ID: 1018230813

View in Genome Browser
Species Human (GRCh38)
Location 6:161673491-161673513
Sequence GGTGCCTGGCCAATGTGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 168}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018230813_1018230819 7 Left 1018230813 6:161673491-161673513 CCAGGGCACATTGGCCAGGCACC 0: 1
1: 0
2: 1
3: 13
4: 168
Right 1018230819 6:161673521-161673543 ACTACTTTGGCTTATTCCAAGGG No data
1018230813_1018230815 -6 Left 1018230813 6:161673491-161673513 CCAGGGCACATTGGCCAGGCACC 0: 1
1: 0
2: 1
3: 13
4: 168
Right 1018230815 6:161673508-161673530 GGCACCCATTTTAACTACTTTGG No data
1018230813_1018230821 24 Left 1018230813 6:161673491-161673513 CCAGGGCACATTGGCCAGGCACC 0: 1
1: 0
2: 1
3: 13
4: 168
Right 1018230821 6:161673538-161673560 CAAGGGAGCTGAGAAGCCATTGG 0: 1
1: 0
2: 3
3: 39
4: 289
1018230813_1018230818 6 Left 1018230813 6:161673491-161673513 CCAGGGCACATTGGCCAGGCACC 0: 1
1: 0
2: 1
3: 13
4: 168
Right 1018230818 6:161673520-161673542 AACTACTTTGGCTTATTCCAAGG 0: 1
1: 0
2: 0
3: 17
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018230813 Original CRISPR GGTGCCTGGCCAATGTGCCC TGG (reversed) Intronic
900277457 1:1840752-1840774 AGTGCCTGGCCCTGGTGCCCAGG + Intronic
900570831 1:3357466-3357488 GGGGCCTGGCCAGTGGCCCCAGG + Intronic
901237679 1:7676234-7676256 GGTGCCTGGGCAGGGAGCCCCGG - Intronic
902395869 1:16132328-16132350 GATGCCTGGCCATTGAGCCCGGG - Intronic
902765702 1:18613390-18613412 GATGCCTGGCCACAGAGCCCAGG + Intergenic
904674767 1:32192216-32192238 GGGGGCTGGGCAAAGTGCCCTGG + Intronic
904864718 1:33569399-33569421 AGTGCATGGCCAATGGGCTCTGG - Exonic
905823156 1:41009753-41009775 GGGACCTGGCCAATATGCCAGGG - Intronic
910488539 1:87742750-87742772 GGTGCTTGGCAACTGTGCTCGGG + Intergenic
915546616 1:156602514-156602536 GGTGTCTCGCCATTTTGCCCAGG - Intergenic
917081023 1:171257348-171257370 GGTGACTGTGCCATGTGCCCTGG + Intronic
918182557 1:182096971-182096993 GCTGCATGGCCATTTTGCCCTGG + Intergenic
919761355 1:201100055-201100077 CCTGCCTGGGGAATGTGCCCAGG - Intronic
920166754 1:204041528-204041550 GGTCCCTGGCCCAGGTCCCCAGG - Intergenic
922784161 1:228274877-228274899 GGTGCCTGTGCAAGGAGCCCTGG - Intronic
924289530 1:242524049-242524071 GGTGCCTGGCCGAGGCCCCCGGG + Intronic
924434039 1:244022961-244022983 GGTGCAGGGCCAAGGTGACCTGG + Intergenic
1062826313 10:571410-571432 GGAGCCTGGGAAATGAGCCCCGG - Intronic
1064228132 10:13505475-13505497 GGTGTCTGCCCCATGTGGCCTGG - Intronic
1069229831 10:65995861-65995883 GGTCCCTAGACAATGTGCCCAGG + Intronic
1069960430 10:72075893-72075915 GGTGCTTGCCCAAGGTGCACTGG - Intronic
1073023863 10:100471370-100471392 AGTGCCTAGAAAATGTGCCCAGG + Intronic
1075280243 10:121132712-121132734 TGTCCCTTGCCTATGTGCCCAGG + Intergenic
1075710877 10:124529997-124530019 GGTGCCTTGCCACAGGGCCCAGG + Intronic
1076460997 10:130647381-130647403 GGAGACCGGCCAATGTTCCCTGG - Intergenic
1080830713 11:35890998-35891020 GGTGTCTGGCTATGGTGCCCAGG + Intergenic
1082852780 11:57780244-57780266 GGTGTCTTGCCATTTTGCCCAGG + Intronic
1082984901 11:59160098-59160120 GCTGCTTGGACCATGTGCCCTGG + Intergenic
1084793997 11:71492019-71492041 GGTCCCTGGCCTGGGTGCCCAGG + Intronic
1085778901 11:79390753-79390775 GGCTCCAGGCCAATGTGTCCTGG + Intronic
1090467098 11:126944404-126944426 GAGGCCTGGACAAAGTGCCCTGG - Intronic
1091368978 11:135043124-135043146 GGGGCCTGGCAGATGTGCCCAGG - Intergenic
1091709368 12:2726909-2726931 GGTACGTGGTCCATGTGCCCTGG - Intergenic
1096699123 12:53370936-53370958 GGTGCCTGGGCAAAGGTCCCTGG - Intergenic
1097830151 12:64215865-64215887 GGTGACTGGCCGTGGTGCCCTGG - Exonic
1098104907 12:67059387-67059409 GGTGGCTGGGCGTTGTGCCCTGG - Intergenic
1100469175 12:94874401-94874423 GGTGTCTCGCCATTTTGCCCAGG + Intergenic
1103958426 12:124592600-124592622 GTTGCCTGGTCACTTTGCCCTGG - Intergenic
1104510697 12:129374981-129375003 GGTCCCTGAGAAATGTGCCCCGG - Intronic
1104649906 12:130524009-130524031 GGGGCCTGTCCAGTGTGGCCAGG - Intronic
1105439408 13:20402896-20402918 GCTGCCTGCCCCATGTGCCCTGG - Intergenic
1106325557 13:28685300-28685322 GGGGTCTGGCCACTGTGCACAGG - Intergenic
1108228654 13:48316936-48316958 CGTGCCCGCCCAAGGTGCCCTGG + Intronic
1108252627 13:48582240-48582262 GGTGGCTGGACAAAGTGCCCAGG + Intergenic
1113043076 13:106125424-106125446 GGTGCCCGGGCAGTGAGCCCTGG - Intergenic
1113444024 13:110351876-110351898 GTTTCCTGGCCAATGCGCCTGGG + Intronic
1113788153 13:113013815-113013837 GCTGCCAGGCCACTGTGCCTGGG - Intronic
1115545566 14:34462394-34462416 GCGGCCTGGCCAATGAGCGCGGG - Intronic
1118705144 14:68473223-68473245 GGAGCCTGGGCAAAGAGCCCTGG + Intronic
1121105707 14:91278126-91278148 GGGACCTGGCCACTTTGCCCCGG - Exonic
1121169711 14:91843341-91843363 AGTTCCAGACCAATGTGCCCAGG + Intronic
1121600207 14:95197819-95197841 GCGGCCAGGCCATTGTGCCCCGG + Intronic
1122255546 14:100473162-100473184 GGGCCCTGGGCTATGTGCCCTGG + Intronic
1122638134 14:103139697-103139719 CATGCCTGGCCACTCTGCCCTGG + Intergenic
1122799129 14:104221116-104221138 GGTGGCTGGCAAAGGAGCCCTGG - Intergenic
1127609194 15:60620786-60620808 GGTGCCCGGCAACTGTGCCTTGG - Intronic
1127977562 15:64009435-64009457 GGGGCCTGGCCAAGGAGCTCAGG - Intronic
1129029098 15:72605546-72605568 GATGCCAGGCCAAAGAGCCCAGG - Intergenic
1130847239 15:87758811-87758833 GGTACATGGGCAATGTACCCTGG + Intergenic
1132214179 15:100050538-100050560 GGTGGTTGGCCAAGATGCCCAGG + Intronic
1132864460 16:2086589-2086611 GGTGCCTGGCCAGTGGTCCTCGG - Intronic
1138404375 16:56777774-56777796 GGTTCTTGGCCAATGTACCGAGG - Intronic
1139941823 16:70611020-70611042 TGTGCCAGGCCACTGTGCTCCGG - Intronic
1141045886 16:80715839-80715861 AGTGCCTGGCCCTTGTGCCCTGG + Intronic
1142701459 17:1664463-1664485 GGTGCCTGTCCTATGTGTGCTGG - Intronic
1143701786 17:8665993-8666015 AGAGCCTGGCCTGTGTGCCCTGG - Intergenic
1144028644 17:11300764-11300786 GGTTCCTGGCCAGTATGCCGGGG - Intronic
1144754570 17:17671413-17671435 GCTCCCTGGGCAGTGTGCCCAGG - Intergenic
1145993383 17:29092321-29092343 GGTGAGGGGCCAAGGTGCCCGGG - Exonic
1146677257 17:34782039-34782061 GGTGCCTGGCCTGGGAGCCCTGG + Intergenic
1146915416 17:36675374-36675396 GTGCCCTGGCAAATGTGCCCTGG - Intergenic
1147386680 17:40086707-40086729 GGTGACTGGCCAATGTCATCGGG - Exonic
1147476422 17:40715798-40715820 AGTGCCTGGCTAATTTGCCCAGG + Intergenic
1147703360 17:42409744-42409766 GGTGCCTGGCCTGTGTGCCCAGG - Intronic
1148103944 17:45109386-45109408 CGTGCCTTCCCACTGTGCCCAGG + Exonic
1149869828 17:60171385-60171407 GCTGCCTGGCCTCTGTTCCCTGG - Intergenic
1149993801 17:61396758-61396780 GGTGGCAGACGAATGTGCCCAGG - Intergenic
1152121481 17:78421520-78421542 GCGGCCTGGCCACAGTGCCCTGG + Intronic
1152532481 17:80927158-80927180 GGTGGCTGGACACTGTGCCAGGG + Intronic
1152623873 17:81379595-81379617 GGTGCCTGGCAGATGTGGACGGG - Intergenic
1152748842 17:82053253-82053275 GGTGCCTGGCCCATGTTGCAGGG + Exonic
1157490372 18:48119701-48119723 GGTGCCTGGCAAATGTGTGTTGG + Intronic
1157601394 18:48895167-48895189 AGTGCCTGGCCAATTGGCCCTGG + Intergenic
1158547901 18:58411441-58411463 GGTGCCTGGCAAATGACTCCTGG + Intergenic
1160709087 19:542522-542544 GGTGCCTGCCCTGTGTGCCCAGG - Intergenic
1161428002 19:4215074-4215096 GCTTCCTGGCCTATGTGCCATGG - Intronic
1161772183 19:6236831-6236853 GGTGGCTGGCCAACCAGCCCAGG + Intronic
1163236455 19:16033050-16033072 GGGGCCTGGCCAGTGGGACCTGG + Intergenic
1164539922 19:29114637-29114659 GCTCCCTGGCCATTGTGACCTGG - Intergenic
1164593258 19:29517681-29517703 GGTGGCTCGCCTCTGTGCCCTGG - Intergenic
1164618062 19:29678391-29678413 TGGGCCTGGCCAGTGGGCCCGGG + Intergenic
1164859228 19:31549599-31549621 GGTGAATGGCAAAAGTGCCCAGG - Intergenic
1165092002 19:33392523-33392545 CGTGCCTGGCCAGAGTGTCCTGG - Intronic
1167465246 19:49647196-49647218 GGTGCCTGGGCCTTGAGCCCTGG + Intronic
926141396 2:10370618-10370640 GGAGTCTGCCCTATGTGCCCTGG - Intronic
927200570 2:20575689-20575711 CGGGCCTGGCCCATGTGCCTGGG + Intronic
927554734 2:24023682-24023704 GCTGTCTGGCGCATGTGCCCTGG + Exonic
929115871 2:38443567-38443589 GGTGCCTGGCCATTGAGGCTTGG - Intergenic
934571914 2:95377941-95377963 GGTGCCTGCCCAGGGTCCCCAGG + Intronic
937120461 2:119437094-119437116 TGGGCCAGGCCCATGTGCCCGGG + Exonic
944405908 2:199383357-199383379 GGTGGCTGTCCAGTGGGCCCTGG - Intronic
946338773 2:219055551-219055573 CGTGGCTGGCAAATGTGGCCCGG + Exonic
947627574 2:231629908-231629930 CGTGCCTGGCCCCTGGGCCCAGG - Intergenic
948826677 2:240576465-240576487 GCTGCCTGAGCAATCTGCCCAGG - Intronic
1170156972 20:13277877-13277899 GTTGCCCAGCCAATGGGCCCGGG - Intronic
1171484806 20:25478986-25479008 GGTGCCAGGCCCATCTGCTCAGG + Exonic
1172877356 20:38173411-38173433 GGTGCCTGGCCAAGCTCCCATGG + Intergenic
1173660159 20:44727538-44727560 GGAGGCTGGCCAAGGTGTCCAGG + Exonic
1174193659 20:48757780-48757802 GGTGCCAAGGAAATGTGCCCAGG - Intronic
1174516940 20:51099980-51100002 GGTCCCTGGCCACTGGGCCCTGG + Intergenic
1175645790 20:60670359-60670381 GGTGCTAGGCCACTGAGCCCAGG + Intergenic
1175761969 20:61567417-61567439 GGTGCCTGCTCATTGTGTCCTGG + Intronic
1175776409 20:61656505-61656527 GGTGCATGGCCAGTGTGGTCAGG + Intronic
1175916734 20:62429507-62429529 GGTCCCTGGCCAATGAGCCAGGG - Intergenic
1175925340 20:62468634-62468656 GGGGCCAGGCCAATGAGGCCGGG + Intronic
1178937548 21:36876096-36876118 GGGGTCTGGCCACTGTGCACAGG - Intronic
1179337893 21:40474914-40474936 GGTCTCTGGCCTAGGTGCCCAGG - Intronic
1179910106 21:44442973-44442995 GCTGCCTGGCCACTGAGCACTGG + Exonic
1180752045 22:18131255-18131277 GGTGCCTGGCCCCAGTACCCAGG + Exonic
1180979730 22:19872856-19872878 AGTGCCTGGGCACTGGGCCCTGG - Intergenic
1181119121 22:20653736-20653758 GGTTCATGGCTAAGGTGCCCAGG - Intergenic
1181127843 22:20712344-20712366 CGTGCCCGGCCCAGGTGCCCTGG + Intronic
1181949594 22:26544487-26544509 GGTGCCTGGGCAAACTCCCCTGG - Intronic
1183431100 22:37766179-37766201 AGGGTCTGGCCCATGTGCCCAGG - Intronic
1185337449 22:50276928-50276950 GATGCCTGGCCAAGGGGGCCAGG + Intronic
949788865 3:7771086-7771108 GGTGCTTGGCCCATGTTCTCTGG - Intergenic
952951876 3:38532328-38532350 GGTGCCCGGGGAAAGTGCCCTGG - Intronic
954628571 3:52036087-52036109 GGTGCTAGGCCACTCTGCCCTGG - Intergenic
966735156 3:183181729-183181751 GGTCCATGGCCTCTGTGCCCCGG + Intronic
966767937 3:183479155-183479177 GGTCCATGGCCTCTGTGCCCTGG - Intergenic
967540005 3:190656328-190656350 GGTGCTTGGACATTGTGCCTGGG - Exonic
969570711 4:8006635-8006657 TGAGCCAGGCCAATGTTCCCTGG + Intronic
981538570 4:145825150-145825172 GGGGCCTGGCCAGGGAGCCCAGG + Intronic
985476421 5:81861-81883 GGTGCCTGGTCACAGAGCCCAGG + Intergenic
991328915 5:65470113-65470135 GGTGCCTCGCCATGCTGCCCAGG + Intronic
992749573 5:79849801-79849823 GAACCCTGGCCACTGTGCCCTGG + Intergenic
992997375 5:82346714-82346736 GGAGCCTGGCCTCTCTGCCCTGG + Intronic
1001074663 5:168616717-168616739 GAACCCTGGCCAAAGTGCCCTGG - Intergenic
1001560523 5:172666024-172666046 AGTGCCTGGCAAGTCTGCCCAGG + Intronic
1002603383 5:180368091-180368113 GGTGCCTCCCCCATCTGCCCAGG + Intergenic
1002889090 6:1317880-1317902 GCTGCGTGGCCAAAGGGCCCTGG + Intergenic
1004667335 6:17760787-17760809 GGTGCTTGCCCAAGGTGACCAGG + Intronic
1005332002 6:24759899-24759921 AGCGCCTGGCCAAGGTGGCCTGG - Intergenic
1006164411 6:32056205-32056227 GGTGCCTGGGGGATGTGCTCAGG + Intronic
1006732446 6:36246391-36246413 GTTGCCTGGCCATGTTGCCCAGG + Intronic
1007684170 6:43655511-43655533 GGTGCCTGGGCACAGTGCCCTGG + Intronic
1007715338 6:43852322-43852344 GGTGCCTGGCCAAAGTCACAAGG + Intergenic
1007789923 6:44303026-44303048 GCTGCCTGGCCCAGGGGCCCCGG - Intronic
1011802143 6:91029335-91029357 GGCTCTTTGCCAATGTGCCCAGG - Intergenic
1018230813 6:161673491-161673513 GGTGCCTGGCCAATGTGCCCTGG - Intronic
1019299937 7:297814-297836 CGTGCCTGGCCAGTGTGCGGAGG + Intergenic
1020254918 7:6497678-6497700 GGTCCGGGGCCACTGTGCCCCGG - Intronic
1020275327 7:6620915-6620937 GGTGGCTTGGAAATGTGCCCAGG - Intronic
1022738631 7:33100079-33100101 GCTCCCTGGCCAAGGTGCCAGGG - Intronic
1024963827 7:55004680-55004702 GGCGCCTGGCCAGCCTGCCCGGG - Intergenic
1026257757 7:68727204-68727226 GGTGCCTGCCCAGTGCCCCCAGG + Intergenic
1027185046 7:75965987-75966009 GGTGCTGGGCCACTGGGCCCTGG + Intronic
1027518325 7:79170239-79170261 GGTGCCTGGGAAAATTGCCCAGG - Intronic
1029226777 7:99034202-99034224 GGGCCCTGGCCACTCTGCCCGGG + Intronic
1030440088 7:109578728-109578750 GGGGTCTTGCCATTGTGCCCAGG - Intergenic
1034561563 7:151883071-151883093 GGTGGCTGGCACAGGTGCCCGGG - Intergenic
1035347801 7:158217153-158217175 GGTTGCTGGCAAAAGTGCCCTGG - Intronic
1035434583 7:158849973-158849995 GGGGCCTGGCCCTTTTGCCCAGG + Intergenic
1035861159 8:3029350-3029372 GGTGCCAGGCCAATGGGACGTGG - Exonic
1041471322 8:58212355-58212377 GGTGTCTGGACAGTGTGCTCAGG - Intergenic
1043751660 8:83943610-83943632 GGTCCCTGGACAGTGTGCTCAGG + Intergenic
1044882271 8:96735778-96735800 GGTGCCTGCCCAATTAGCCAGGG + Intronic
1046431636 8:114135382-114135404 GCTCCCTGAACAATGTGCCCTGG + Intergenic
1048334039 8:133490048-133490070 GATGCCTGGCGAAAGTCCCCAGG + Intronic
1051257603 9:15231202-15231224 GGTGCCTTGCCATCTTGCCCAGG + Intronic
1052020894 9:23524231-23524253 GGTGCATGGCCAGTGTGCTTGGG + Intergenic
1056783919 9:89574534-89574556 GCTGCCTTCTCAATGTGCCCAGG + Intergenic
1058965332 9:110032365-110032387 GATGTCTGGCCAAGTTGCCCAGG - Intronic
1059764647 9:117372208-117372230 GGTGCAGGGCTAATGTGCCAAGG - Intronic
1060596454 9:124851971-124851993 AGTGGCTAGACAATGTGCCCAGG + Intergenic
1062102257 9:134734393-134734415 GGGGCCTGGCCAAAGGCCCCAGG - Intronic
1062461053 9:136662734-136662756 GGGGCCTGGACAAACTGCCCAGG - Intronic
1062516641 9:136940188-136940210 GATGCCTGGCACATGTGCCGGGG - Intronic
1187857615 X:23652284-23652306 GGAGTCTGGCAAATGTGTCCAGG - Intergenic
1189292195 X:39894480-39894502 GGTGCCTGGCCACTTTGCTCAGG - Intergenic
1199561784 X:149171323-149171345 GTTGTCTGCCAAATGTGCCCTGG - Intergenic
1199941929 X:152636284-152636306 GGTGGCTGGACAAAATGCCCCGG + Intergenic
1200226576 X:154420843-154420865 GAAGCTTGGCCAAGGTGCCCTGG - Intronic