ID: 1018226188

View in Genome Browser
Species Human (GRCh38)
Location 6:161631004-161631026
Sequence AAAGCGTGGCCCCACCCTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 84}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018226188_1018226192 7 Left 1018226188 6:161631004-161631026 CCAGAAGGGTGGGGCCACGCTTT 0: 1
1: 0
2: 0
3: 6
4: 84
Right 1018226192 6:161631034-161631056 GGCTGCTCCTGCTACCCTCTTGG 0: 1
1: 0
2: 3
3: 24
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018226188 Original CRISPR AAAGCGTGGCCCCACCCTTC TGG (reversed) Intronic
900160005 1:1219034-1219056 AGACCGGGGCCCCACCCTCCAGG + Intronic
900174904 1:1287343-1287365 AGAGCGTGGCCGCACCCCTGGGG + Intronic
900957020 1:5892427-5892449 CAAGCAGGGCCCCACCCTTAAGG - Intronic
902533994 1:17108442-17108464 AAAACGTGGCCCCAGCCCTAGGG - Intronic
903071244 1:20727939-20727961 ACAGGGTGGCCCCACCCACCTGG + Exonic
916207011 1:162324955-162324977 ACAGTGTGGCCCCACACTTCAGG + Intronic
921096682 1:211892716-211892738 AAAGCGTGGCCCGACACTGTTGG + Intergenic
922741338 1:228015889-228015911 CAAGCGTGGCCCCAGCCAGCAGG - Intronic
1070801685 10:79247626-79247648 AAGGCCTGGCCTCACCCTACGGG - Intronic
1073670252 10:105579865-105579887 GCAGCCTGGCCCCAGCCTTCAGG + Intergenic
1075223896 10:120608255-120608277 AAACCGTGACCCCTCCCTTCAGG + Intergenic
1077572751 11:3353892-3353914 AAAGCCAGGCCCCTACCTTCAGG - Intronic
1079401525 11:20110081-20110103 AAAGTGAGGCCCCAGCCATCTGG + Intronic
1080684306 11:34502684-34502706 AAAGCCTGGCTCCATCCCTCAGG + Intronic
1081546483 11:44075534-44075556 AGAGCGAGGCACCACCATTCAGG - Exonic
1089419288 11:118319199-118319221 AAAGTGTGGCCCAACCACTCAGG - Intergenic
1089626173 11:119752354-119752376 AAAGCATGCTCCCACACTTCTGG - Intergenic
1098234084 12:68401816-68401838 AAGACTTGGCTCCACCCTTCCGG - Intergenic
1103177527 12:118877610-118877632 TAATCCTGGCCCCTCCCTTCTGG + Intergenic
1107784327 13:43939417-43939439 ACAGGGTGGACACACCCTTCTGG + Intergenic
1115347825 14:32362148-32362170 AGTGAGTGGCCCCAGCCTTCAGG + Intronic
1121111777 14:91317694-91317716 AAACAGCGGCCCCTCCCTTCCGG + Intronic
1132573167 16:652852-652874 ACAGCCTGGCCCCACACTGCTGG - Intronic
1132894932 16:2224159-2224181 AAACCGAGGCCCCACCCTCTTGG - Intronic
1137887765 16:52125225-52125247 AAAGCCTTTCCCCACACTTCTGG + Intergenic
1144771228 17:17760676-17760698 AAATGGTGGCACCACCCTGCAGG + Intronic
1148680829 17:49472631-49472653 AAGGCGTGGCCACCCCCTCCTGG - Intronic
1151571604 17:74928852-74928874 AAAGCATGGCCCCTGCCCTCAGG + Intronic
1155122689 18:22839031-22839053 AAAGCGAAGCCACACCCTTAAGG + Intronic
1158959082 18:62573324-62573346 ATAGCGTGGACCTAGCCTTCAGG - Intronic
1161308285 19:3578957-3578979 AAAGCCGGCCCCCACCCATCTGG - Exonic
1162668801 19:12237600-12237622 GGAGCTTGGCCCCACCCTCCTGG + Intronic
1167863711 19:52306903-52306925 AAAGAGTGGCCTCACCCTCCAGG - Intronic
925336552 2:3102823-3102845 CACACGAGGCCCCACCCTTCAGG + Intergenic
932219654 2:69989826-69989848 AAGGCGGGGACCCACCCTACTGG + Intergenic
948319996 2:237061474-237061496 AAAGCGCTGCCCCACCCACCAGG + Intergenic
1169700681 20:8443383-8443405 AAAGCAGGGCCTCACCCTACAGG - Intronic
1171231900 20:23493559-23493581 AGAGGGTGGCCCCACCCTCCTGG + Intronic
1173674210 20:44820055-44820077 AAAGCGTGCTCCCACCCTGAGGG - Intergenic
1175918462 20:62438573-62438595 AGGGCCCGGCCCCACCCTTCTGG + Intergenic
1180949679 22:19715396-19715418 AAGGGTTGGCCCCACCCTCCAGG + Intronic
1182532330 22:30969702-30969724 GAGGCCTGGCGCCACCCTTCGGG + Intergenic
1184004379 22:41697696-41697718 AAAGCTGGGCCTGACCCTTCTGG + Exonic
1184869051 22:47221984-47222006 GACGCGTGGACCCAGCCTTCTGG + Intergenic
955515950 3:59726524-59726546 AATGCCTGGCCCCTGCCTTCAGG - Intergenic
961525811 3:127496663-127496685 ACAGCCTGGCCCCACACTTCAGG - Intergenic
961637984 3:128345282-128345304 AAAGAGTGGACCCACGCTCCAGG - Intronic
961716884 3:128863973-128863995 AAAGAGAGGGCACACCCTTCAGG - Intergenic
963483353 3:145904305-145904327 GCAGCCTGGCCCCAGCCTTCAGG - Intergenic
968731322 4:2270659-2270681 GCAGCGTGGCCCCACCTTCCTGG + Exonic
972358299 4:38303324-38303346 GCAGCTTGGCCCCAGCCTTCAGG + Intergenic
974455750 4:62127777-62127799 AAAGCATTGCCCCACTCTACTGG - Intergenic
975839388 4:78457466-78457488 AGAGCATTTCCCCACCCTTCTGG + Intronic
978964565 4:114725559-114725581 GCAGCCTGCCCCCACCCTTCAGG + Intergenic
980470324 4:133241048-133241070 AATGTGTGTCCCTACCCTTCAGG - Intergenic
982122526 4:152156727-152156749 AAAGCATTGCCCCGCCCCTCAGG + Intergenic
985574056 5:665581-665603 ACAGCCAGGCCCCACCCTCCAGG + Intronic
985750225 5:1669410-1669432 AAACCCTGTCCCCACCCTGCTGG - Intergenic
987136532 5:14904684-14904706 AAGGCTTGGCCTCACCCATCTGG - Intergenic
991625023 5:68592333-68592355 AAGCCGCGGCCACACCCTTCCGG - Intergenic
993187065 5:84635197-84635219 TCAGCCTGGCCCCAACCTTCAGG + Intergenic
994437353 5:99755137-99755159 AAATGCTGGCCCCATCCTTCAGG + Intergenic
998434961 5:142100296-142100318 AGAGCCTGTCCCCACCCTTGTGG - Intergenic
999563475 5:152830883-152830905 AAAACATAGCCCCACTCTTCTGG + Intergenic
999968106 5:156831617-156831639 AAAGCCTTTCCCCACCCTTTTGG - Intergenic
1005839973 6:29737908-29737930 AAAGCCTGGCCCCACTCTGGAGG + Intronic
1006793158 6:36716643-36716665 AACACCTGGCCCCACCCTCCGGG - Intronic
1018226188 6:161631004-161631026 AAAGCGTGGCCCCACCCTTCTGG - Intronic
1020835064 7:13138965-13138987 ACATCGTGGCCCAAGCCTTCAGG + Intergenic
1022472014 7:30687846-30687868 AAATGGAGGCCCCTCCCTTCAGG - Intronic
1023802398 7:43846286-43846308 AAAGCATGGCCCCAGCCCCCAGG - Intergenic
1024202700 7:47122632-47122654 GAAGCCTGGCCACAGCCTTCTGG + Intergenic
1027779860 7:82507753-82507775 ACAGCATGGCCCCAGTCTTCAGG + Intergenic
1030094564 7:105886541-105886563 AAAGCATGGCTCCCCCCTACTGG + Intronic
1034294370 7:149958977-149958999 CAAGGGTGGCCCCATACTTCTGG + Intergenic
1034364908 7:150537864-150537886 TAACCGTGGCCCCTGCCTTCAGG + Intergenic
1034811699 7:154137895-154137917 CAAGGGTGGCCCCATACTTCTGG - Intronic
1036085636 8:5610158-5610180 AAAGCCTGGCCACACCGTTCAGG - Intergenic
1042217186 8:66438488-66438510 AACGCGTGGCCACACCTTTTTGG - Intronic
1044814084 8:96092822-96092844 CAAGCGTGGCACCACCATGCTGG + Intergenic
1048285514 8:133138141-133138163 AATGCCTGGCCCCATCCTCCAGG - Intergenic
1059773124 9:117446637-117446659 AAAGCATGCCCACACCCGTCTGG - Intergenic
1060146950 9:121261188-121261210 AAAGCCCAGCCCCACTCTTCTGG - Intronic
1186591024 X:10930250-10930272 AAAGAGTGTCCCTACCCTACAGG + Intergenic
1194980535 X:100435712-100435734 GAAGTGTGACCCCACCCTGCTGG + Intergenic
1195498565 X:105566874-105566896 TAATCCTGGCCCCTCCCTTCTGG - Intronic
1199980018 X:152915779-152915801 GAAGCGTGGGCACACCCTGCTGG + Intronic
1200251619 X:154557181-154557203 AACGCGTGGCCTCCCGCTTCTGG + Intronic
1200253826 X:154568865-154568887 AACGCGTGGCCTCCCGCTTCTGG + Intergenic
1200263943 X:154635543-154635565 AACGCGTGGCCTCCCGCTTCTGG - Intergenic
1200266148 X:154647235-154647257 AACGCGTGGCCTCCCGCTTCTGG - Intergenic