ID: 1018229707

View in Genome Browser
Species Human (GRCh38)
Location 6:161663846-161663868
Sequence GGACCACGAGGAGCAGCCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 209}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018229702_1018229707 1 Left 1018229702 6:161663822-161663844 CCCTGTGGTGAGAGGGTGGCTGG 0: 1
1: 0
2: 5
3: 39
4: 366
Right 1018229707 6:161663846-161663868 GGACCACGAGGAGCAGCCGCCGG 0: 1
1: 0
2: 0
3: 19
4: 209
1018229696_1018229707 13 Left 1018229696 6:161663810-161663832 CCCAACAGCCGGCCCTGTGGTGA 0: 1
1: 0
2: 1
3: 11
4: 91
Right 1018229707 6:161663846-161663868 GGACCACGAGGAGCAGCCGCCGG 0: 1
1: 0
2: 0
3: 19
4: 209
1018229704_1018229707 0 Left 1018229704 6:161663823-161663845 CCTGTGGTGAGAGGGTGGCTGGT 0: 1
1: 0
2: 2
3: 24
4: 260
Right 1018229707 6:161663846-161663868 GGACCACGAGGAGCAGCCGCCGG 0: 1
1: 0
2: 0
3: 19
4: 209
1018229697_1018229707 12 Left 1018229697 6:161663811-161663833 CCAACAGCCGGCCCTGTGGTGAG 0: 1
1: 0
2: 1
3: 11
4: 256
Right 1018229707 6:161663846-161663868 GGACCACGAGGAGCAGCCGCCGG 0: 1
1: 0
2: 0
3: 19
4: 209
1018229700_1018229707 5 Left 1018229700 6:161663818-161663840 CCGGCCCTGTGGTGAGAGGGTGG 0: 1
1: 1
2: 4
3: 46
4: 385
Right 1018229707 6:161663846-161663868 GGACCACGAGGAGCAGCCGCCGG 0: 1
1: 0
2: 0
3: 19
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018229707 Original CRISPR GGACCACGAGGAGCAGCCGC CGG Intronic
900186755 1:1336478-1336500 GGTCCACCCGGAGCAGCCGCCGG - Exonic
900996666 1:6126653-6126675 GCACCACTATGAGCAGCAGCAGG - Exonic
901676969 1:10890981-10891003 TGAGCAAGAGGAGCAGCCTCAGG + Intergenic
902214143 1:14924101-14924123 GGAGCGGGAGGAGGAGCCGCGGG + Intronic
903010970 1:20330293-20330315 TGATCACGAAGAGGAGCCGCGGG - Exonic
903281040 1:22250202-22250224 GGACCAGGAGGAGGAGCCGGGGG + Intergenic
903888502 1:26554967-26554989 AGACCACCAGGAGCAGCGGTGGG - Intronic
903976766 1:27155059-27155081 GGACCAGGAGGAGCTGCAGCTGG - Intronic
904642113 1:31938532-31938554 GAACCACGAGGAGGAGGAGCGGG - Intronic
905769139 1:40626078-40626100 AGACCACCAGGAGCAGGCACAGG + Exonic
906052712 1:42888031-42888053 AGGCCACGAGCAGCAGCAGCAGG + Intergenic
915782113 1:158563517-158563539 GGACAAAGAGGAGCAGCTGGAGG + Exonic
918450148 1:184650025-184650047 GGACAAGGAGGAGCAGACCCTGG - Intergenic
1063353001 10:5373750-5373772 GGCCCCCCAGGAGCAGCAGCAGG - Exonic
1068203895 10:53822426-53822448 GGAGCAAGAGGAGCAGGAGCAGG + Exonic
1069998570 10:72358965-72358987 GGACCAAGATGAGCAGCAGAGGG - Intergenic
1075904048 10:126065207-126065229 GGACAACCAAGAGCAGCCTCTGG + Intronic
1076890118 10:133279228-133279250 GGACCAGTTGGAGCAGCAGCAGG + Exonic
1077111595 11:864442-864464 GGAACACCAGCAGCAGCAGCAGG - Exonic
1077321023 11:1942046-1942068 GGGCCACCAGGAGCAGGTGCTGG + Intergenic
1077333687 11:1994231-1994253 GGAACACAAGGGGCAGCCCCTGG - Intergenic
1078631754 11:13009798-13009820 CGACGACGAGGCGCTGCCGCAGG + Intergenic
1083912853 11:65720253-65720275 CGACCAAGAGGAGGAGCCGCTGG - Exonic
1083954652 11:65976742-65976764 GGACGAGGAGAAGCAGCAGCAGG + Exonic
1089132665 11:116224557-116224579 GGACCACTAGGGGGAGCCCCGGG - Intergenic
1089152272 11:116373293-116373315 AGGCCACGAGGAGCTGCAGCTGG - Intergenic
1202816668 11_KI270721v1_random:49413-49435 GGAACACAAGGGGCAGCCCCTGG - Intergenic
1094649503 12:32361647-32361669 GGAACACGTGGAGCATCCGGAGG + Intronic
1094854998 12:34398930-34398952 GGACCACGGGGACCAGCCCAAGG + Intergenic
1101668085 12:106838561-106838583 GGAGCAGGAGGAGCAGGAGCAGG + Intronic
1101846118 12:108364399-108364421 GGAACACGAGGAGGTGCCCCTGG + Intergenic
1103534755 12:121626807-121626829 GCACCACCAGCGGCAGCCGCCGG + Exonic
1103561937 12:121797407-121797429 GGACCAGCAGGAACAGCAGCAGG + Intronic
1104682404 12:130760873-130760895 GGAACACGAGGGGCTGCCGAGGG - Intergenic
1104730625 12:131103543-131103565 GGACCACGGGGAGCAACCTGGGG - Intronic
1104954093 12:132455279-132455301 GGGCCACCAGGAACAGCCGGGGG + Intergenic
1105070914 12:133234128-133234150 GGACCAGCAGGAGCAGCAGCAGG - Exonic
1112438510 13:99408467-99408489 GGACCATGAGGGGCAGCCCGAGG + Intergenic
1114277027 14:21155782-21155804 ACACCACGAAGAGCAGCCTCTGG + Exonic
1118258447 14:64225382-64225404 GCAGCAGGAGGAGCAGCTGCAGG - Exonic
1118316004 14:64726554-64726576 GGCCCACCTGGAGCAGCCGGGGG - Intronic
1119444707 14:74653530-74653552 TGCCCACAAGGAGCAGCCGAAGG - Intronic
1119759212 14:77139708-77139730 CCACCACGTTGAGCAGCCGCAGG + Exonic
1119778056 14:77260401-77260423 GGACCATGAGAGGCAGCAGCAGG - Intergenic
1122695807 14:103551497-103551519 GGACCACGAGCTGCTGCGGCAGG - Intergenic
1123024859 14:105419811-105419833 GGAAGAGGAGGAGCGGCCGCGGG - Exonic
1123059251 14:105587032-105587054 GGGCCACGAGGCCCTGCCGCTGG - Intergenic
1123083582 14:105707263-105707285 GGGCCACGAGGCCCTGCCGCTGG - Intergenic
1123681686 15:22768530-22768552 GGAGCAGGAGGAGCAGATGCGGG - Intergenic
1123681781 15:22768992-22769014 GGAGCAGGAGGAGCAGGTGCGGG - Intergenic
1123681844 15:22769325-22769347 GGAGCAGGAGGAGCAGGTGCGGG - Intergenic
1123681934 15:22769829-22769851 GGAGCAGGAGGAGCAGATGCGGG - Intergenic
1123681938 15:22769850-22769872 GGAGCAGGAGGAGCAGATGCGGG - Intergenic
1123681942 15:22769871-22769893 GGAGCAGGAGGAGCAGATGCGGG - Intergenic
1123681955 15:22769952-22769974 GGAGCAGGAGGAGCAGATGCGGG - Intergenic
1123681986 15:22770120-22770142 GGAGCAGGAGGAGCAGATGCAGG - Intergenic
1123682186 15:22770729-22770751 GGAGCAGGAGGAGCAGATGCGGG - Intergenic
1123701719 15:22918929-22918951 GGGCGAGGAGGAGCAGCCCCCGG - Intronic
1123762154 15:23441421-23441443 GGAGCAGGAGGAGCAGATGCAGG - Exonic
1124333940 15:28843287-28843309 GGACCAGGAGAAGGAGCTGCGGG - Intergenic
1124684570 15:31771008-31771030 GGACCATGAGGGGCAAGCGCAGG - Intronic
1126800698 15:52294938-52294960 GGGCCACGAGGTGCAGTCGTAGG - Intronic
1126949254 15:53862205-53862227 GGACCACGAGAACAAGCAGCTGG - Intergenic
1128735291 15:70050213-70050235 GGAAGACGAGGAGAAGCAGCAGG + Intronic
1130113988 15:80989986-80990008 GGACCAAGAGGAGGAGCCAGTGG - Intergenic
1130725280 15:86432830-86432852 GAACAATGAGGAGCAGCCCCTGG + Intronic
1131156887 15:90081032-90081054 GGCCCTGGAGGTGCAGCCGCTGG + Exonic
1132552414 16:559045-559067 GGTCCATGAGGAACAGCCCCTGG - Intergenic
1132580417 16:682260-682282 GGACATCGAGGAGCACCTGCAGG + Exonic
1132583362 16:695172-695194 GCCCCACCCGGAGCAGCCGCTGG + Intronic
1132809287 16:1789907-1789929 GGAGCCCGAGGGGCAGCCACGGG + Intronic
1135016149 16:18926357-18926379 GGACGACGAGGAGCAGGCGGTGG + Exonic
1135321769 16:21502184-21502206 GGACGACGAGGAACAGGCGGTGG + Intergenic
1135437202 16:22437081-22437103 GGACGACGAGGAGCAGGCGGTGG - Intronic
1136333240 16:29595291-29595313 GGACGACGAGGAGCAGGCGGTGG + Intergenic
1136447926 16:30335322-30335344 GGAGGACGAGGAGCAGGCGGTGG + Intergenic
1136592284 16:31224713-31224735 GACCCACGAGCAGCAGCGGCTGG - Exonic
1138537661 16:57668374-57668396 GGAGCAGGAGGAGCAGGAGCAGG - Exonic
1141461701 16:84181745-84181767 GGGCCACGGGGATCAGCCTCAGG - Exonic
1142269514 16:89081873-89081895 GGGCCACAGGGAGCAGCTGCAGG - Intergenic
1142521957 17:511131-511153 GGACCAACTGGAGCAGCCACTGG - Exonic
1144828678 17:18120342-18120364 GGACGAGGAGGAGCTGCCCCCGG + Exonic
1145029721 17:19495401-19495423 GGAGCAGCAGGAGCAGCAGCAGG - Intronic
1145029723 17:19495422-19495444 GGAGCAGCAGGAGCAGCAGCAGG - Intronic
1145218429 17:21069428-21069450 GGGGCAGGAGGAGCAGCAGCAGG + Intergenic
1146006928 17:29166307-29166329 GCACCACGGGGGGCAGGCGCAGG + Exonic
1146793111 17:35764137-35764159 GGAGGGCGAGGAGCCGCCGCGGG + Exonic
1148388757 17:47254771-47254793 GGACCACGGGCAGCAACCCCGGG - Intronic
1148451142 17:47778479-47778501 GGAGCACGCGGAGAAGGCGCAGG + Intergenic
1150292903 17:63992002-63992024 GGCCCCCGAGGAGCAGCTTCAGG - Intergenic
1151390851 17:73785824-73785846 GGGCCACGTGGAGCTGCAGCCGG + Intergenic
1151701029 17:75742661-75742683 TGACGACGAGAAGCAGCTGCTGG + Exonic
1151935130 17:77256773-77256795 GAACCACAAGGACCAGCAGCTGG + Intergenic
1152597937 17:81246957-81246979 GGACCAGCAGGAGAAGCTGCTGG - Exonic
1152773967 17:82188337-82188359 AGCCCACGTGGAGCAGCTGCAGG - Exonic
1155780523 18:29826882-29826904 GGACCACAAGCAGCAGACCCTGG + Intergenic
1158480999 18:57821755-57821777 GGACCAGGAGCAGCAGCAGTTGG + Intergenic
1160486706 18:79299919-79299941 GTGCCACGAGGAGCAGCCGTAGG + Intronic
1160586330 18:79915424-79915446 GGACCAGGAGCAGCAGCGTCGGG - Intronic
1160619077 18:80157940-80157962 GGACCACAAGGAGAAGCAGCGGG + Exonic
1160806395 19:994040-994062 GGACCGCACGGAGCAGCTGCAGG + Exonic
1160973499 19:1780733-1780755 GGGCCACGAGGAGGAGCCCCAGG - Exonic
1160991425 19:1861876-1861898 GGGACACGTGGAGCAGCCGAAGG - Intronic
1161424988 19:4198401-4198423 GGACCGCGGGGAGCGGCCGGAGG - Intronic
1162493282 19:11007904-11007926 GGAGGAGGAAGAGCAGCCGCAGG + Exonic
1162904958 19:13817879-13817901 GCGCAACGAGGAGCAGCTGCTGG + Exonic
1162932436 19:13963695-13963717 GGACCGCGTGGTGCAGCGGCTGG - Exonic
1163021413 19:14482796-14482818 GGAACACGAGGCGGGGCCGCAGG + Exonic
1163158754 19:15452695-15452717 GGAGCAGCAGGAGCAGCTGCGGG - Exonic
1163690899 19:18737730-18737752 GGAGGAGGAGGAGCAGCAGCAGG - Intronic
1163696210 19:18764795-18764817 GGGCCAAGAGAAGCAGCTGCAGG + Intronic
1165423245 19:35732581-35732603 GGGCCATGGGGAGCAGCCACGGG + Exonic
1166107678 19:40605424-40605446 CGTCCACGTGGAGCACCCGCAGG + Exonic
1168339783 19:55616288-55616310 GCACCACGCGGTGCTGCCGCAGG - Exonic
925684649 2:6458686-6458708 AGACCAAGAGTAGCAGCAGCAGG + Intergenic
926111715 2:10188114-10188136 GGACCCCGAGCTGCAGCCCCAGG + Intronic
929483292 2:42333403-42333425 GGACCAAGAAGAGCTGCCCCTGG + Intergenic
932837286 2:75049545-75049567 GGCCCACGAGGAGGAGCCAGAGG - Exonic
934773286 2:96921507-96921529 GGAGCAAGAGGAGAAGCTGCTGG + Exonic
936628909 2:114178993-114179015 GGCCCAGGAGGAGGAGCAGCAGG + Intergenic
938421602 2:131151576-131151598 TGACCAGGATGAGCTGCCGCTGG + Intronic
946449655 2:219769018-219769040 GCAGCAGGAGGAGCAGCAGCAGG + Intergenic
947732055 2:232436752-232436774 GCACCACGCGGGGCAGCTGCAGG + Intergenic
947806696 2:232973621-232973643 AGACCACGTGGAGCAGAGGCAGG + Intronic
947933502 2:233983852-233983874 TGACCAGGAGGAGCAGGCTCTGG - Intronic
948206966 2:236167624-236167646 GGGCGACGCGGAGAAGCCGCCGG + Exonic
948751485 2:240135977-240135999 GGACCAGGAGGCGCAGCCTGAGG - Intronic
949009787 2:241671914-241671936 TGACCACGAGGGTCAGACGCGGG + Intronic
1171173328 20:23034344-23034366 GGACACCCAGGAGCAGCCGCCGG - Intergenic
1171182389 20:23100350-23100372 GGTCCACGAGACGCAGCCCCTGG - Intergenic
1171411674 20:24952043-24952065 GGAGCACTGGGAGCTGCCGCAGG + Intronic
1171484436 20:25476992-25477014 GGAGCTGGAGGAGCCGCCGCAGG - Exonic
1172209526 20:33187116-33187138 GGACCCCGGGGCGCAGCCTCAGG + Intergenic
1173556987 20:43973292-43973314 GCACCAGGAGAAGCAGCCGGAGG - Intronic
1175203003 20:57290852-57290874 GGGCCAGGTGGAGCAGCAGCAGG - Intergenic
1175248302 20:57594340-57594362 GGACCTCGGGGACCAGCCCCTGG + Intergenic
1175583974 20:60122699-60122721 GGACCTGGAGGAGCAGAGGCTGG - Intergenic
1175674197 20:60932913-60932935 GGAAAACGAGGAGGAGGCGCTGG + Intergenic
1175930856 20:62493126-62493148 GGAACAGGAGGAGCAGCTCCAGG - Intergenic
1176033461 20:63025013-63025035 GGACCACGGGAAGCTGCAGCTGG - Intergenic
1176034720 20:63030623-63030645 GGTCCTTGAGGAGCAGCAGCTGG - Intergenic
1176081832 20:63277303-63277325 GCCCCACGAGGAGCAGCTACCGG - Exonic
1176381922 21:6117961-6117983 CGACTACGATGAGCAGGCGCTGG + Exonic
1179254076 21:39699875-39699897 GGAAGAAGAGGAGCAGCTGCTGG - Intergenic
1179656756 21:42850589-42850611 GGACCAGGAGCAGCAGCCTCTGG + Intronic
1179741550 21:43420278-43420300 CGACTACGATGAGCAGGCGCTGG - Exonic
1183083198 22:35470319-35470341 GGGCCATGAGGAGCTGCCACAGG - Intergenic
1184437826 22:44490315-44490337 GGACCACGAGGTCCAGGCACTGG + Intergenic
949547238 3:5082628-5082650 GCCCCAGGAGGAGCAGCAGCAGG - Intergenic
949987763 3:9553529-9553551 GGCCCGCGAGGAGCAGGCGGTGG + Intronic
953837337 3:46358163-46358185 TGACCATGATGAGCAGCGGCAGG - Exonic
960126568 3:114005153-114005175 GGTCCACATGGAGCAGCCCCTGG - Intronic
962203689 3:133418420-133418442 GGACAAGGAGGAGAAGCCCCGGG + Intronic
963598336 3:147356380-147356402 GGGCTAGGAGGAGGAGCCGCAGG - Intergenic
964006262 3:151832945-151832967 GGAACAGGAGGAGCAACAGCAGG + Intergenic
966886518 3:184380345-184380367 GCAGCCCGAGGAGCAGCAGCGGG - Exonic
966948791 3:184797131-184797153 GGACCACACGGACCACCCGCTGG + Intergenic
968442358 4:630301-630323 GGGCCACGAGGGGCAGCGGGAGG + Intronic
968701354 4:2059565-2059587 GGACCATGAGGCGCTGCCGGGGG + Exonic
968977764 4:3830822-3830844 GTAACAGGAGGAGCAGCCCCAGG + Intergenic
969098211 4:4750285-4750307 GGAGCACGGGGGTCAGCCGCAGG - Intergenic
969720084 4:8888715-8888737 GGACCATGAGGACCAGGCGCTGG - Intergenic
978615345 4:110588071-110588093 GGACCTTGCGGAGCAGCCACAGG + Intergenic
981081712 4:140643969-140643991 GGACCCGGAGGAAGAGCCGCTGG - Intronic
982122735 4:152158141-152158163 GGAACAGGGGGAGCAGCTGCAGG + Intergenic
982139453 4:152304178-152304200 GGACCACGAGGAGGTGCTGAGGG - Intergenic
982321787 4:154084549-154084571 GGCCCTGGAGCAGCAGCCGCTGG - Intergenic
985423160 4:189804182-189804204 GGACAACTAGGAACAGCCCCAGG - Intergenic
986392811 5:7301324-7301346 GGACCAGGAGAAGGAGCTGCGGG - Intergenic
988999953 5:36749562-36749584 GGACCAAGAGAACCAGCCTCTGG + Intergenic
992240800 5:74767325-74767347 GAGCCGCCAGGAGCAGCCGCTGG - Exonic
998038901 5:138938310-138938332 GGGCCACGAGGAGAAGGAGCTGG - Intergenic
998424020 5:142012227-142012249 AGACCACGAGGAGGCGCCACTGG + Exonic
999695988 5:154189622-154189644 GCGCCCCGAGGAGGAGCCGCTGG + Intronic
1001639172 5:173233141-173233163 GGACAACGCGGAGCGGCCCCGGG - Exonic
1002021453 5:176366391-176366413 GGAGGACGAGGAGCCGGCGCTGG + Exonic
1002108700 5:176893525-176893547 GGGCCACGAGGAGCACCAGCTGG + Intronic
1002334780 5:178470241-178470263 GGACCAGGAGGGACAGACGCTGG - Intronic
1005915213 6:30345321-30345343 GGACCCCGAGAACCAGGCGCTGG + Exonic
1007400198 6:41598897-41598919 GGACCTGGAGGAGGAGCTGCCGG + Exonic
1008531599 6:52466271-52466293 CAAGCAAGAGGAGCAGCCGCTGG - Intronic
1011684647 6:89814726-89814748 CCAGCACCAGGAGCAGCCGCTGG + Intronic
1016684844 6:146869455-146869477 GGACCTCAAGGAGAAGCCGATGG - Intergenic
1017672303 6:156778917-156778939 GGAGCAGGAGGAGCAGGAGCGGG + Exonic
1017737969 6:157381094-157381116 GGAGCAGGAGGAGGAGCCGCGGG + Intergenic
1018229707 6:161663846-161663868 GGACCACGAGGAGCAGCCGCCGG + Intronic
1019746439 7:2702833-2702855 GGGCCGCGAGGAGCAGCGGATGG - Exonic
1021639975 7:22727469-22727491 GCAACACCAGGAGCAGCCCCAGG - Exonic
1025990552 7:66493669-66493691 GGAACTCGAGGCGCAGCGGCTGG + Intergenic
1026038197 7:66844910-66844932 GGAACTCGAGGAGCGGCTGCCGG - Intergenic
1026773669 7:73217856-73217878 GGACCAGAAGGAGCAGGTGCCGG + Intergenic
1027014528 7:74771250-74771272 GGACCAGAAGGAGCAGGTGCCGG + Intergenic
1027073505 7:75174707-75174729 GGACCAGAAGGAGCAGGTGCCGG - Intergenic
1033099795 7:138460452-138460474 GGCCTCTGAGGAGCAGCCGCAGG + Exonic
1034271096 7:149803738-149803760 GGACCAGGCTGACCAGCCGCAGG - Intergenic
1034720366 7:153286691-153286713 GGACCAGGAGCAGCAGTCCCAGG + Intergenic
1039782452 8:40798590-40798612 GGACTACCAGGAGCATCAGCAGG - Intronic
1040071367 8:43191518-43191540 GCACCAGGATGAGCAGCCACTGG - Exonic
1041384081 8:57280131-57280153 GGCACAGGAGGAGCAGCTGCAGG + Intergenic
1043455747 8:80410295-80410317 GGATCTCGAGGGGCAGCGGCTGG + Intergenic
1045313803 8:101026395-101026417 GGACGAAGAGGAGCAGCTCCGGG + Intergenic
1049003579 8:139841158-139841180 GGACCACAAGAAGGAGCCGGGGG - Intronic
1049082084 8:140451313-140451335 GGACCACCACGAGCAGCGTCTGG + Exonic
1049682974 8:143927913-143927935 GGCCCACGAGGAGCAGCTCAAGG - Exonic
1050458444 9:5856375-5856397 GGGCCAAGAGGAGCGGCCGGAGG + Intergenic
1053001121 9:34577865-34577887 GGAGCGCGCCGAGCAGCCGCGGG + Intronic
1056963667 9:91148393-91148415 GGATCAGGAGGAGCAGTCGGGGG + Intergenic
1057353905 9:94320288-94320310 GGGCAAAGTGGAGCAGCCGCAGG - Exonic
1057653845 9:96937302-96937324 GGGCAAAGTGGAGCAGCCGCAGG + Exonic
1060096267 9:120793359-120793381 GGACCGGGAGCAGCGGCCGCAGG - Exonic
1060520740 9:124292574-124292596 GGACCAAGTGGAACAGCCCCGGG - Intronic
1061247701 9:129409413-129409435 GCACCCCAAGGAGCAGCTGCAGG + Intergenic
1061447675 9:130650433-130650455 GGACCAGGAGCAGAAGCCACGGG + Intergenic
1061848323 9:133400504-133400526 GGCCCAGGAGGTGCAGCAGCAGG - Exonic
1062390581 9:136332099-136332121 GGCCCACGGGCAGCAGCAGCGGG - Intronic
1062630392 9:137460696-137460718 GGAGTACGAGGAGGAGCTGCTGG - Exonic
1186480243 X:9891069-9891091 GGACCAGGAAGGACAGCCGCTGG - Exonic
1186509076 X:10117147-10117169 TGTCCTCGGGGAGCAGCCGCGGG + Exonic
1187505605 X:19875875-19875897 GGACCCCAAGAAGCAGCAGCTGG - Intronic
1188005421 X:25013238-25013260 GGACGACGAGGAGGAGCTGCTGG - Exonic
1188005430 X:25013301-25013323 GGACGACGAGGAGGAGCTGCTGG - Exonic
1192533757 X:71911243-71911265 GGACCTCGAGGGGCACCTGCTGG + Intergenic
1200232802 X:154452764-154452786 GGGCCAGGAGGAGCAGCCGTAGG - Intergenic
1200769005 Y:7106426-7106448 TGACCATGAGGACCAGCAGCAGG + Intergenic
1200951460 Y:8903089-8903111 GGCCGACGTGGAGCAGCAGCAGG - Intergenic
1202161487 Y:21940223-21940245 GGCCGACGTGGAGCAGCAGCAGG + Intergenic
1202229869 Y:22646150-22646172 GGCCGACGTGGAGCAGCAGCAGG - Intergenic
1202313287 Y:23550015-23550037 GGCCGACGTGGAGCAGCAGCAGG + Intergenic
1202557515 Y:26120579-26120601 GGCCGACGTGGAGCAGCAGCAGG - Intergenic