ID: 1018229633

View in Genome Browser
Species Human (GRCh38)
Location 6:161663150-161663172
Sequence GACTCACAGTTCCACGTGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 22098
Summary {0: 36, 1: 862, 2: 5111, 3: 8006, 4: 8083}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018229633_1018229636 17 Left 1018229633 6:161663150-161663172 CCAGTCACGTGGAACTGTGAGTC 0: 36
1: 862
2: 5111
3: 8006
4: 8083
Right 1018229636 6:161663190-161663212 TTTATAAATTACCCAATCTCAGG 0: 313
1: 7384
2: 13951
3: 14074
4: 10807

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018229633 Original CRISPR GACTCACAGTTCCACGTGAC TGG (reversed) Intronic
Too many off-targets to display for this crispr