ID: 1018225235

View in Genome Browser
Species Human (GRCh38)
Location 6:161622108-161622130
Sequence GGGTCCTCATGGTGAGTGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018225232_1018225235 -4 Left 1018225232 6:161622089-161622111 CCTTTCCAAGGTGGTGACTGGGT 0: 1
1: 0
2: 1
3: 21
4: 189
Right 1018225235 6:161622108-161622130 GGGTCCTCATGGTGAGTGAGAGG No data
1018225220_1018225235 22 Left 1018225220 6:161622063-161622085 CCCCCCGTCTCCAACTCCTCGCA 0: 1
1: 0
2: 0
3: 8
4: 191
Right 1018225235 6:161622108-161622130 GGGTCCTCATGGTGAGTGAGAGG No data
1018225222_1018225235 20 Left 1018225222 6:161622065-161622087 CCCCGTCTCCAACTCCTCGCACC 0: 1
1: 0
2: 2
3: 20
4: 229
Right 1018225235 6:161622108-161622130 GGGTCCTCATGGTGAGTGAGAGG No data
1018225233_1018225235 -9 Left 1018225233 6:161622094-161622116 CCAAGGTGGTGACTGGGTCCTCA No data
Right 1018225235 6:161622108-161622130 GGGTCCTCATGGTGAGTGAGAGG No data
1018225224_1018225235 18 Left 1018225224 6:161622067-161622089 CCGTCTCCAACTCCTCGCACCTC No data
Right 1018225235 6:161622108-161622130 GGGTCCTCATGGTGAGTGAGAGG No data
1018225223_1018225235 19 Left 1018225223 6:161622066-161622088 CCCGTCTCCAACTCCTCGCACCT 0: 1
1: 0
2: 2
3: 20
4: 250
Right 1018225235 6:161622108-161622130 GGGTCCTCATGGTGAGTGAGAGG No data
1018225229_1018225235 -1 Left 1018225229 6:161622086-161622108 CCTCCTTTCCAAGGTGGTGACTG 0: 1
1: 0
2: 1
3: 48
4: 475
Right 1018225235 6:161622108-161622130 GGGTCCTCATGGTGAGTGAGAGG No data
1018225225_1018225235 12 Left 1018225225 6:161622073-161622095 CCAACTCCTCGCACCTCCTTTCC No data
Right 1018225235 6:161622108-161622130 GGGTCCTCATGGTGAGTGAGAGG No data
1018225221_1018225235 21 Left 1018225221 6:161622064-161622086 CCCCCGTCTCCAACTCCTCGCAC 0: 1
1: 0
2: 0
3: 14
4: 205
Right 1018225235 6:161622108-161622130 GGGTCCTCATGGTGAGTGAGAGG No data
1018225227_1018225235 6 Left 1018225227 6:161622079-161622101 CCTCGCACCTCCTTTCCAAGGTG 0: 1
1: 0
2: 0
3: 22
4: 214
Right 1018225235 6:161622108-161622130 GGGTCCTCATGGTGAGTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018225235 Original CRISPR GGGTCCTCATGGTGAGTGAG AGG Intronic