ID: 1018235395

View in Genome Browser
Species Human (GRCh38)
Location 6:161718609-161718631
Sequence GCCACTGGGCTGTTTCTCTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 206}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018235395_1018235401 -2 Left 1018235395 6:161718609-161718631 CCCGAGAGAAACAGCCCAGTGGC 0: 1
1: 0
2: 1
3: 19
4: 206
Right 1018235401 6:161718630-161718652 GCCTCGGGACTATCCCTAGCAGG 0: 1
1: 0
2: 1
3: 2
4: 26
1018235395_1018235405 13 Left 1018235395 6:161718609-161718631 CCCGAGAGAAACAGCCCAGTGGC 0: 1
1: 0
2: 1
3: 19
4: 206
Right 1018235405 6:161718645-161718667 CTAGCAGGCACCTGCCAGTAAGG 0: 1
1: 0
2: 8
3: 243
4: 2491

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018235395 Original CRISPR GCCACTGGGCTGTTTCTCTC GGG (reversed) Intronic
900339001 1:2178985-2179007 GCCACTGGGGTGTGACTCTGGGG + Intronic
900472313 1:2860995-2861017 GCCTCTGTGCTGCTTCCCTCTGG + Intergenic
900683342 1:3931178-3931200 GCCACTGGGCTGTTGGGTTCTGG + Intergenic
901913335 1:12478690-12478712 GGCACGGTGATGTTTCTCTCTGG + Intronic
902542138 1:17163038-17163060 GCCGCTGGGCAGTTACTCACAGG - Intergenic
906145469 1:43557931-43557953 CCCTCTGGGCTGCTTCCCTCTGG - Intronic
906438489 1:45818373-45818395 GCCACTGAGCTGGTTGTCACAGG + Intronic
907706164 1:56834604-56834626 GCAAATGGGCTTTTTCTCTAGGG - Intergenic
908120984 1:60985744-60985766 TCCACTGGCCTGTATCTCCCGGG + Intronic
911875712 1:103160539-103160561 TCCAGTGTTCTGTTTCTCTCTGG - Intergenic
912499219 1:110110849-110110871 GCCAGTGGGCTGATTTTGTCAGG - Intergenic
913165607 1:116181839-116181861 GTCACTTGGCTTTTTCTTTCTGG + Intergenic
917747241 1:178022362-178022384 GCTACTGGGCAGTTTATCTCTGG - Intergenic
918454618 1:184696021-184696043 GCAACTGGGGGGATTCTCTCTGG + Intronic
920079496 1:203362017-203362039 GCCACTGGGCTCTTTTGCCCTGG - Intergenic
920866692 1:209759263-209759285 AGGACTGGGCTGTGTCTCTCAGG - Intronic
922983385 1:229847668-229847690 GTCACTGCTCTGTTTCTTTCTGG + Intergenic
923986049 1:239383812-239383834 GCCACTGCACTGTATCTGTCAGG + Intergenic
1062862896 10:823869-823891 GGCACTGGCCTGTGTCTCACAGG - Intronic
1062924980 10:1309511-1309533 ACCACTGGGATGTTTGTTTCTGG + Intronic
1064330488 10:14389575-14389597 GCCACTGAGCTGGTTGTCACTGG - Intronic
1064741974 10:18443258-18443280 GACACTAGGGTGTTTCTCACTGG - Intronic
1065087203 10:22190630-22190652 GCCAGTGGGATGTTTGTGTCTGG + Intergenic
1065722079 10:28636744-28636766 GCTACTGGGCTGTTCCGGTCAGG + Intergenic
1070588201 10:77781897-77781919 GCCACTCGGGTGTTTATGTCGGG - Intergenic
1070975129 10:80600373-80600395 GACACTGAGCTTTTTCTGTCTGG + Intronic
1071115452 10:82213958-82213980 GGCACTGGGCTCTTTCTCTTTGG + Intronic
1072007201 10:91263832-91263854 GCCACAGGTCTGTGTCTCTTAGG - Intronic
1072102293 10:92240190-92240212 GGCACTGCGCTGTTTTCCTCCGG + Exonic
1072526173 10:96273496-96273518 GCCTCTGGTCTTTTTCTCTGGGG - Intergenic
1075394181 10:122114554-122114576 CCCACGGGGCTCTTTCTCACAGG + Intronic
1077265342 11:1645760-1645782 GCCACTGGCCTGCTTTTCACTGG + Intergenic
1079870718 11:25794686-25794708 GCCAGAGGGCTGCCTCTCTCAGG - Intergenic
1080145956 11:28984231-28984253 CCCAGTGGTCTGTTTCTCCCTGG - Intergenic
1080473025 11:32564540-32564562 TCCACAAGGCTGTTTCTTTCTGG + Intergenic
1080895638 11:36447042-36447064 GCCACTGGGCAGTCTCTTACTGG - Intronic
1081767807 11:45624106-45624128 TCCACTGGCCTGTTTTTCTAGGG - Intergenic
1083826292 11:65205770-65205792 GCCACTGGGTTGCTCCCCTCTGG - Intronic
1087051627 11:93891490-93891512 GCCAGTGGGCTGTTTTTGTATGG + Intergenic
1088356231 11:108946621-108946643 GCCACTGAGCTGGTTGTCACCGG + Intergenic
1090471307 11:126983690-126983712 GCTGCAGGGCTGTTTCTTTCTGG - Intronic
1091004870 11:131943544-131943566 CCCACTGGTCTCTTTCACTCTGG - Intronic
1091046606 11:132331033-132331055 GCCACTGGGCTGCTTCCCGCAGG - Intronic
1091308647 11:134557505-134557527 GCCAAAGGCCTGTGTCTCTCTGG - Intergenic
1091763432 12:3102871-3102893 GACACTGGGATGTCCCTCTCTGG - Intronic
1091855117 12:3733135-3733157 GCCATTGGGCTGTTTGTCAAGGG - Exonic
1092206007 12:6614386-6614408 GCGACTGGCCTGTTGCCCTCTGG - Intergenic
1093201439 12:16191686-16191708 GACACTGGTCTTTCTCTCTCAGG + Intronic
1096585327 12:52616087-52616109 GGCACTGGGATGTTTGCCTCTGG - Intronic
1097114579 12:56688085-56688107 GCGACTCCGCTTTTTCTCTCCGG + Exonic
1097596878 12:61644108-61644130 GCAACTGCTCTGTTGCTCTCAGG + Intergenic
1105503689 13:20992435-20992457 GCCACTGGGCTGCATCTCTTCGG - Intronic
1105541884 13:21322905-21322927 TCCAGTGGGCTGTGACTCTCTGG - Intergenic
1108066115 13:46579005-46579027 AACATTGGGCTGTTTCTCCCTGG + Intronic
1108753749 13:53475453-53475475 GCTTCTGGCCTGTTTCTCTTCGG + Intergenic
1109157745 13:58931970-58931992 TACACTGTGCTGTTTTTCTCAGG - Intergenic
1112640376 13:101267404-101267426 GCCACTGGGTTTTTTCACACAGG - Intronic
1113616955 13:111686950-111686972 GACACTGTGCTATTTCTTTCAGG - Intergenic
1113622485 13:111772221-111772243 GACACTGTGCTATTTCTTTCAGG - Intergenic
1114255613 14:20999158-20999180 GCCACTGGGCTGTGCCTGGCAGG + Intergenic
1114947115 14:27697079-27697101 GCCACTTGGCTTTCTCTGTCAGG - Intergenic
1119489301 14:75016972-75016994 GACACTGGGCTGATTCAGTCAGG + Exonic
1119958005 14:78821714-78821736 GCCACTGGGCCGGTTATCTCTGG + Intronic
1120761599 14:88290329-88290351 TCCACAGGGCTGTTTCCTTCTGG - Intronic
1121488594 14:94341617-94341639 TCTACTGGGCTTTTTCTATCAGG - Intergenic
1122534858 14:102455043-102455065 TTCACTGGGAGGTTTCTCTCGGG + Intronic
1122890020 14:104727892-104727914 GGCACTGGGCTGTTTATGTCTGG + Intronic
1124253652 15:28123640-28123662 GCGATTGGGCTGTTTCTCTCAGG - Intronic
1124338298 15:28873563-28873585 TGCACTGGGATGTTTATCTCTGG - Intergenic
1125575915 15:40755326-40755348 GCCCCTTGTCTGTTTCCCTCAGG + Exonic
1126628610 15:50710874-50710896 TCCAATGGGCTATTTTTCTCTGG - Intronic
1126709870 15:51443652-51443674 GCCAGTGGACTTATTCTCTCAGG - Intergenic
1127865835 15:63031977-63031999 GTGACTGGGCTGTCACTCTCAGG + Intergenic
1129890613 15:79069355-79069377 GCCACACTGCTGTATCTCTCAGG + Intronic
1130261323 15:82355876-82355898 GCCTCTCCGCTGTTTCTCGCGGG + Intergenic
1130279912 15:82513142-82513164 GCCTCTCCGCTGTTTCTCGCGGG - Intergenic
1130429655 15:83833771-83833793 ACATCTGGGCAGTTTCTCTCTGG - Intronic
1130471287 15:84229328-84229350 GCCTCTCCGCTGTTTCTCGCGGG - Intergenic
1130478781 15:84343899-84343921 GCCTCTCCGCTGTTTCTCGCGGG - Intergenic
1130492989 15:84444232-84444254 GCCTCTCCGCTGTTTCTCGCGGG + Intergenic
1130593582 15:85233955-85233977 GCCTCTCCGCTGTTTCTCGCGGG - Intergenic
1131588445 15:93721399-93721421 CCCACTGGGCTCTTCCCCTCTGG + Intergenic
1131909394 15:97180273-97180295 TACACTGTGCTGTTACTCTCAGG + Intergenic
1133631808 16:7629148-7629170 GGCCCTGGGCTGCTTCTCCCTGG + Intronic
1134022385 16:10930038-10930060 CCCACTTGGCTCTTTCTCCCAGG + Exonic
1136408983 16:30065620-30065642 GCCTCTGGGCTGCGCCTCTCGGG + Intronic
1139318333 16:66092371-66092393 GCAACTGGGCTCATTCTCACTGG - Intergenic
1139340274 16:66263877-66263899 GCCCCTGGTCTCTTCCTCTCTGG - Intergenic
1139461805 16:67128533-67128555 TCCACAGGGCTGTCTCTCTTAGG - Intronic
1140342678 16:74180554-74180576 TCCACTGGGCTGGTTATTTCTGG - Intergenic
1144088223 17:11829988-11830010 CCCACAGGCCTGTTTCCCTCTGG + Intronic
1148809044 17:50278886-50278908 TCCACTGGGCTGTCTGGCTCCGG - Exonic
1150229847 17:63543952-63543974 GCCACTGGGCTGCAGCTCCCTGG + Intronic
1150639357 17:66939210-66939232 GCCACTGGGGTGAGTCTCACTGG - Intergenic
1151995050 17:77603163-77603185 GGCTCTGGGCTCTTTCTCCCCGG - Intergenic
1152035570 17:77870184-77870206 GCCCCTGGGCTGGGTTTCTCAGG + Intergenic
1152892635 17:82891131-82891153 GCGACTGGGCTGCTCCTCCCAGG - Intronic
1153930753 18:9876964-9876986 CCCAAAGGGCTGCTTCTCTCTGG + Intergenic
1155278053 18:24208969-24208991 GCCACTGCCCTGGTGCTCTCTGG - Intronic
1157559697 18:48637639-48637661 GCCACTGACCAGCTTCTCTCGGG - Intronic
1157878290 18:51294202-51294224 GCCTCTCTGCTGTTCCTCTCTGG - Intergenic
1158914340 18:62106454-62106476 GCCACTGGGCTGTGCTGCTCTGG + Intronic
1159756528 18:72372200-72372222 GCATCTGGGCTGTGTTTCTCAGG - Intergenic
1160562274 18:79766120-79766142 ACCACAGGGATGTTTATCTCTGG - Intergenic
1161361844 19:3854581-3854603 GCCTCTGAGTGGTTTCTCTCTGG - Intronic
1162557143 19:11394294-11394316 GCCACTGTGCTGTGTATCCCAGG - Intronic
1162779555 19:12999864-12999886 GGCACTTGGCATTTTCTCTCCGG + Intronic
1163465889 19:17468593-17468615 GCCACTGGCCTGCTGCTTTCTGG - Intergenic
1164021566 19:21311877-21311899 GCCATAGGGCTGTTTCTGTTTGG - Intronic
1164608449 19:29616540-29616562 TCCACTACGGTGTTTCTCTCTGG - Intronic
1165734859 19:38169788-38169810 CCCTCTGGGCTGTCTCTGTCTGG - Intronic
1166061407 19:40327957-40327979 CCCCCTGGGCTGTAACTCTCCGG - Intronic
1167067005 19:47193919-47193941 GCCCCTGGCCTGTATTTCTCTGG - Intronic
1167108608 19:47446031-47446053 CTCCCTGGGCTGTCTCTCTCTGG - Intronic
1168252115 19:55147176-55147198 CCCACTGGGCCTCTTCTCTCTGG - Intronic
1202638236 1_KI270706v1_random:60202-60224 GCCTCTGGGCTGGTGCTCTATGG + Intergenic
927642134 2:24852175-24852197 GCCGCTGGGCCGTTTCTGTGAGG - Intronic
928524603 2:32126972-32126994 GCCAGAGGGCTGTTACTCTTTGG + Exonic
929441293 2:41967450-41967472 GCCACTGGGCTGTCTGTCACAGG - Intergenic
929918830 2:46157874-46157896 GCCACTGAGCTGTGTCTCCGAGG + Intronic
931218481 2:60267583-60267605 ACCAGTGGTTTGTTTCTCTCAGG - Intergenic
931395879 2:61888243-61888265 TCCACTGGGCTGCTTCTATAGGG + Intronic
938344015 2:130554087-130554109 GCCACTTGGCTGCTTCCCACAGG + Intergenic
938345818 2:130566635-130566657 GCCACTTGGCTGCTTCCCACAGG - Intergenic
938378875 2:130825649-130825671 CCCAATGGGGTGCTTCTCTCAGG + Intergenic
944320179 2:198331556-198331578 GCCACTGGCTGGTTTCTCTGTGG + Intronic
944960577 2:204868027-204868049 GCACCTAGGATGTTTCTCTCAGG - Intronic
945260044 2:207834798-207834820 ACCTCTGGGCTGTTTCTCTGTGG + Intronic
946760908 2:222992332-222992354 CCCACGGGGATTTTTCTCTCTGG - Intergenic
947971970 2:234332313-234332335 GCCACTGTCCCGTGTCTCTCTGG + Intergenic
948031125 2:234818461-234818483 CCAAGTGGGCTGTTTCTGTCAGG + Intergenic
948270264 2:236668729-236668751 GCCACAGGGCAGCTTCTCGCTGG + Intergenic
948543925 2:238712032-238712054 GGCACTGGCCAGCTTCTCTCTGG - Intergenic
948741926 2:240053938-240053960 GCCCCTGTGCTCTTCCTCTCAGG + Intergenic
1170138866 20:13105148-13105170 GCCCCTGGCATGTTCCTCTCTGG - Intronic
1171486510 20:25489985-25490007 GCCACTGGCCTGTGTCTCCTAGG - Exonic
1171503144 20:25610272-25610294 GACACTGGGATGCTTCTCTGTGG + Intergenic
1173970157 20:47146401-47146423 CCCACTCTGCTGTTTCTGTCTGG + Intronic
1176002345 20:62838214-62838236 GCCACTGGGCGGTTTCACTGTGG + Intronic
1178294225 21:31395368-31395390 CCCAGTGGACTGCTTCTCTCTGG - Intronic
1178869852 21:36364246-36364268 GCCACTGACCTGTTGCTCTCAGG - Exonic
1179114592 21:38478420-38478442 TCCACTGGCCTGGTTCTCCCAGG + Intronic
1183472878 22:38018941-38018963 GCCAATGGCCTGGTTCTCCCTGG - Intronic
1184101814 22:42344751-42344773 GCCACAGGGCTGCTGCTCTCTGG + Intergenic
956446048 3:69326882-69326904 GCAACGAGGCTGTTTCTTTCTGG - Intronic
956614854 3:71160407-71160429 GCCACTGGGTTGTTTATCTGTGG + Intronic
956882225 3:73521970-73521992 GCCCATGGGCTGTTTCTGTAAGG + Intronic
957352001 3:79036364-79036386 ACCACTGGTCTGGTTCTCTGTGG + Intronic
961659723 3:128462331-128462353 GGGCCTGGGCTGTTTCTATCAGG - Intergenic
964206424 3:154179956-154179978 GTCACTAGGCTGTTTCCTTCTGG + Intronic
981011303 4:139927955-139927977 GCTACTGGGCTGTTGCTTTTAGG + Intronic
983266535 4:165513554-165513576 GGAGCTGGGCTGTTCCTCTCAGG + Intergenic
985297664 4:188453073-188453095 GCCACTATGCTCTTTCTCTTGGG + Intergenic
985747782 5:1656886-1656908 GCCACCGGGCTGGTTCCTTCCGG + Intergenic
986696738 5:10363692-10363714 GACACTGGGTTGTTTCTATTTGG - Intronic
987108965 5:14666827-14666849 GGTAGTGGGCTGTTTCTCTATGG + Intronic
989678401 5:44000858-44000880 ACCAGTGGGCTTTTTCTCTTTGG - Intergenic
996447176 5:123568356-123568378 ACCACTGGGCTGGTTGTCACCGG + Intronic
997264692 5:132488333-132488355 AGCTCTGGGATGTTTCTCTCTGG + Intronic
999570127 5:152910407-152910429 GGCAGAGGGCTTTTTCTCTCTGG + Intergenic
1002965862 6:1965936-1965958 GCCTGTGGGCTGTAGCTCTCTGG - Intronic
1003410257 6:5855873-5855895 TCCAGTGGGCTGTGACTCTCCGG + Intergenic
1005321799 6:24662800-24662822 ATCACTTGGCTTTTTCTCTCTGG - Intronic
1006148172 6:31971513-31971535 GGAACTGGGCTGCTTCTCCCTGG - Exonic
1006627462 6:35407357-35407379 GCCACTGCGCTGTGGCTCTCGGG + Intronic
1007990330 6:46248556-46248578 GCCACTAAGCTGTTTCTGTCTGG + Intronic
1012609835 6:101203251-101203273 GACACTGGGTTAGTTCTCTCTGG + Intergenic
1014473838 6:121848637-121848659 GCCACTGGGCTGGATTTCCCAGG - Intergenic
1015120495 6:129696131-129696153 GCCTCTGGGATGTTTTTCACAGG + Intronic
1015327236 6:131937056-131937078 GACAATGGGGTGTTTCTATCTGG + Intergenic
1015352693 6:132241375-132241397 TCTACTTGGCTCTTTCTCTCAGG - Intergenic
1017996265 6:159534167-159534189 CCCACTGGGCTGCTTCTGCCTGG - Intergenic
1018235395 6:161718609-161718631 GCCACTGGGCTGTTTCTCTCGGG - Intronic
1023819673 7:43973504-43973526 GGCACAGGGCTGCCTCTCTCTGG + Intergenic
1024450536 7:49536944-49536966 GGCCCTGGGCTTTTTCTCTTTGG - Intergenic
1026018928 7:66693483-66693505 GACACTTGGCTGTGTCTCTGGGG - Intronic
1028641590 7:93047815-93047837 CCCACTGTGATCTTTCTCTCTGG - Intergenic
1029031272 7:97469666-97469688 GGCACTTGGCTGTGTCTCTATGG - Intergenic
1029278015 7:99419004-99419026 GCCTCTGGGCTGGTACACTCTGG - Exonic
1029493222 7:100883576-100883598 GCCTCTGGGCTTTTGCTATCTGG + Intronic
1029714645 7:102319287-102319309 CCCTCTGTGCTGTTTCTTTCGGG + Intronic
1029744722 7:102510473-102510495 GGCACAGGGCTGCCTCTCTCTGG + Intronic
1029762713 7:102609635-102609657 GGCACAGGGCTGCCTCTCTCTGG + Intronic
1029873535 7:103722295-103722317 GCAAAAGGACTGTTTCTCTCAGG - Intronic
1032261120 7:130337893-130337915 GCCACTTGGCTGTCTCCATCCGG - Intergenic
1032853164 7:135812424-135812446 GCCCCCAGGCTGTTTCTGTCTGG - Intergenic
1033588854 7:142794139-142794161 GCCCCTGAGCTGCTTCTTTCAGG + Intergenic
1033686657 7:143646762-143646784 GCCACTGGGCTGGCTCACTCTGG - Intronic
1033689077 7:143720545-143720567 GCCACTGGGCTGGCTCACTCTGG + Exonic
1033697952 7:143810852-143810874 GCCACTGGGCTGGCTCACTCTGG + Intergenic
1035990425 8:4483988-4484010 GGCAATGGGATGTTTCTCCCAGG - Intronic
1037250887 8:16892576-16892598 GTCATTGGGCAGATTCTCTCTGG - Intergenic
1037567515 8:20130217-20130239 GCCTCTGAGCTGTGTCTGTCAGG - Intergenic
1038205374 8:25459493-25459515 GCCACGGGGCTGTTTCTCCGGGG + Intronic
1038424497 8:27455691-27455713 GCCACAGGGCTTGTTCTCCCTGG - Intronic
1038837163 8:31138843-31138865 GGCACTGCTCTGTTTGTCTCTGG + Intronic
1039816336 8:41097874-41097896 CTCACTGGGATGTTTCTCACTGG - Intergenic
1040880304 8:52197810-52197832 CCCTCTAGGCTGTTTCTCTGAGG - Intronic
1042567165 8:70123853-70123875 GCCACTGGGTTGCTTCTCCTTGG + Intronic
1045402759 8:101835222-101835244 GCCACTTGGCTTTCTATCTCAGG + Intronic
1045977816 8:108149473-108149495 GGTACTTGGCTGTTTCTTTCTGG - Intergenic
1046012451 8:108565734-108565756 CCCACTGGGCCTTTGCTCTCGGG + Intergenic
1047774853 8:128061407-128061429 GACACTGGGTTGTTTCTTTGGGG + Intergenic
1049276676 8:141723525-141723547 ACCCCTGGCCTGCTTCTCTCTGG - Intergenic
1051206091 9:14690575-14690597 TCCTCTGTGCTATTTCTCTCAGG - Intronic
1053066679 9:35074054-35074076 CCCAGTGGGCTGTCTCTCTGTGG - Exonic
1053427082 9:38017250-38017272 GCCACCCGGCTGCTTCTCTTGGG + Intronic
1056190679 9:84181302-84181324 GCCACTGGGATGTTTTTCCCTGG - Intergenic
1057261992 9:93589992-93590014 GCCACTGCGGTGTTGCTCCCTGG + Intronic
1057562135 9:96136767-96136789 GCAACTGGGATGGATCTCTCAGG - Intergenic
1058777478 9:108298780-108298802 GTCACTGAGCTGGTTCCCTCTGG - Intergenic
1059787716 9:117604349-117604371 CCCACTGGGCTCATTATCTCTGG - Intergenic
1060212193 9:121717484-121717506 GCCCCTGGGCAGATTCACTCGGG + Intronic
1061917430 9:133762703-133762725 GCCTCTGGGCTGTATGCCTCTGG - Exonic
1062381492 9:136288947-136288969 GCCCTTGAGCTGTTTCTCTTGGG - Intronic
1062416113 9:136451128-136451150 GACACTCGGCTGTTTGTATCAGG + Intronic
1203744688 Un_GL000218v1:35328-35350 GCCACTGGGCTGTGGCTCATGGG - Intergenic
1203565416 Un_KI270744v1:84156-84178 GCCACTGGGCTGTGGCTCATGGG + Intergenic
1186734079 X:12442240-12442262 GTCACAGGGCTGTTTGCCTCAGG + Intronic
1190302635 X:49065458-49065480 GCCCCATGGCTGCTTCTCTCTGG + Exonic
1192146224 X:68684648-68684670 GCCACTGGGATGCCCCTCTCTGG - Intronic
1194190467 X:90829449-90829471 GCTCCTGGGCTTTTTCTCTTTGG + Intergenic
1195043546 X:101035617-101035639 GCCACTTGACTGTGTTTCTCAGG + Exonic
1198387629 X:136144787-136144809 GCCTCTTGGCTGTTTCTTTTGGG + Intergenic
1199700655 X:150373191-150373213 GCCAAAGGGCTGTTACTCTTGGG - Intronic
1200486131 Y:3771153-3771175 TTCAGTGGGCTGTGTCTCTCTGG - Intergenic
1200537125 Y:4411873-4411895 GCTCCTGGGCTTTTTCTCTTTGG + Intergenic