404-17438426 CAATCTCCCACAAGACTGGGAGG + Intronic
1080795646 11:35560457-35560479 AAATCTGCCACCAGCTTGGTAGG - Intergenic
1082847787 11:57740495-57740517 CACACTGACCCAAGCTTGGAGGG - Exonic
1084420974 11:69060428-69060450 CACTCGGCCACAAGGCTGGAGGG - Intronic
1088510187 11:110565834-110565856 CAACCTGCCACACACTTGGCAGG + Intergenic
1099529455 12:83759355-83759377 CAATCTGACACAGGCTTCGTGGG - Intergenic
1101326384 12:103719396-103719418 CAAACTGCCACAAACTGGGTGGG + Intronic
1107874682 13:44779806-44779828 GAAACTGCCACCATCTTGGATGG - Intergenic
1109734903 13:66469923-66469945 CACTCTGCCATTAGCTTTGAAGG - Intronic
1111156153 13:84329001-84329023 CAAGCAGCCAGAGGCTTGGAGGG - Intergenic
1112151690 13:96771653-96771675 AAAGCTGCCAAAATCTTGGAAGG - Intronic
1112724186 13:102283021-102283043 CAATCAGCCCAAAGCTTGTATGG + Intronic
1116810378 14:49534211-49534233 CAATCAGCAACAGGCTTGCAGGG + Intergenic
1124219663 15:27838631-27838653 CATTTTGCTACAGGCTTGGAGGG - Intronic
1136144766 16:28310070-28310092 GGCTCTGCCACAAGCTGGGAGGG - Intronic
1137332122 16:47508369-47508391 CAATCTGCAATTAGTTTGGAGGG + Intronic
1140714480 16:77709668-77709690 CAATCTGCAACAATCCTGTAAGG + Intergenic
1147212552 17:38880354-38880376 GAAGCTGCCACAAGGTTGGGTGG + Intronic
1147787597 17:42990966-42990988 CCCTCTGCCACAGGGTTGGAGGG - Exonic
1148943457 17:51236604-51236626 AACTGTGCCACATGCTTGGAGGG - Intronic
1152062756 17:78090737-78090759 CCATCTGCCCCCAGCTGGGATGG - Intronic
1152128580 17:78462215-78462237 CACTCTCCCACCAGCCTGGAGGG - Intronic
1153001479 18:459323-459345 CAATCTGCCATAAGTCTGGAAGG + Intronic
1156592274 18:38504200-38504222 CAATCTGCCAGAAGCTTGCAGGG + Intergenic
1157132496 18:45020048-45020070 CAACCTGCCACAACCCTGGGAGG - Intronic
1160017363 18:75154964-75154986 CAAATTTCCACAAGCTCGGAGGG - Intergenic
1160256548 18:77252073-77252095 CTATCTCCCACACGCGTGGACGG - Intronic
1164461907 19:28456206-28456228 CCATCTGCCCCAAGCCTGGGTGG + Intergenic
1166064985 19:40352449-40352471 CAAGCTGCCTCAAGCTTCCAGGG - Intronic
1168385333 19:55958550-55958572 CAATATGTCACAAGCATGGCCGG - Intronic
929147691 2:38721084-38721106 CAATCTGCCACAAGCAGTCATGG + Intronic
931872000 2:66471088-66471110 CAATTTGTCACAAGCTCTGAAGG + Intronic
933767929 2:85723356-85723378 CAATATTCCACATTCTTGGAGGG + Intergenic
934708855 2:96502616-96502638 CAACCAGCCACAATCTAGGAGGG + Intronic
935040415 2:99420798-99420820 CAGTATACCACAGGCTTGGAAGG - Intronic
938579729 2:132635138-132635160 CACTAGGCCCCAAGCTTGGAGGG + Intronic
943436717 2:187873274-187873296 GAATCTGCCAAAAGAATGGAAGG + Intergenic
945837029 2:214845861-214845883 CACTCTGTCACCAGATTGGAGGG - Intergenic
946656166 2:221950389-221950411 CACTCTGCCACTTGCTAGGAAGG - Intergenic
947825985 2:233106366-233106388 CAATCTGCCATAAGAAAGGATGG - Intronic
948041247 2:234903361-234903383 CAATCCACCAGAAGCTGGGAGGG + Intergenic
1171241249 20:23568725-23568747 CCCTCTGCCACTAGCTTTGAAGG + Exonic
1173440246 20:43069098-43069120 CCCTCAGCCCCAAGCTTGGAAGG + Intronic
1174092153 20:48058196-48058218 CACTTTCCCACAATCTTGGAAGG - Intergenic
1175212922 20:57372809-57372831 CAACCTGGCCAAAGCTTGGAGGG - Intronic
1175387336 20:58605660-58605682 CAGGCTGCCACAAGGCTGGATGG + Intergenic
1182521220 22:30885498-30885520 CAGTAGGCCACAAGCTTGAAGGG + Intronic
1183768218 22:39899210-39899232 CAATCTGTCCCATGCTTGTAAGG + Intergenic
1184047223 22:41978963-41978985 CACTGTGCCACAAGCTTTGCTGG - Intronic
1184420898 22:44382347-44382369 ATATCTGTCACACGCTTGGAGGG + Intergenic
949732431 3:7129361-7129383 TTATCTGCCACAATCATGGACGG - Intronic
951432893 3:22628531-22628553 CCAGCTGCCAAATGCTTGGAAGG + Intergenic
952890548 3:38037390-38037412 CAATTTTCCACAAGCATGCAAGG - Intergenic
953343055 3:42151726-42151748 TAATCTGCCTGAAGCTAGGAAGG - Intronic
953677267 3:45012796-45012818 CAAGCAGCTACCAGCTTGGATGG + Intronic
954397598 3:50301111-50301133 CAGTCTGCCACATGGTGGGAAGG - Intronic
956400438 3:68873870-68873892 AAATCTCCCACACCCTTGGATGG + Intronic
956864449 3:73355659-73355681 CAATGTGCCACAAACTTGAGTGG - Intergenic
961554516 3:127688866-127688888 AAATCTGCTCCAAGCGTGGATGG + Intergenic
964476490 3:157102299-157102321 CAAACTGCTAGAAGCTGGGAGGG + Intergenic
968214755 3:196879545-196879567 CAATGTGCCTTAAGCCTGGAGGG - Intronic
971184424 4:24359905-24359927 CAAGTTGCCACAAACTTGAATGG - Intergenic
974821375 4:67070695-67070717 CCAACTACCAGAAGCTTGGAGGG + Intergenic
982379727 4:154736742-154736764 CACTCTGCCACCAGGCTGGAGGG - Intronic
996145995 5:119977092-119977114 CAATCTGCCTCTAGCATGCAAGG - Intergenic
1005144160 6:22668426-22668448 GAATCTGCCAGCACCTTGGAAGG + Intergenic
1009512971 6:64576050-64576072 TAATATGACAGAAGCTTGGAAGG - Intronic
1012578952 6:100840359-100840381 CACTCTGTCACCAGCCTGGAGGG + Intronic
1014330103 6:120053842-120053864 CAATCTGCAACAACCTTCCAAGG + Intergenic
1014837058 6:126171619-126171641 CAATTTGTCACAAGAGTGGAGGG + Intergenic
1016072203 6:139752405-139752427 CAATCTGCCACAAAATATGACGG + Intergenic
1016700882 6:147052888-147052910 CCATCTGCCCCAAGCCAGGAAGG - Intergenic
1018222909 6:161599205-161599227 CAATCTGCCACAAGCTTGGATGG - Intronic
1019267358 7:125304-125326 CACTCTGCCAGGAGCCTGGAGGG - Intergenic
1021905463 7:25328795-25328817 CAAACTACCAGAAGCTAGGAGGG + Intergenic
1022722065 7:32950319-32950341 CACTCTGCCACCAGGCTGGATGG - Intergenic
1023224013 7:37950336-37950358 CCATCTGGCACGTGCTTGGAGGG - Exonic
1023274012 7:38498529-38498551 AAACCTGCCACAAGGTTGTAGGG + Intronic
1023840644 7:44095808-44095830 CAAGGTCCCACCAGCTTGGAGGG + Intergenic
1025742990 7:64215796-64215818 TAATCTGCCACAAGGTTGCCAGG - Intronic
1026038434 7:66846169-66846191 CAATGTGCCACCAGGTTGGCAGG - Intergenic
1029012183 7:97273559-97273581 CAATCCCACACAAGCTTGCAAGG - Intergenic
1029584217 7:101459855-101459877 CAATCAGCTCCACGCTTGGATGG - Intronic
1031088898 7:117329134-117329156 TAATCTGCTACAAGTTTGTAGGG - Intergenic
1032383662 7:131507020-131507042 CAATCCGCAAACAGCTTGGAGGG - Intronic
1034496098 7:151423545-151423567 CAAACCGCCAGAAGCTGGGAGGG - Intergenic
1038315209 8:26478700-26478722 CAATGTGCCACAATCTGGCAAGG - Intronic
1038353640 8:26806069-26806091 AAAGCTGCCACATGCCTGGAAGG - Intronic
1038353728 8:26806723-26806745 AAAGCTGCCACATGCCTGGAAGG + Intronic
1041045445 8:53882260-53882282 CACTCCCCCACAAGCGTGGAGGG - Intronic
1043478558 8:80629173-80629195 CAATGTGCCAGAAGCTGGCAAGG + Exonic
1044244045 8:89920183-89920205 CAAGCTGCCACCTGCTTTGAGGG - Intronic
1050185052 9:2964482-2964504 CAATCTTCCAGTAGCTGGGAGGG + Intergenic
1053407092 9:37886640-37886662 CACACTGACCCAAGCTTGGAGGG - Intronic
1057194050 9:93106823-93106845 CAAGCTGCCACAAGTATGTAGGG + Intronic
1057704920 9:97389418-97389440 CCATCTGCCAACAGCCTGGAGGG + Intergenic
1059354077 9:113686391-113686413 CACTCTGCCCCCAGCTAGGAGGG + Intergenic
1060170673 9:121458591-121458613 CATTCTGCCACCAGGCTGGAGGG - Intergenic
1060958428 9:127661506-127661528 CAATCAGAAACGAGCTTGGAAGG + Intronic
1187960044 X:24559672-24559694 AAATATGCCCCAAGCTTGGAGGG - Intronic
1188222321 X:27556121-27556143 CAATGAGCGACAAACTTGGAAGG - Intergenic
1189708718 X:43786471-43786493 CAATCTGCCACTGGCTTGAGGGG + Intronic
1192684330 X:73288038-73288060 CTTTTTGCCACAAACTTGGAAGG + Intergenic
1193049682 X:77086768-77086790 CATTCTGCCATAAGTTTGAATGG - Intergenic
1193600669 X:83505775-83505797 CCATTTGCCAGAGGCTTGGAGGG - Intergenic
1194132592 X:90100109-90100131 CATTTTGCCAACAGCTTGGAAGG + Intergenic
1196919525 X:120571476-120571498 CATTCTTCCACCAGGTTGGAGGG - Intronic
1199453427 X:147999033-147999055 CTATATGCCAGAAACTTGGAGGG + Intronic
1200478382 Y:3670188-3670210 CATTTTGCCAATAGCTTGGAAGG + Intergenic