ID: 1018226478

View in Genome Browser
Species Human (GRCh38)
Location 6:161634256-161634278
Sequence CATCTGCGGGGACGCTCACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 56}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018226478_1018226496 29 Left 1018226478 6:161634256-161634278 CCTGGTGAGCGTCCCCGCAGATG 0: 1
1: 0
2: 0
3: 7
4: 56
Right 1018226496 6:161634308-161634330 GGCAGCGGGAGGGCCTTCTCAGG 0: 1
1: 0
2: 0
3: 27
4: 210
1018226478_1018226484 -4 Left 1018226478 6:161634256-161634278 CCTGGTGAGCGTCCCCGCAGATG 0: 1
1: 0
2: 0
3: 7
4: 56
Right 1018226484 6:161634275-161634297 GATGGGCTCAGTCCCCCTGAAGG 0: 1
1: 0
2: 1
3: 9
4: 115
1018226478_1018226491 14 Left 1018226478 6:161634256-161634278 CCTGGTGAGCGTCCCCGCAGATG 0: 1
1: 0
2: 0
3: 7
4: 56
Right 1018226491 6:161634293-161634315 GAAGGCCTGTAGCAGGGCAGCGG No data
1018226478_1018226493 18 Left 1018226478 6:161634256-161634278 CCTGGTGAGCGTCCCCGCAGATG 0: 1
1: 0
2: 0
3: 7
4: 56
Right 1018226493 6:161634297-161634319 GCCTGTAGCAGGGCAGCGGGAGG 0: 1
1: 0
2: 2
3: 37
4: 367
1018226478_1018226485 7 Left 1018226478 6:161634256-161634278 CCTGGTGAGCGTCCCCGCAGATG 0: 1
1: 0
2: 0
3: 7
4: 56
Right 1018226485 6:161634286-161634308 TCCCCCTGAAGGCCTGTAGCAGG No data
1018226478_1018226487 8 Left 1018226478 6:161634256-161634278 CCTGGTGAGCGTCCCCGCAGATG 0: 1
1: 0
2: 0
3: 7
4: 56
Right 1018226487 6:161634287-161634309 CCCCCTGAAGGCCTGTAGCAGGG 0: 1
1: 0
2: 0
3: 8
4: 140
1018226478_1018226492 15 Left 1018226478 6:161634256-161634278 CCTGGTGAGCGTCCCCGCAGATG 0: 1
1: 0
2: 0
3: 7
4: 56
Right 1018226492 6:161634294-161634316 AAGGCCTGTAGCAGGGCAGCGGG 0: 1
1: 0
2: 2
3: 27
4: 279
1018226478_1018226495 19 Left 1018226478 6:161634256-161634278 CCTGGTGAGCGTCCCCGCAGATG 0: 1
1: 0
2: 0
3: 7
4: 56
Right 1018226495 6:161634298-161634320 CCTGTAGCAGGGCAGCGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018226478 Original CRISPR CATCTGCGGGGACGCTCACC AGG (reversed) Intronic
903216445 1:21846089-21846111 CCACTGCAGGGACCCTCACCGGG + Exonic
907268056 1:53274793-53274815 AATCTGCGGGGACCCTCACAGGG + Intronic
909817559 1:80015841-80015863 CAGCTGAGGGGAAGCGCACCTGG + Intergenic
913356621 1:117929518-117929540 CATCTCCGGCGACCCTCAGCAGG + Exonic
919977793 1:202623799-202623821 CAGCTGGGGGAGCGCTCACCAGG + Intronic
1063639762 10:7818320-7818342 CAGGTGCTGGGGCGCTCACCTGG - Intergenic
1067525443 10:47035738-47035760 CTTCTGAGGGGACACACACCTGG + Intergenic
1071564658 10:86665489-86665511 CATCTCCTGGGATGCTCCCCGGG - Intronic
1077333715 11:1994318-1994340 CCTCTGCGGGGAAGCTGACCCGG + Intergenic
1078421923 11:11219538-11219560 AAACTGGGGGGACGCTCACTGGG - Intergenic
1078599564 11:12718171-12718193 CATCTGTGGGGACGTGCCCCAGG + Intronic
1080583151 11:33659834-33659856 CATCTGCTGGGACTCAGACCTGG - Intronic
1083635390 11:64117983-64118005 CATCTGCTGGTACGTGCACCAGG + Exonic
1084399210 11:68933910-68933932 CATCTGCAAGCAAGCTCACCAGG - Exonic
1084737081 11:71112498-71112520 CAGCTGCAGGGGAGCTCACCTGG + Intronic
1089739966 11:120575691-120575713 CATCTGTAGGGACGCCCAGCAGG - Intronic
1096559169 12:52423722-52423744 CCTCTGCTGGGCCGCCCACCCGG + Intergenic
1096743850 12:53713022-53713044 CATCTGTGTGGACAGTCACCAGG - Intronic
1103607304 12:122096856-122096878 CAGCTGGGGGGACTCACACCTGG - Intronic
1113899912 13:113790958-113790980 CATCTGCGAGGACGTTCGCAGGG + Intronic
1123584702 15:21747342-21747364 CATCTGCTGGGATACTCACATGG + Intergenic
1123621347 15:22189949-22189971 CATCTGCTGGGATACTCACATGG + Intergenic
1124513537 15:30347742-30347764 CATATGCTGGGAGGCTGACCAGG - Intergenic
1124729384 15:32183023-32183045 CATATGCTGGGAGGCTGACCAGG + Intergenic
1130979391 15:88802820-88802842 CGTCAGCGGGGAGGCTCACGGGG - Intergenic
1132668560 16:1093478-1093500 CAGCCGCGGGGCCCCTCACCCGG + Exonic
1135036728 16:19084800-19084822 AATCTGTGGAGACGCTCACATGG + Intergenic
1139592766 16:67942652-67942674 CATCCGCAGAGACACTCACCGGG + Exonic
1140514471 16:75532170-75532192 CCTCTGTGGGGAGACTCACCAGG - Intronic
1142539639 17:648092-648114 CAGCTGCTGGGACACCCACCTGG + Intronic
1144142969 17:12367697-12367719 CATTTGTGGGGGTGCTCACCAGG - Intergenic
1149038349 17:52158821-52158843 CGGCGGCGAGGACGCTCACCTGG - Intronic
1151545473 17:74790369-74790391 AATCTGCGGGGAGCCTCTCCAGG - Intronic
1152718395 17:81910898-81910920 CACCTACAGGGACGCTCGCCCGG + Intronic
1157585840 18:48800650-48800672 CATCTGCGGAGGTGCTCCCCTGG + Intronic
1162793646 19:13075741-13075763 CAACTGGTGGGAGGCTCACCAGG - Intronic
926245814 2:11121867-11121889 CAGATCTGGGGACGCTCACCTGG + Intergenic
937318822 2:120948601-120948623 CCTCTCAGGGGAGGCTCACCTGG + Intronic
1173490541 20:43476511-43476533 TGTCTGGGGGGACGCCCACCTGG - Intergenic
1174258711 20:49278002-49278024 CAGTTGCGGGGCCACTCACCCGG + Exonic
1175453290 20:59089224-59089246 CATCACTGGGGATGCTCACCGGG + Intergenic
1176083064 20:63283598-63283620 CAGCTGCAGGGACGCCCATCTGG + Intronic
1178403520 21:32306715-32306737 CATCTGCGGGGAGGCGGACCAGG - Exonic
967085315 3:186089929-186089951 AATCTGTGGAGACGCACACCAGG + Intronic
969566741 4:7983205-7983227 CATCTGCGGGGACTCTCGCATGG + Intronic
982357762 4:154489393-154489415 CATCTACGGTGATGCTCACCAGG + Intronic
1003544848 6:7051257-7051279 CACCTTCCGGGACGCGCACCTGG + Intergenic
1012567690 6:100680360-100680382 CATCTTCAGGGACAGTCACCAGG + Intronic
1016433004 6:144007916-144007938 GATCTGCGGGGTCCCGCACCCGG + Intronic
1018226478 6:161634256-161634278 CATCTGCGGGGACGCTCACCAGG - Intronic
1021805261 7:24348983-24349005 CAGCTGCAGGGATGCTCAACAGG - Intergenic
1023908811 7:44539856-44539878 CAGCTGCAGGGACGCGCACACGG + Exonic
1032782126 7:135171783-135171805 CCTCTGCAGGGACGCTCCACAGG - Intergenic
1053143732 9:35698025-35698047 CATCTGGGGTGAAGCTCACCTGG + Exonic
1053474019 9:38368956-38368978 CATCACTGGGGAGGCTCACCTGG + Intergenic
1053919649 9:42975045-42975067 CACCTGCGGGGATGCGCAGCGGG - Intergenic
1054380981 9:64488791-64488813 CACCTGCGGGGATGCGCAGCGGG - Intergenic
1055030448 9:71768271-71768293 CCACTGCGGGGACGCAGACCCGG - Intronic
1059452036 9:114376687-114376709 CATCTTTGGGGAATCTCACCCGG + Exonic
1203787348 EBV:135333-135355 CCTCTGCCGGGAAGCCCACCCGG + Intergenic
1186507350 X:10103680-10103702 CTTCTCCAGGGACGCTCACAGGG - Intronic
1190345343 X:49332068-49332090 CCGCTGCGGGGGCGCTCACCAGG - Intronic
1191122169 X:56917504-56917526 CATCTACTGAGACACTCACCTGG + Intergenic
1199533614 X:148877297-148877319 CATCTGCTGGAATGCTCACAGGG + Intronic