ID: 1018230401

View in Genome Browser
Species Human (GRCh38)
Location 6:161669895-161669917
Sequence AGAGCCTGTGCGCTGCAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 332
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 302}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018230401_1018230408 11 Left 1018230401 6:161669895-161669917 CCAGCCTGCAGCGCACAGGCTCT 0: 1
1: 0
2: 1
3: 28
4: 302
Right 1018230408 6:161669929-161669951 ATGCTGCCCCTTTGCAGAACGGG 0: 1
1: 0
2: 0
3: 18
4: 155
1018230401_1018230407 10 Left 1018230401 6:161669895-161669917 CCAGCCTGCAGCGCACAGGCTCT 0: 1
1: 0
2: 1
3: 28
4: 302
Right 1018230407 6:161669928-161669950 CATGCTGCCCCTTTGCAGAACGG No data
1018230401_1018230412 24 Left 1018230401 6:161669895-161669917 CCAGCCTGCAGCGCACAGGCTCT 0: 1
1: 0
2: 1
3: 28
4: 302
Right 1018230412 6:161669942-161669964 GCAGAACGGGCCCTGAGAAATGG No data
1018230401_1018230413 25 Left 1018230401 6:161669895-161669917 CCAGCCTGCAGCGCACAGGCTCT 0: 1
1: 0
2: 1
3: 28
4: 302
Right 1018230413 6:161669943-161669965 CAGAACGGGCCCTGAGAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018230401 Original CRISPR AGAGCCTGTGCGCTGCAGGC TGG (reversed) Intronic
900576019 1:3382808-3382830 AGTGCCTGTGGGCTGAGGGCTGG - Intronic
900976159 1:6017745-6017767 AGCGCCTCTGCACTGCAGCCTGG + Intronic
901349582 1:8582237-8582259 ATAGCCACTGCGCTGCAGCCTGG - Intronic
901587209 1:10306711-10306733 ATAGCCAGTGCACTGCAGCCAGG + Intronic
902276657 1:15344921-15344943 AGAGCATGTGCTCTGGAGTCAGG - Intronic
903322626 1:22552057-22552079 AGAGCCAGCGAGCTGGAGGCCGG + Intergenic
903706415 1:25289031-25289053 AAAGCCTGTGCTCTGAAGTCTGG - Intronic
903720822 1:25404335-25404357 AAAGCCTGTGCTCTGAAGTCTGG + Intronic
905527285 1:38648619-38648641 AGAGGCTGTGGGCTGGTGGCAGG - Intergenic
905741762 1:40377250-40377272 AGTGCCACTGCGCTGCAGCCTGG + Intronic
906301695 1:44686906-44686928 ATAGCCACTGCACTGCAGGCCGG + Intronic
906525646 1:46491649-46491671 GGATTCTGTGCGCTGCAGGCGGG + Intergenic
907401944 1:54229698-54229720 AGGGCCTTGGCGCTCCAGGCTGG - Intronic
907865043 1:58391214-58391236 AGAGCCTGGCTGCTGCTGGCCGG - Intronic
914868110 1:151450073-151450095 CGTGCCTCTGCGCTGCAGCCTGG - Intronic
915076040 1:153308697-153308719 AGAGGCTGTGCACTGCAGAGTGG - Intronic
915248460 1:154572157-154572179 AGAGCGTGAGTGCCGCAGGCTGG + Exonic
916197869 1:162241665-162241687 AGAGCCTGGACTCTGCAGTCAGG - Intronic
923461647 1:234214285-234214307 GGAGGATGTGCGCTGCAGGGCGG + Intronic
923591854 1:235327380-235327402 AGGGCCTGTGGGCCGCGGGCAGG + Intronic
924679953 1:246221060-246221082 AGAGACTGTTCTCTGCAGGCAGG - Intronic
1062899918 10:1135834-1135856 TGAGCCAGTGCGCTCCAGCCTGG - Intergenic
1063029725 10:2222227-2222249 CCATCCTGTGCACTGCAGGCTGG - Intergenic
1063473239 10:6306064-6306086 AGAGCCTCTGCTCTCCAGCCTGG - Intergenic
1063497614 10:6524867-6524889 AGAGCCTGCCCGCTGCAGCCAGG - Intronic
1063939218 10:11109761-11109783 AACGCTTGTGCTCTGCAGGCCGG + Intronic
1065259842 10:23913215-23913237 ACTGCCTGTGCCCTGCAGTCTGG - Intronic
1067781957 10:49214156-49214178 ACAGCATGTGCTCTGAAGGCAGG + Intergenic
1068005145 10:51384382-51384404 AGAGGCTGAGGGATGCAGGCAGG + Intronic
1068593978 10:58882710-58882732 AGAGGCTGTGGGGTGCAGACAGG + Intergenic
1069421504 10:68250640-68250662 AGAGGTTGTGCACTGCAGTCAGG - Intergenic
1070806525 10:79274156-79274178 AGCCCCTCTGTGCTGCAGGCAGG - Intronic
1071516811 10:86303450-86303472 AGAGACTGTGCTCAGCAGGAAGG + Intronic
1072156585 10:92729374-92729396 AGAGCCACTGCACTGCAGCCTGG + Intergenic
1072490761 10:95904080-95904102 GGAGCCTGTGGGCTGCAGGTTGG - Intronic
1072732685 10:97858287-97858309 AGAGTCTGTGAGCTCCAGGGAGG - Intronic
1075237779 10:120746535-120746557 AAAGACTGTGCTCTGCAGGGAGG + Intergenic
1076287759 10:129317049-129317071 GCAGCCTGTGGGCTGCAGGTTGG - Intergenic
1076585655 10:131545947-131545969 AAAGCCTGTGAGCTCCAGCCTGG + Intergenic
1076618969 10:131775004-131775026 AGAGTGTGGGGGCTGCAGGCTGG - Intergenic
1076726904 10:132418179-132418201 AGAGGCAGTGCTCTGCACGCGGG + Intergenic
1076744792 10:132507432-132507454 AGGGAATGTGCCCTGCAGGCAGG - Intergenic
1076783060 10:132735114-132735136 AGACCCTGTGGGCTCCATGCAGG + Intronic
1076839646 10:133039688-133039710 GGAGCCTGGGTGCTGCTGGCTGG - Intergenic
1077321210 11:1942922-1942944 AGAGCCGGTGATCTGCAGCCAGG + Intergenic
1077411771 11:2407039-2407061 CGGGGCTGTGCGCTGGAGGCAGG - Intronic
1078102254 11:8336837-8336859 AAGGCCAGTGCTCTGCAGGCAGG + Intergenic
1079603609 11:22341043-22341065 AGAGCTGCTCCGCTGCAGGCGGG - Intronic
1083298376 11:61727464-61727486 AGAGGCTCTGGGCTGCAGCCTGG + Intronic
1083622752 11:64057066-64057088 AGAGCTGGTGCGACGCAGGCTGG - Intronic
1084036656 11:66515499-66515521 AGAGCCTGTGAGCTCAAGCCAGG - Intronic
1084178731 11:67436346-67436368 AGAGCCTGTGGGAGACAGGCAGG + Exonic
1084637334 11:70400462-70400484 AGAGCCTCTGCACTCCAGCCTGG - Intronic
1086464358 11:87037990-87038012 AGAGCCTGAGCCCTGCAGGGAGG - Exonic
1087375776 11:97337755-97337777 TGAGCCAGTGCACTGCAGCCTGG + Intergenic
1089645560 11:119876395-119876417 GGAGCCTGTGTCCTGCTGGCTGG + Intergenic
1090703500 11:129316344-129316366 AGAGCCTGTGAGTTGAATGCTGG - Intergenic
1090869600 11:130731427-130731449 AGACCCAGGGCCCTGCAGGCTGG - Intergenic
1091318513 11:134632915-134632937 AGATCCTGAGCGGTGCAGACAGG - Intergenic
1091833441 12:3567359-3567381 AGAGCATGGGCTCTGCAGTCAGG - Intronic
1092753347 12:11739380-11739402 CGAGCATGTGCACTGCAGGTTGG - Intronic
1096517633 12:52165868-52165890 AGGCCCTGTGTGCTGCAGGCTGG - Intergenic
1098888545 12:75984294-75984316 AGAGCCATTGCACTGCAGCCTGG + Intergenic
1099764269 12:86961647-86961669 AGAGCCTGTGCACTTGAGGGAGG - Intergenic
1101123847 12:101610851-101610873 AGAGCCTGGGCTCTGCAGCCCGG - Intronic
1102096530 12:110245778-110245800 AGTTCCTGGGCACTGCAGGCAGG - Intergenic
1102251694 12:111391698-111391720 ATAGCCACTGCGCTGCAGCCTGG + Intergenic
1102296220 12:111738825-111738847 CGCGCCTGTGCACTGCAGCCTGG + Intronic
1104644473 12:130487018-130487040 GGAGCCTGTTGGCTGCAGCCAGG - Intronic
1104952839 12:132450192-132450214 AGGGACTGTGTGATGCAGGCAGG - Intergenic
1105526348 13:21181185-21181207 TGAGCCGTTGCGCTGCAGCCTGG + Intergenic
1108122691 13:47207177-47207199 AGAGCCTGCTAGCTGCAGGCAGG + Intergenic
1108204614 13:48075004-48075026 AGAGCCACTGCACTCCAGGCTGG + Intronic
1112238790 13:97660674-97660696 AGAGCCGGTGCAAGGCAGGCTGG + Intergenic
1112683390 13:101793689-101793711 AGAGGCTGTGCACTGCTGGTGGG - Intronic
1113548731 13:111175516-111175538 TGAGCCTGCCTGCTGCAGGCTGG + Intronic
1114068068 14:19083222-19083244 GCAGCCTGTGCTCTGCAGACAGG - Intergenic
1114094194 14:19316804-19316826 GCAGCCTGTGCTCTGCAGACAGG + Intergenic
1115576285 14:34714816-34714838 AGAGCGCGAGCCCTGCAGGCCGG + Intronic
1115881906 14:37928790-37928812 GGAGCCTGTGGGCTGGAGGCTGG + Intronic
1118003680 14:61546157-61546179 TAAGCCTGTGCAATGCAGGCAGG - Intronic
1118734220 14:68690550-68690572 CCAGCCTGTGAGCTGCGGGCAGG - Intronic
1118808263 14:69256232-69256254 AGAGCCTCTGCTGAGCAGGCTGG - Intergenic
1119484231 14:74977792-74977814 AGAGAGTGCGCCCTGCAGGCAGG + Intergenic
1120067003 14:80054107-80054129 GGAGCCTGTGGGCTGCAGGTTGG + Intergenic
1120456104 14:84732224-84732246 AGAGCCTAGGAGCTGCAGGGTGG - Intergenic
1121702056 14:95962076-95962098 ACAGCCTGTGGGCTGGATGCTGG - Intergenic
1122903727 14:104792508-104792530 AGTGCCTGTGCCCTGCTGGGTGG - Intronic
1122919752 14:104875139-104875161 AGAGCCTGGGCCCCTCAGGCTGG - Intronic
1123587925 15:21775350-21775372 TGAGCCTATGCTCTGCAGGCTGG - Intergenic
1123624563 15:22217915-22217937 TGAGCCTATGCTCTGCAGGCTGG - Intergenic
1123627018 15:22234246-22234268 ACAGCCTGGGCCCTACAGGCCGG - Intergenic
1124156281 15:27227453-27227475 AGTGCCAGTGCACTGCAGCCTGG + Intronic
1124721067 15:32111054-32111076 AGAGCTTGTGGGCTCCAGGAAGG + Intronic
1126789206 15:52205086-52205108 GAAGCCTGTGGGCTTCAGGCCGG + Exonic
1128565063 15:68695634-68695656 AGCGCCTGTTCTTTGCAGGCTGG + Intronic
1128802222 15:70504199-70504221 AAACCCTGAGAGCTGCAGGCTGG - Intergenic
1129055515 15:72817205-72817227 AGAGCCTGTGTTCTGCAGGAAGG + Intergenic
1129271611 15:74422056-74422078 AGAGGCCATGCGCTGCAGCCTGG + Intronic
1129364480 15:75045858-75045880 ATAGCCAGTGCGCTCCAGCCTGG + Intronic
1129386790 15:75200860-75200882 AGGGGCTGGGCGCTGCAGGTAGG - Intronic
1130049326 15:80470294-80470316 CGAGCCAGTGCGCTGCATGTGGG - Exonic
1131715863 15:95110234-95110256 AGAGCCACTGCGCTCCAGCCTGG - Intergenic
1132090332 15:98943076-98943098 AGAGGCTGGGGGCTCCAGGCTGG - Intronic
1132305336 15:100807831-100807853 AGGGCCTGAAGGCTGCAGGCTGG + Intergenic
1132721098 16:1316012-1316034 AGAGGCTGTGAGATCCAGGCTGG + Intronic
1132826122 16:1906545-1906567 AGAGCCTCAGCGCTGCACCCGGG + Intergenic
1132906116 16:2283603-2283625 AGAGCCTGTGCCTCTCAGGCGGG - Intronic
1132975374 16:2708546-2708568 AGAGCCTCTGACCTGCAGGCGGG - Exonic
1133080827 16:3318747-3318769 GGAGTGTGTGTGCTGCAGGCAGG + Exonic
1133785033 16:8966897-8966919 AGAGCCTCTGGGATACAGGCTGG + Intergenic
1135122437 16:19778076-19778098 AGAGCCTGTGCGAAGCAGTATGG + Intronic
1136229757 16:28879403-28879425 AGAGCCTCCCCACTGCAGGCCGG + Intronic
1137669386 16:50270650-50270672 GGAGCCTGGGTGGTGCAGGCAGG + Intronic
1137712478 16:50575936-50575958 ACATCCTGTGCACTGCAGGATGG - Intronic
1137800302 16:51256860-51256882 AGAGACTGTTTGCTGAAGGCAGG + Intergenic
1137910900 16:52377093-52377115 ACAGCCTGTCTGCTGCATGCTGG - Intergenic
1138276455 16:55738362-55738384 AGAGGCTGTGCAGTTCAGGCAGG - Intergenic
1138282385 16:55781725-55781747 AGAGGCTGTGCAGTTCAGGCAGG - Intergenic
1138286563 16:55814919-55814941 AGAGGCTGTGCAGTTCAGGCAGG + Intronic
1138346763 16:56324884-56324906 AGAGCCTGTCCACTGCAGAAGGG - Intronic
1138383110 16:56617370-56617392 AGGGACTGTGAGCAGCAGGCCGG - Intergenic
1138728978 16:59173804-59173826 AGAGTCTGTTCCCAGCAGGCAGG - Intergenic
1140661644 16:77195051-77195073 ACAGCCTGCACGCTGTAGGCAGG - Exonic
1141442966 16:84041360-84041382 TGAGACTGTGCGCTCCAGCCTGG - Intronic
1141455306 16:84137326-84137348 ACAGCCTGTGCTGTGCATGCGGG - Intronic
1141710629 16:85696918-85696940 GGAGCCGGCGCGCTGCAGGCAGG - Intronic
1142143820 16:88484368-88484390 AAGGCCTGAGCGTTGCAGGCTGG - Intronic
1142695095 17:1629021-1629043 GGGGCCTGGGCGCTGCGGGCCGG + Intergenic
1144575703 17:16428083-16428105 AGAGCCTGTGCACTGCATGCAGG - Intronic
1145238054 17:21222918-21222940 AGGGCATGTGTGCTCCAGGCTGG + Intergenic
1146093496 17:29905716-29905738 AGGGCCTGTGGGCTGGGGGCTGG + Intronic
1146159396 17:30551799-30551821 AGAGTGTATACGCTGCAGGCAGG + Intergenic
1148213774 17:45823627-45823649 AGAGCCTGTGCTCCGGAGCCTGG - Intronic
1148485350 17:47987386-47987408 AGAGCCTGAGCCCAGCAGGAGGG + Intergenic
1150424018 17:65062803-65062825 AGCGCCAGTGCACTGCAGCCTGG - Intergenic
1150606849 17:66699165-66699187 ATAGCCAGTGCACTGCAGCCTGG + Intronic
1150903403 17:69310189-69310211 AGATCCAGTGCACTGCAGGCTGG - Intronic
1151195612 17:72429429-72429451 AGAGCCTGTGCATTGGAGGTTGG - Intergenic
1152506473 17:80752330-80752352 AGACACTGTGGGCTGCATGCAGG - Intronic
1152571991 17:81125003-81125025 AGGGCCAGGTCGCTGCAGGCAGG + Exonic
1154321781 18:13360029-13360051 AGAGACTGTGAGCTGTAGGTGGG + Intronic
1155850237 18:30765562-30765584 AGAGCCTGGGCACTGGAGGAAGG - Intergenic
1156899875 18:42288156-42288178 AGAGCCTGTGCTATTCAGCCTGG + Intergenic
1159519088 18:69495642-69495664 AGGGCCTGAAGGCTGCAGGCAGG - Intronic
1159913070 18:74164830-74164852 TGCGCCACTGCGCTGCAGGCTGG - Intergenic
1159938704 18:74389092-74389114 AGAGCCTGGGCCCTGCTGGCAGG - Intergenic
1160282702 18:77507378-77507400 TGAGCCACTGCGCTGCAGCCTGG + Intergenic
1160691827 19:463861-463883 GCAGCCTGTGCCCCGCAGGCCGG + Exonic
1160851575 19:1195371-1195393 AGAGCTCCTGCCCTGCAGGCTGG + Intronic
1160851999 19:1197185-1197207 AGAGCTCCTGCCCTGCAGGCTGG + Intronic
1160856886 19:1221746-1221768 ACAGCCTGTGCGCGGCTGGCAGG - Intronic
1161345457 19:3766905-3766927 AGGACCTGTGGGCTGCAGGAAGG + Intronic
1161400329 19:4064446-4064468 AGGGCCTGAGGGCTTCAGGCCGG - Intronic
1161767089 19:6213915-6213937 TGAGCCTGGGGCCTGCAGGCAGG - Intronic
1162087409 19:8257013-8257035 AGAGCCAATGCGCAGCAGGTTGG - Exonic
1162709043 19:12578066-12578088 AGAGCTGGAGCGCTGCAGGGTGG + Exonic
1163365552 19:16874031-16874053 AGGGCCTGGGCTGTGCAGGCGGG + Intronic
1163747083 19:19055005-19055027 GGACCCTGTGCTCTGAAGGCCGG + Intronic
1164653681 19:29904227-29904249 TGAGGCTGTGCTCTGCAGGGTGG - Intergenic
1164757410 19:30700429-30700451 AGTGCCAGTGCACTGCAGCCTGG - Intronic
1165093930 19:33400523-33400545 AGCCCCTCTGCGCTGCAGGCTGG + Intronic
1166827850 19:45620662-45620684 TGAGCCACTGCGCTGCAGCCTGG + Intronic
1168226543 19:54999189-54999211 AGCGCCATTGCGCTCCAGGCTGG - Intronic
1168239720 19:55082946-55082968 AGAGTCTGTGCACTGCGGGCTGG + Intronic
929298289 2:40272542-40272564 AGAGCCTGTGCTCTGAGGACTGG + Intronic
929511252 2:42568082-42568104 AGAGCCTGCAGGCTCCAGGCCGG + Intronic
934494213 2:94783322-94783344 ACAGGCTGTGCAATGCAGGCAGG + Intergenic
934503032 2:94873889-94873911 GGACCCTCTGTGCTGCAGGCTGG - Intronic
935335367 2:102010530-102010552 CGAGCCACTGCGCTCCAGGCTGG + Intronic
936432354 2:112475340-112475362 ACAGCCTCTGTGGTGCAGGCTGG + Intergenic
936626794 2:114157181-114157203 AAGGCCAGTGGGCTGCAGGCAGG - Intergenic
938252665 2:129827694-129827716 AGAGGGTGCGCGGTGCAGGCAGG + Intergenic
939231440 2:139431609-139431631 AGAGCCATTGCACTGCAGCCTGG - Intergenic
939560026 2:143721016-143721038 AGAGCCACTGCGCTCCAGCCTGG + Intronic
940066230 2:149633067-149633089 TGTGCCACTGCGCTGCAGGCTGG + Intergenic
944525891 2:200619286-200619308 TGATCCTGTGAGCTGCAGGATGG + Intronic
945119373 2:206442921-206442943 AGAGCGTTTGCGCCGCAGGCTGG - Intergenic
945972580 2:216245071-216245093 TGAGCCAGTGCACTGCAGCCTGG - Intergenic
946372279 2:219288091-219288113 AGGGCCTGTGGTCTGCTGGCGGG + Intergenic
946922243 2:224591956-224591978 AGAGTCTGTGCACTGTAGGGAGG + Intergenic
948278227 2:236726280-236726302 AGAGCCTGAGCACACCAGGCTGG - Intergenic
948412519 2:237775105-237775127 AGAGCCTGTGCTCTGGAAGAGGG + Intronic
1168854899 20:1001752-1001774 AGTCCCTGTGCCCCGCAGGCTGG + Intronic
1169141361 20:3229007-3229029 AGTGCCCGTCTGCTGCAGGCTGG - Exonic
1170649287 20:18225243-18225265 AAAGCCTCTGAGCTGCAGGGTGG + Intergenic
1171023350 20:21607203-21607225 GGAGCCTGTGTCCTGCTGGCAGG + Intergenic
1171112328 20:22495471-22495493 TGGGCCTGTGCAGTGCAGGCAGG - Intergenic
1171780416 20:29411677-29411699 CTGGCCTCTGCGCTGCAGGCAGG + Intergenic
1172645428 20:36466167-36466189 AGAGCCTGTCGGCTGCAACCTGG + Intronic
1172679616 20:36702565-36702587 TGAGCCTTTGCACTGCAGCCTGG - Intronic
1173208390 20:41012768-41012790 AGAGGCTGTTGGCTGAAGGCTGG + Intergenic
1173817758 20:46000688-46000710 AGAGCCCCAGGGCTGCAGGCTGG - Intergenic
1173847617 20:46197992-46198014 TGAGTCTCTGAGCTGCAGGCGGG - Intronic
1174063977 20:47851696-47851718 AGTGCCTGTGGGCTGAAGCCAGG + Intergenic
1174540328 20:51284331-51284353 AGAGTCTGTCAGCTGCAGGAAGG - Intergenic
1175542673 20:59757536-59757558 AGAGCATGAGCTCTGCAGGCTGG + Intronic
1175809765 20:61851717-61851739 AGAGGCTGGGCGCTGCCGGCAGG - Intronic
1178491631 21:33056254-33056276 ACAGCCTTTGTGCAGCAGGCTGG + Intergenic
1178884704 21:36476065-36476087 AGAGCCTGCACTCAGCAGGCAGG - Intronic
1179272924 21:39865635-39865657 TCAGCCTGTGCTCTGCTGGCTGG - Intergenic
1179427851 21:41295917-41295939 ACAGGCTGTGCCCTGCAGGCTGG + Intergenic
1179680923 21:43020825-43020847 AGAGCCCATCCTCTGCAGGCAGG - Intronic
1180012390 21:45059377-45059399 AGAGCCTGTGCCCAGCGGGCAGG - Intergenic
1180486541 22:15805786-15805808 GCAGCCTGTGCTCTGCAGACAGG - Intergenic
1181081488 22:20418612-20418634 ATAGCCTCTGCGCTCCAGCCGGG + Intergenic
1181327766 22:22063918-22063940 AGAGCCAGTGCACTCCAGCCTGG - Intergenic
1181980001 22:26759610-26759632 AGAGCAGGTGCACTGCAGACAGG - Intergenic
1182249606 22:28989691-28989713 GGACTCTGTCCGCTGCAGGCGGG + Intronic
1183102807 22:35594223-35594245 GGAGCCTGAGTGCTGCGGGCAGG + Intergenic
1183746388 22:39694315-39694337 CCAGCCCGTGAGCTGCAGGCAGG - Intergenic
1183898611 22:40988868-40988890 AGAGCCAGTGCACTCCAGCCTGG - Intergenic
1184059522 22:42073791-42073813 AGAGCCTGGGGGCTGCCGGTGGG + Intergenic
1184820573 22:46906519-46906541 AGAGACTCTGCGCTGATGGCAGG + Intronic
1184842153 22:47058377-47058399 AGGGCCAGTGCTCTGCAGCCAGG + Intronic
1185080028 22:48704562-48704584 AGGGCCTGGGAGCTGCAGCCTGG + Intronic
1185122841 22:48982776-48982798 AGGGCCTGGGAGCTGGAGGCAGG + Intergenic
1185190385 22:49432702-49432724 AGAGTGTGTAGGCTGCAGGCTGG - Intronic
1185216236 22:49601395-49601417 AGGGCCCGAGCTCTGCAGGCAGG + Intronic
950541598 3:13616475-13616497 AGAGACTCAGCACTGCAGGCAGG - Intronic
951536763 3:23747094-23747116 TGAGCCTTTGCACTCCAGGCTGG - Intergenic
952821635 3:37491309-37491331 AGTGCCTGTGAGCTGCTGTCAGG + Intronic
954860888 3:53689463-53689485 AGAGCCTGGGGGCTGGGGGCTGG + Intronic
955510582 3:59676666-59676688 GCAGCCTGTGGGCTGCAGGTTGG + Intergenic
955635653 3:61026556-61026578 GCAGCCTGTGGGCTGCAGGTTGG - Intronic
957084665 3:75668834-75668856 CCGGCCTCTGCGCTGCAGGCAGG - Intergenic
957492938 3:80953260-80953282 GGAGCCAGTGCACTCCAGGCTGG - Intergenic
961387373 3:126530154-126530176 GGAGCCTGGGCCCTGCAGACGGG - Intronic
961505528 3:127368592-127368614 AGAGCCCATGCCCTGCAGGGAGG + Intergenic
962378239 3:134876332-134876354 AGAGGCTGAGCCCTACAGGCTGG - Intronic
962929314 3:140022537-140022559 GGAGACTGGGCGCTGCAGGAGGG + Intronic
964289137 3:155156152-155156174 AGAGCCTGTGCTGTGGAGTCAGG + Intronic
968001761 3:195211347-195211369 CGAGCCTCTGCACTCCAGGCTGG + Intronic
968359309 3:198136381-198136403 AGAGCAGGGGAGCTGCAGGCCGG - Intergenic
968427530 4:533591-533613 GCAGCCTGGGCACTGCAGGCAGG + Intronic
968447906 4:661749-661771 AGAATGTGTGGGCTGCAGGCTGG - Intronic
970018598 4:11540827-11540849 GCAGCCTGTGGGCTGCAGGTTGG + Intergenic
972528616 4:39940703-39940725 AGCGCCTCTGCGCTCCAGCCTGG - Intronic
976052231 4:81022832-81022854 AGAGCCTGTAGGCTGCACGTGGG + Intergenic
976158387 4:82172403-82172425 TGAGTCTGTGAGCTTCAGGCTGG - Intergenic
980797538 4:137703870-137703892 AGAGCCACTGCGCTCCAGCCTGG - Intergenic
982166923 4:152621857-152621879 TGAGCCACTGCACTGCAGGCTGG - Exonic
984443297 4:179800557-179800579 AGAGCCTTTGCACTCCAGCCTGG + Intergenic
984762719 4:183376725-183376747 AGAGCCACTGCGCTGGGGGCGGG - Intergenic
985531314 5:435317-435339 CCAGCCTGTGCTGTGCAGGCAGG + Exonic
985645241 5:1081855-1081877 ACAGCTTGTGCGCCGCAAGCAGG + Intronic
985678296 5:1243470-1243492 AGAGTGTGTGTCCTGCAGGCAGG + Intronic
985788104 5:1910489-1910511 GGAGCCTGTGCGTGGCTGGCTGG - Intergenic
988538152 5:32087246-32087268 TGACCCTGGGCGATGCAGGCTGG - Exonic
988564778 5:32312519-32312541 AGGGCCCGAGCGCTGGAGGCTGG - Intronic
989730472 5:44641855-44641877 AGAGCCTGAACCCTGGAGGCCGG - Intergenic
991704858 5:69348406-69348428 AGTGCCTCTGCACTCCAGGCTGG - Intergenic
993610814 5:90052108-90052130 AGAGCCCCTGGGCTGCATGCAGG - Intergenic
993729896 5:91410035-91410057 TGTGCCAGTGCGCTCCAGGCTGG + Intergenic
995128436 5:108603906-108603928 GCAGCCTGTGGGCTGCAGGTTGG + Intergenic
995487327 5:112652106-112652128 AGAGCATGTGACCTGGAGGCCGG - Intergenic
997218945 5:132141630-132141652 AGAGCCTGTCCGTTGAAGCCAGG - Intergenic
997520887 5:134524359-134524381 AGAGCCTGCGCTCGCCAGGCGGG - Intronic
997528792 5:134569822-134569844 AGAGCCAGAGGTCTGCAGGCTGG - Intronic
997988374 5:138523321-138523343 AGAGCCACTGCACTGCAGCCTGG + Intronic
999270170 5:150292119-150292141 ACAGCCAGTGGGCAGCAGGCAGG + Intergenic
1001684547 5:173583748-173583770 AGAACCTGGGAGCTGGAGGCTGG + Intergenic
1001768749 5:174276506-174276528 AGAGGCTGTGTACTGCAGGTTGG + Intergenic
1002335672 5:178476573-178476595 AAAGCGTGTGCGCTGGGGGCAGG + Intronic
1005712471 6:28515334-28515356 AGAGCCTGTCCCCTTCATGCTGG - Intronic
1006084406 6:31586291-31586313 AGAGCTTGTGGCCTGCAGGATGG - Intronic
1006501990 6:34465366-34465388 GGAGCCTGGACGCTGCAGGGAGG - Intergenic
1006857215 6:37142960-37142982 AGAGCCAGTGCACTCCAGCCTGG + Intergenic
1008126069 6:47670165-47670187 AAAACATGTGAGCTGCAGGCTGG - Intronic
1010043921 6:71419848-71419870 AGGGCCTGTGCGCGGCTGGGTGG - Intergenic
1010428136 6:75749052-75749074 AGAGGCTCTGCGCCGCGGGCGGG + Intergenic
1010749818 6:79605265-79605287 AGAGCAGATGGGCTGCAGGCTGG - Intergenic
1014517017 6:122392408-122392430 TGCGCCAGTGCACTGCAGGCTGG - Intergenic
1018230401 6:161669895-161669917 AGAGCCTGTGCGCTGCAGGCTGG - Intronic
1018756133 6:166851202-166851224 ACAGCCAGTCCTCTGCAGGCAGG + Intronic
1019136105 6:169908702-169908724 AGGGGCCGTGCTCTGCAGGCTGG + Intergenic
1019260685 7:80295-80317 AGAGCAGGGGAGCTGCAGGCCGG + Intergenic
1019384320 7:746226-746248 AGACCCTGGGCACGGCAGGCGGG - Intronic
1019384336 7:746278-746300 AGAGCCTGGGCCCAGCGGGCAGG - Intronic
1019384416 7:746548-746570 AGAGCCTGGGCACGGCGGGCGGG - Intronic
1019917024 7:4140178-4140200 GCAGCCTGTGAGGTGCAGGCTGG - Intronic
1020199422 7:6067896-6067918 AGAGCCACTGCACTGCAGCCTGG + Intergenic
1021080763 7:16361896-16361918 AGAGCCACTGCGCTCCAGCCTGG - Intronic
1022643226 7:32207212-32207234 AGAGCCTGTGCTGTGATGGCTGG - Intronic
1025268981 7:57491475-57491497 TGTGCCACTGCGCTGCAGGCTGG + Intergenic
1027420355 7:78012449-78012471 AGTGACTGTGGGCAGCAGGCAGG - Intergenic
1028259789 7:88648930-88648952 AGAGCCACTGCACTGCAGCCTGG - Intergenic
1029123973 7:98285013-98285035 AGAGCCTGCGTCCTGCAAGCGGG + Intronic
1029509104 7:100982161-100982183 AGAAGCTGTGCCCTGGAGGCTGG - Intronic
1030261712 7:107572052-107572074 AGAGCCTGTGCTTAGCAGGGAGG - Intronic
1035547246 8:492462-492484 GGAGCCTGCGCGCGGCAGGGAGG - Exonic
1035577351 8:716272-716294 GGAGGCTGTGCACTGCTGGCAGG + Intronic
1035643099 8:1198596-1198618 AGAGTGTGTGCTCTGCAGACTGG + Intergenic
1035874881 8:3177333-3177355 AGAGCCTCTGCACTGGGGGCTGG - Intronic
1038549388 8:28452755-28452777 GGTGCCTTTGCGCTCCAGGCTGG + Intronic
1040284265 8:46091965-46091987 ACAGCATGGGGGCTGCAGGCAGG + Intergenic
1040589233 8:48774160-48774182 AGAGCCACTGCGCTGCGGGAAGG + Intergenic
1041117475 8:54554276-54554298 AGAGGCTGTGAAATGCAGGCAGG + Intergenic
1041119412 8:54571134-54571156 ACAGTGTGTGTGCTGCAGGCAGG - Intergenic
1041712996 8:60910230-60910252 TGAGCCTGTGCTCTGCTGGCTGG + Intergenic
1043393043 8:79809646-79809668 AGAGCCACTGCACTGCAGCCTGG - Intergenic
1043706683 8:83358884-83358906 AGAGCCTCTGTGCTGGAGACAGG + Intergenic
1045033366 8:98158184-98158206 AGCCCCTCTGCGCTGCAGGCTGG - Exonic
1047934945 8:129767318-129767340 AGAGGCTGTGCTCTGCAGTTAGG - Intronic
1048439265 8:134447909-134447931 AGAGCCTCTGGGGTGCAGGAGGG + Intergenic
1048441007 8:134458869-134458891 AGAGCCTGTCCGGTGCATGAGGG - Intergenic
1048830212 8:138468998-138469020 ACAGCCAGTGCGCTCCAGCCTGG + Intronic
1049252237 8:141595478-141595500 AGGCCCCGTGCGCTGCAGACAGG - Intergenic
1049300738 8:141868075-141868097 AGGGCCTGTGAGAGGCAGGCTGG - Intergenic
1049475444 8:142795043-142795065 AGAGGCTGTGGGCTGCTGGGTGG + Intergenic
1051227073 9:14910465-14910487 TGTGCCTGTGTGCTGCAGGCGGG - Intronic
1054745073 9:68845594-68845616 GGAGCGTGGGAGCTGCAGGCAGG + Intronic
1056841540 9:90001909-90001931 AGGGCCTGTGCTCTGCTGCCTGG - Intergenic
1056993632 9:91434217-91434239 AGAGCCTGTGTTGTGCAGACTGG - Intergenic
1057745852 9:97750367-97750389 AGAGCCTTGGAGCTGGAGGCAGG - Intergenic
1058428844 9:104900207-104900229 AAAGCCTGTGTGCTGCCGCCAGG - Intronic
1059448761 9:114356873-114356895 AGAGCCGGTGCTCTGGAGTCTGG + Exonic
1060235298 9:121858553-121858575 AGCGCCAGTGCCCTGCAGGAAGG + Intronic
1060881617 9:127122029-127122051 AGAGCCTTTGGGGTGCCGGCCGG - Intronic
1060964663 9:127705906-127705928 GGTGCCTGTTCCCTGCAGGCAGG - Intronic
1061367214 9:130178316-130178338 AGAGCCTGTGAGGAGGAGGCTGG - Intronic
1061714498 9:132510229-132510251 AGAGCATGTGCGATGCAACCTGG - Intronic
1061843927 9:133376257-133376279 AGGGCCTGCGCGCGGCGGGCGGG - Intergenic
1062261327 9:135664630-135664652 TGAGCCTGTGCCCTGGAGGAGGG + Intronic
1062442571 9:136577565-136577587 GGAGCCTGGGCGCTGCTCGCTGG - Intergenic
1062572395 9:137191681-137191703 AGGGCATGTGGGCTGCGGGCAGG + Exonic
1062743997 9:138200095-138200117 AGAGCAGGGGAGCTGCAGGCCGG - Intergenic
1186544415 X:10434077-10434099 AGGGCTTGGGCTCTGCAGGCTGG + Intergenic
1187460303 X:19480774-19480796 GGAGCCTGTGCACTCCAGCCTGG + Intronic
1189151058 X:38707213-38707235 GCAGCCTGTGAGCTGCAGGTTGG + Intergenic
1192232831 X:69277874-69277896 AGAGCCTGCCTGCTGGAGGCAGG + Intergenic
1201137678 Y:11003137-11003159 TGGGCCTCTGCGCTCCAGGCTGG - Intergenic