ID: 1018227641

View in Genome Browser
Species Human (GRCh38)
Location 6:161644569-161644591
Sequence CAGGCGCCCACACTTGGACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 162}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018227641_1018227647 16 Left 1018227641 6:161644569-161644591 CCAGGTCCAAGTGTGGGCGCCTG 0: 1
1: 0
2: 1
3: 9
4: 162
Right 1018227647 6:161644608-161644630 TCAGATCTCTCATGTCTTCATGG 0: 1
1: 0
2: 14
3: 21
4: 257
1018227641_1018227648 26 Left 1018227641 6:161644569-161644591 CCAGGTCCAAGTGTGGGCGCCTG 0: 1
1: 0
2: 1
3: 9
4: 162
Right 1018227648 6:161644618-161644640 CATGTCTTCATGGCGTCTGTTGG 0: 1
1: 0
2: 0
3: 8
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018227641 Original CRISPR CAGGCGCCCACACTTGGACC TGG (reversed) Intronic
900210039 1:1450877-1450899 GAGGCGCCCAAGCTTGGCCCTGG - Intronic
900222400 1:1516207-1516229 GAGGCGCCCAAGCTTGGCCCTGG - Intronic
900296853 1:1956228-1956250 GACGCGCTCACACTTGGAACAGG + Intronic
900309336 1:2025778-2025800 CAGGCGCCGACGCTTGGCCCGGG - Intronic
900458699 1:2789940-2789962 CAGGCGCTCGCACATGGCCCGGG + Intronic
901214901 1:7549862-7549884 CAAGCGCCCAGGCTTGGCCCTGG + Intronic
903492893 1:23743270-23743292 CCAGCGCGCACACTTGGGCCAGG + Exonic
904238121 1:29126889-29126911 CAGGCGCCCACCACTGTACCCGG - Intergenic
905778220 1:40684672-40684694 CAGGCGCACCCACTTGGCCATGG + Intergenic
907176483 1:52528032-52528054 CAGGCGCCCACCACTGTACCCGG - Intronic
907437250 1:54457840-54457862 CAGGCGCCCACCACTGCACCCGG - Intergenic
912500552 1:110119315-110119337 CAGGGGCCCACATTTACACCTGG + Intergenic
914678414 1:149921461-149921483 CAGGCGCCCACCACTGCACCTGG + Intergenic
917531997 1:175843809-175843831 CAGGCTCGGACACATGGACCGGG - Intergenic
917968917 1:180195057-180195079 CAGGCGCCTGCACTTGGTCGTGG + Intronic
918669765 1:187200559-187200581 CAGGCGCCCACCACTGCACCCGG - Intergenic
920508716 1:206535071-206535093 CAGGCGCCCACCACTGCACCTGG - Intronic
921265189 1:213416123-213416145 CAGGCTCCCACGCATGCACCCGG + Intergenic
922290320 1:224204256-224204278 CAGGCGCCCACCACTGCACCTGG + Intergenic
923783101 1:237042818-237042840 CAGGCGCCCGGGCTCGGACCCGG + Intronic
924708196 1:246514757-246514779 CAGGCGCCCACCACTGCACCTGG - Intergenic
1063115462 10:3068677-3068699 CCGGCGCCCCCACGTGCACCCGG - Intronic
1064126627 10:12667101-12667123 CAGGCAGCCACATTTGGCCCTGG - Intronic
1069922405 10:71824238-71824260 CAGGAGCCCACACTGGCCCCGGG + Intronic
1070004637 10:72411468-72411490 CAGGCGCCCACCACTGCACCCGG + Intronic
1073177697 10:101566481-101566503 CAGGCGCGCACACATGCACATGG - Intergenic
1074414041 10:113251535-113251557 CTGGAGCCCACACTTGGTGCTGG + Intergenic
1075477661 10:122750174-122750196 CAGGTGCCCACAGTTGTGCCTGG - Intergenic
1075478452 10:122756976-122756998 CAGGTGCCCACAGTTGTGCCTGG - Intergenic
1075479172 10:122764602-122764624 CAGGTGCCCACAATTGTGCCTGG - Intergenic
1075479581 10:122768333-122768355 CAGGTGCCCACAGTTGTGCCTGG - Intergenic
1077516359 11:3004298-3004320 CAGCCACCCACACTTGGATCTGG + Intronic
1082024561 11:47562845-47562867 CAGGCGCCCACTATTATACCTGG + Intronic
1083941408 11:65898181-65898203 CAGGCGCCCACAACTGTGCCCGG + Intronic
1084400144 11:68938754-68938776 CAGGCGCCCACACCTGGCCCAGG - Intronic
1084675558 11:70631807-70631829 CAGACGCCCAGACTTGGAGCTGG - Intronic
1084722782 11:70918646-70918668 CAGGCGCCCACAACTACACCTGG + Intronic
1085495026 11:76961052-76961074 CAGGCTCCAACACTTGGTGCTGG - Intronic
1086965854 11:93027496-93027518 CAGGTGCCCACAACTGCACCTGG - Intergenic
1089508548 11:118980783-118980805 CAGGCTTCCACACTTGGCCTTGG - Intronic
1093978351 12:25448714-25448736 CAGGCGCCCACCCCTACACCAGG - Intronic
1094109556 12:26847160-26847182 CAGGCGCCCACCACTGCACCCGG - Intergenic
1095989563 12:48025369-48025391 CAGGCGCCCAGAGATGGAGCTGG - Exonic
1096211995 12:49773764-49773786 CAGGCGCCCACCACTGCACCTGG + Intergenic
1098158680 12:67626236-67626258 CAGGCCTTCAGACTTGGACCAGG + Intergenic
1101176604 12:102157975-102157997 CAGGCGCCCACCATTACACCTGG - Intronic
1101644972 12:106623179-106623201 CAGGCGCCCACCACTGCACCTGG + Intronic
1102470127 12:113155025-113155047 CAGGCGCCCGCCAGTGGACCTGG - Intronic
1102553086 12:113706376-113706398 CAGGCGCCCACCACTGCACCTGG - Intergenic
1103611988 12:122129620-122129642 CAGGCTCACCCACCTGGACCAGG - Exonic
1105004898 12:132715426-132715448 CAGGCGCCCACCACTGCACCTGG - Intronic
1109603685 13:64663807-64663829 CAGGTACCCACATTTGGACCAGG - Intergenic
1109963565 13:69662815-69662837 CAGGCGCCCGCCATTGCACCTGG + Intergenic
1112521862 13:100103452-100103474 CAGGCGCCCACCACTGCACCTGG + Intronic
1112893000 13:104261770-104261792 CAGGCGCCCACCACTGCACCTGG - Intergenic
1115780556 14:36763884-36763906 CAGGTGCCCACCATTGCACCTGG - Intronic
1119538092 14:75419372-75419394 AAGGCCCCCACACTCGGAACTGG - Intergenic
1119794696 14:77385426-77385448 CAGGCGCCCACCACTGTACCTGG + Intronic
1122576189 14:102744153-102744175 CAGGCGCCCACCACTGCACCCGG + Intergenic
1123116138 14:105894883-105894905 CAGGCACCCACATCTGGATCAGG - Intergenic
1123502249 15:20899626-20899648 CAGGCGCCCACCACTGCACCTGG + Intergenic
1123559498 15:21473309-21473331 CAGGCGCCCACCACTGCACCTGG + Intergenic
1123595734 15:21910609-21910631 CAGGCGCCCACCACTGCACCTGG + Intergenic
1125318801 15:38459708-38459730 CGGGCGCCCACCCTTGGTACAGG - Intronic
1126728553 15:51657494-51657516 CAGGCGCCCACCACTGCACCCGG + Intergenic
1128246522 15:66136353-66136375 CAAGAGCCCACACTAGGACAGGG + Intronic
1132092240 15:98956132-98956154 CAGCCGGCCACACGTGGACAAGG - Intronic
1202967844 15_KI270727v1_random:200469-200491 CAGGCGCCCACCACTGCACCTGG + Intergenic
1132886035 16:2182481-2182503 CAGGCGTCCACACTTCCAGCTGG + Intronic
1133078015 16:3295045-3295067 CAGGCACTCACACTTGCGCCGGG - Intronic
1133317735 16:4894688-4894710 CAGCCCCCGACTCTTGGACCTGG + Intronic
1135724683 16:24845462-24845484 CAGGCGCCCACATCGGGCCCAGG - Intergenic
1139015571 16:62684867-62684889 CAGGCACCCACATCTGGACGAGG - Intergenic
1141582965 16:85012760-85012782 CAGGCGCCCAAAACTGCACCCGG - Intergenic
1142635399 17:1254029-1254051 CAGGAGCCCAAAGCTGGACCTGG + Intergenic
1143006695 17:3840934-3840956 CAGAAACCCACAGTTGGACCTGG - Intronic
1143188908 17:5027269-5027291 CAGGCGCCCACAACCGCACCCGG + Exonic
1143782769 17:9238077-9238099 CCTGCACCCACACATGGACCAGG - Intronic
1147179498 17:38675083-38675105 CAGACACACACACGTGGACCCGG + Exonic
1152184941 17:78849779-78849801 CAGGCGCCCACCACTGTACCTGG + Intergenic
1157277055 18:46318525-46318547 CAGGCGCCCACTCGGGGACAAGG - Intergenic
1160810440 19:1010795-1010817 CAGGCGCCGCCACTGGGCCCCGG - Exonic
1161485890 19:4535432-4535454 CAGGTGGCCAAACTTGGTCCGGG - Intronic
1161626430 19:5329620-5329642 CAGGCGCCCACTATTACACCCGG - Intronic
1162344838 19:10113124-10113146 CAGGTGCTCACACTTGGCCAGGG - Intronic
1162867457 19:13559620-13559642 CAGGTGCCCACAGTGGTACCTGG - Intronic
1164426991 19:28150398-28150420 CAGAGCCCCACACTTTGACCAGG + Intergenic
1165142812 19:33712611-33712633 CAGCCGCCCACACTTGCTCCAGG + Intronic
1168439277 19:56349560-56349582 CAGGCGCCCACCACTGCACCCGG - Intronic
1168590237 19:57627896-57627918 CAGGCGCCCACCACTGCACCTGG + Intergenic
926641105 2:15237915-15237937 CAGGCGCCCGCCATTGGGCCTGG + Intronic
931736549 2:65199601-65199623 CAGGGGCCAACACCTGGAACTGG - Intergenic
935416818 2:102827946-102827968 CAGGCGCCCACAATCACACCCGG - Intronic
942755615 2:179337939-179337961 CAGGCGCCCACCACTGCACCTGG + Intergenic
944660821 2:201920258-201920280 CAGGCGCCCACCCCTACACCTGG + Intergenic
946048443 2:216840783-216840805 TAGGCGCACACACATGGACATGG - Intergenic
946118860 2:217491042-217491064 CAGGAGCCCAGACTTGTCCCTGG - Intronic
947135634 2:226974378-226974400 CAGGCGCCCACCACTGGGCCTGG + Intronic
947537047 2:230946714-230946736 CTGCAGCCCACACCTGGACCAGG + Intronic
947764932 2:232631858-232631880 CAGGCGCCCACCACTGCACCTGG - Intronic
1168910144 20:1440836-1440858 CAGGAGCTCAGACTGGGACCTGG + Intergenic
1169802994 20:9530443-9530465 CAGGTCCCCCGACTTGGACCTGG - Exonic
1170110501 20:12799339-12799361 CAGGCGCCCACCATTACACCCGG - Intergenic
1170607175 20:17883002-17883024 CAGGCGCCCACACTAGCAACAGG + Intergenic
1172046792 20:32086160-32086182 CAGGCGCCCACAACTGCGCCTGG + Intronic
1172875576 20:38162046-38162068 CAGGAGCCATCACTTGGCCCAGG - Intronic
1173837077 20:46132881-46132903 CACCCGCCCACACTTGGAAGAGG + Intergenic
1175142588 20:56872071-56872093 CAGCCGCCCACACTCTGTCCAGG + Intergenic
1180250940 21:46587693-46587715 CAGGCGCCCGCAACTGCACCTGG - Intergenic
1180699861 22:17775361-17775383 CAGACGCCCTCACTTCTACCCGG + Intergenic
1184646439 22:45897808-45897830 CAGGCGGCCTCACTGGCACCTGG + Intergenic
1184796018 22:46733063-46733085 CAGGCACCCACCATTGCACCCGG - Intronic
1185076806 22:48687535-48687557 CTGGTGCCCTCACTAGGACCTGG - Intronic
949450698 3:4181741-4181763 CATGAGCCTACCCTTGGACCTGG + Intronic
949494046 3:4615083-4615105 AAGGTTCCCACACATGGACCTGG - Intronic
950428760 3:12938909-12938931 CAGGGGGACACACATGGACCTGG + Intronic
953353385 3:42233103-42233125 CAGGCGCCCACCATCAGACCCGG - Intergenic
955279350 3:57579428-57579450 CAGGCGCCCACCATTACACCTGG + Intronic
963157529 3:142115459-142115481 CAGGCGCCCACGACTGCACCTGG + Intronic
963606872 3:147419765-147419787 CCGGCACCCAGACTTGGATCTGG - Intronic
968655042 4:1774801-1774823 CAGGCCCCCACACTGGGCCACGG - Intergenic
973755662 4:54070903-54070925 CAGATGCCCACTCTTGGAACTGG - Intronic
975298038 4:72756553-72756575 CAGGCGCCCACCACTGCACCTGG - Intergenic
976850693 4:89541837-89541859 CAGGCTGACACACTTGGACTGGG + Intergenic
978575919 4:110189822-110189844 CAGGCGCCCACAATCACACCTGG - Intronic
980541364 4:134201102-134201124 GAGGCCTCCACACTTGAACCGGG - Exonic
980856146 4:138442830-138442852 CAGGCGCCCACCACTGCACCCGG - Intergenic
981454512 4:144937903-144937925 CAGGTGCCCACTATGGGACCAGG + Intergenic
986184269 5:5422055-5422077 GTGGCGCCCACACCTGGGCCTGG + Intronic
992744699 5:79807575-79807597 CAGGCACCCACATTTGGGGCTGG + Intergenic
995724110 5:115166886-115166908 CCGGCGCCCATACTGGCACCTGG + Intronic
999164555 5:149537231-149537253 CAGGCGCCCACTACTGCACCCGG - Intronic
1002538847 5:179893119-179893141 CAGGTCTACACACTTGGACCAGG + Intronic
1002756772 6:168312-168334 CAGGCGCCCACCACTGCACCTGG - Intergenic
1003127015 6:3363563-3363585 CAGGTGCCCACACTGGGCCCAGG - Intronic
1003872468 6:10413418-10413440 AGGGCGCCCACACCTGGAGCTGG + Intronic
1004818028 6:19333659-19333681 CAGGCGCCCACCATGGCACCCGG + Intergenic
1009530133 6:64803036-64803058 CAGGCACCCACATCTGGACGAGG + Intronic
1010926694 6:81753176-81753198 CATGAGTCCACACTTGGATCGGG - Intergenic
1018227641 6:161644569-161644591 CAGGCGCCCACACTTGGACCTGG - Intronic
1019119959 6:169794549-169794571 CAGGCGGCCACCCCAGGACCAGG + Intergenic
1019300786 7:302467-302489 CAGGAGGCCACACCTGGCCCTGG - Intergenic
1024199848 7:47095604-47095626 CAGGTGCCCACATTTTTACCAGG - Intergenic
1024664031 7:51528206-51528228 TAGGAGCCCACACTGGGACTGGG - Intergenic
1029450626 7:100640354-100640376 CAGGCGCCTAGATTTGGAGCAGG - Intronic
1029704032 7:102266388-102266410 CAGGGGTCCACACTTGGGCTTGG + Intronic
1030230768 7:107206101-107206123 CAGGCGCCCGCCATTGCACCCGG + Intronic
1031616867 7:123892009-123892031 CAGGAGACCACAGTTAGACCTGG + Intergenic
1034173206 7:149079264-149079286 CAGGCGCCCACCACTGCACCCGG - Intronic
1034472960 7:151265423-151265445 CAGCCTCCGACACTGGGACCAGG + Intronic
1034845912 7:154444320-154444342 CAGGCGCCCACAATCACACCTGG - Intronic
1035310069 7:157961936-157961958 CCGGCGGCCACACCTGGACCCGG + Intronic
1036907737 8:12721101-12721123 CAGGCACCCACATCTGGACAAGG - Intergenic
1037523523 8:19702890-19702912 CAGTAGCCCCCACTTAGACCAGG + Intronic
1037842249 8:22253363-22253385 CACGTGCCCACTCTTGGACCAGG + Exonic
1037969124 8:23159717-23159739 CAGGTGCCCACCCTTGCGCCTGG - Intronic
1038225527 8:25653966-25653988 CAGGCACCCACCCATGGGCCTGG - Intergenic
1038461641 8:27722299-27722321 CAGACTCCCACACTTGGGACAGG + Intergenic
1042060944 8:64816998-64817020 TAGGCTCCCACACTTGGCGCTGG + Intergenic
1045750018 8:105472643-105472665 CAGGCGCCCACCATCGCACCCGG + Intronic
1049182941 8:141232196-141232218 CAGGCTCCCACACATGGGGCCGG + Intronic
1049645359 8:143733585-143733607 CTTGCGCCCACACCTGGGCCGGG - Intronic
1050038843 9:1466080-1466102 GAACCACCCACACTTGGACCTGG - Intergenic
1056209039 9:84347980-84348002 CAAGAGCCAACACTAGGACCAGG + Intergenic
1058545057 9:106052456-106052478 CAGGCAGCCACACTAGGTCCTGG - Intergenic
1060209883 9:121703161-121703183 CAGGGACCCTCACCTGGACCTGG + Intronic
1060618900 9:125044850-125044872 CAGGCACCCACATCTGGACGAGG - Intronic
1061113076 9:128589429-128589451 CAGGCGCCCACCACTGCACCTGG + Intronic
1061902424 9:133679844-133679866 CAGGCGCCCGCTCTCGCACCCGG + Intronic
1187506627 X:19883595-19883617 CAGGCACCCACAGCTGGGCCAGG + Intronic
1194719051 X:97319527-97319549 CAGGCGCCCACCACTGCACCCGG + Intronic
1198743140 X:139862374-139862396 CAGAGGCCCAGACTTGGAACTGG + Intronic
1200116925 X:153773508-153773530 CAGTCGCCCACCCCTGTACCAGG - Exonic