ID: 1018231534

View in Genome Browser
Species Human (GRCh38)
Location 6:161680414-161680436
Sequence CTCAGAACTCGGCCATTCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 73}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018231534_1018231541 18 Left 1018231534 6:161680414-161680436 CCTGTGAATGGCCGAGTTCTGAG 0: 1
1: 0
2: 1
3: 12
4: 73
Right 1018231541 6:161680455-161680477 TTTGAGTAGTGGCCTAAATGAGG 0: 1
1: 0
2: 0
3: 8
4: 128
1018231534_1018231542 19 Left 1018231534 6:161680414-161680436 CCTGTGAATGGCCGAGTTCTGAG 0: 1
1: 0
2: 1
3: 12
4: 73
Right 1018231542 6:161680456-161680478 TTGAGTAGTGGCCTAAATGAGGG No data
1018231534_1018231539 7 Left 1018231534 6:161680414-161680436 CCTGTGAATGGCCGAGTTCTGAG 0: 1
1: 0
2: 1
3: 12
4: 73
Right 1018231539 6:161680444-161680466 TCGAGCGTCCATTTGAGTAGTGG 0: 1
1: 0
2: 0
3: 1
4: 30
1018231534_1018231543 20 Left 1018231534 6:161680414-161680436 CCTGTGAATGGCCGAGTTCTGAG 0: 1
1: 0
2: 1
3: 12
4: 73
Right 1018231543 6:161680457-161680479 TGAGTAGTGGCCTAAATGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018231534 Original CRISPR CTCAGAACTCGGCCATTCAC AGG (reversed) Intronic
901435778 1:9246579-9246601 CTCAGAACTGGGCCAGTCCTGGG + Intronic
904251367 1:29226873-29226895 CTCAGAACTTTGCCATTCTCTGG - Intronic
905645690 1:39623721-39623743 TGCAGAACTCAGCCATGCACAGG + Intergenic
905724551 1:40239568-40239590 CACAGAACACAGCCATTCCCCGG + Exonic
915493591 1:156265821-156265843 CTCATACCTCGGCCAGCCACAGG - Exonic
920034586 1:203057764-203057786 CTCAGAACTCGGCTATGGAATGG + Intronic
920219143 1:204383497-204383519 CTCAGAATTCTGCCATCCTCTGG - Intergenic
1062858613 10:792514-792536 CTCAGGACTGGGCCATCCACGGG + Intergenic
1065874762 10:29987585-29987607 CTCAGAATACGGCCTTGCACAGG + Intergenic
1069039994 10:63685412-63685434 CTCAGAACTCGCTCATTCCCTGG + Intergenic
1085450047 11:76626410-76626432 CTCAGTACACAGCCACTCACTGG - Intergenic
1087603329 11:100343520-100343542 CTCAGAACGCGGGTTTTCACAGG + Intronic
1089861121 11:121590862-121590884 CTCAGAGCTGTGCCAGTCACTGG + Intronic
1092731564 12:11539797-11539819 CTCAGAACACAGCCATTCATGGG + Intergenic
1100176384 12:92035598-92035620 CTCAAAACTCTGCTTTTCACAGG - Intronic
1104468052 12:129005912-129005934 CTCAGAGCCCGGCCTTTCTCAGG + Intergenic
1109929778 13:69199892-69199914 CTGATTACTCTGCCATTCACTGG - Intergenic
1112395583 13:99027813-99027835 CTCAGAACTGGCACATTCAGTGG - Intronic
1114179840 14:20356875-20356897 CTCAGAAGGCGGAAATTCACAGG + Intronic
1125502278 15:40247147-40247169 CTCAGACCTGGGGCAGTCACTGG + Intronic
1127973460 15:63979977-63979999 CTCAGAACCTGGCCATACATGGG + Intronic
1128107555 15:65055774-65055796 CTGAGAACTCTGCCAACCACAGG - Intronic
1129528172 15:76236575-76236597 CTCAGAACAAGACCATTTACAGG + Intronic
1131785710 15:95909096-95909118 TTCAGAACTCTGCCATTCACTGG + Intergenic
1133649049 16:7792403-7792425 CTCACCACTCAGCCAGTCACTGG + Intergenic
1140032289 16:71348438-71348460 CTCAGACCTGGACCATTCTCCGG - Intergenic
1142419788 16:89963235-89963257 CTCAGATCTCGGCCCTTCGTGGG + Intronic
1147782905 17:42956429-42956451 CTCAGTTCTCGGACATTCACAGG + Exonic
1154018256 18:10638862-10638884 CCCAGAACACGGCCATCCACAGG + Intergenic
1154186616 18:12190720-12190742 CCCAGAACACGGCCATCCACAGG - Intergenic
1163091062 19:15020851-15020873 CTGAGGACTCAGTCATTCACAGG + Intronic
1167133708 19:47604240-47604262 CTCAGAACTAGGGGACTCACTGG - Intergenic
1167350308 19:48970018-48970040 CTCAGAAACTGTCCATTCACAGG - Intronic
926072467 2:9909318-9909340 CTCAGAAGAGGGCCAGTCACAGG + Intronic
932795696 2:74693594-74693616 TTCAGCACTAGGACATTCACAGG - Intergenic
934981759 2:98849058-98849080 CTCAGGGCTCTGCCCTTCACTGG - Intronic
935984846 2:108662471-108662493 CCCAGAACTAGGCTATTCATGGG + Intronic
936102207 2:109592111-109592133 CCCTAAACTCTGCCATTCACAGG + Intronic
936137283 2:109906122-109906144 CCCAGAACTAGGCTATTCATGGG + Intergenic
936207414 2:110465363-110465385 CCCAGAACTAGGCTATTCATGGG - Exonic
940373521 2:152927772-152927794 CTCAGAACACTGGAATTCACTGG - Intergenic
941250005 2:163149447-163149469 CACAGTACTAAGCCATTCACAGG + Intergenic
944715868 2:202376048-202376070 CCCAGCCCTCGGCCATTCACCGG + Intergenic
945837486 2:214849955-214849977 CTCAGAACTGTGCCATTAAGAGG - Intergenic
1169341434 20:4799466-4799488 CTCTGAACCCAGCCATTCAGTGG + Intronic
1170359116 20:15525095-15525117 CTCAGCATTCGGCCATTTCCAGG + Intronic
1170780593 20:19422199-19422221 CTCTGAGCTCTGCCATTTACTGG - Intronic
1171375947 20:24694227-24694249 GCCAGAACTCGGCCATTCCCTGG + Intergenic
1172224819 20:33298370-33298392 ATCAGAACTCTGCCATGCTCAGG + Intronic
1176000710 20:62830158-62830180 CTCAGAACTCAGGCATACCCTGG - Intronic
1176364107 21:6022272-6022294 CTCAGGACATGGCCATTCAGAGG + Intergenic
1179759411 21:43516273-43516295 CTCAGGACATGGCCATTCAGAGG - Intergenic
1181027720 22:20135415-20135437 CCCAGCCCTCGGACATTCACAGG - Intronic
1183169413 22:36175201-36175223 TTCAGCCCTTGGCCATTCACAGG + Intergenic
1184933602 22:47701394-47701416 CTCAGGACTAGGACATTCAAAGG - Intergenic
950851815 3:16069484-16069506 TTCAGAGATGGGCCATTCACAGG + Intergenic
953672683 3:44976073-44976095 CTCTGGACTCGGCCAGACACCGG + Exonic
956235999 3:67071625-67071647 CTGAGAACTCTGCCATTTGCAGG - Intergenic
958850849 3:99323605-99323627 CTTAGAATTCTGCCAATCACAGG + Intergenic
959125241 3:102283184-102283206 CACAGCACTCCTCCATTCACAGG + Intronic
962249560 3:133827470-133827492 CTCAGGACTAAGCCATTCTCAGG + Exonic
965414182 3:168371833-168371855 TTCAGAACTAGGCCATGCACTGG + Intergenic
968267110 3:197370784-197370806 CACAGTACTGGACCATTCACTGG - Intergenic
968813804 4:2811572-2811594 CTCAGAATTCGGCCCCTCCCAGG - Intronic
976104491 4:81602259-81602281 GTCACAAGTCTGCCATTCACGGG - Intronic
976597298 4:86906138-86906160 TTCAGAACTCAGCCATTTCCCGG + Intronic
980112928 4:128652005-128652027 CTCAGAACTAGTCCACACACTGG - Intergenic
985915146 5:2912383-2912405 TTCAGAGCTCGTCCATCCACAGG + Intergenic
987582903 5:19819784-19819806 CTCCCAACCTGGCCATTCACAGG - Intronic
989000729 5:36757557-36757579 CTTAGAATTCTGCCAATCACAGG - Intergenic
991031394 5:62085700-62085722 GTCAGAACTCAGCTATTCAAAGG + Intergenic
1018231534 6:161680414-161680436 CTCAGAACTCGGCCATTCACAGG - Intronic
1025730930 7:64106761-64106783 CTCAGCCCTTGGCCATTAACAGG - Intronic
1026402543 7:70029554-70029576 CTCAGAACACGAACATTCATGGG - Intronic
1033564591 7:142566207-142566229 CTCCCAACTCTGCCATTCATAGG - Intergenic
1034995848 7:155577012-155577034 TACAAAACTCCGCCATTCACCGG + Intergenic
1035163890 7:156972215-156972237 CTCAAATGTGGGCCATTCACAGG - Exonic
1038979026 8:32736325-32736347 CCCAGAACTCGCCCACTCACTGG - Intronic
1039488936 8:37933090-37933112 TGCAGAACTGAGCCATTCACGGG + Intergenic
1044220834 8:89667723-89667745 CTCAGATCACAGCCAGTCACAGG - Intergenic
1047289230 8:123514657-123514679 TGCAGAACTCAGCCATTCACAGG - Intronic
1060359480 9:122941229-122941251 CTCAGAACTCGGCCCGTCGAGGG - Intronic
1062035473 9:134380762-134380784 CTCAGACCTCGGCCAGACCCAGG - Intronic
1185534297 X:848500-848522 CTCAGAGCTCGGCTGTTCCCAGG - Intergenic
1195437585 X:104863215-104863237 CTCAGACCACTGCCATCCACTGG + Intronic
1199428535 X:147731993-147732015 TTCAGAACTCTGTCATTAACTGG - Intergenic
1201934937 Y:19400002-19400024 CTCAGAACTAGAGTATTCACAGG + Intergenic