ID: 1018236316

View in Genome Browser
Species Human (GRCh38)
Location 6:161727326-161727348
Sequence GCTCAGAGCACACAGTGAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 317
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 284}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018236310_1018236316 27 Left 1018236310 6:161727276-161727298 CCGCTGTTATCCTGAGGACTGTT 0: 1
1: 0
2: 2
3: 12
4: 165
Right 1018236316 6:161727326-161727348 GCTCAGAGCACACAGTGAGCCGG 0: 1
1: 0
2: 1
3: 31
4: 284
1018236309_1018236316 28 Left 1018236309 6:161727275-161727297 CCCGCTGTTATCCTGAGGACTGT 0: 1
1: 1
2: 1
3: 20
4: 147
Right 1018236316 6:161727326-161727348 GCTCAGAGCACACAGTGAGCCGG 0: 1
1: 0
2: 1
3: 31
4: 284
1018236311_1018236316 17 Left 1018236311 6:161727286-161727308 CCTGAGGACTGTTTCTCTGCAGA 0: 1
1: 0
2: 1
3: 20
4: 207
Right 1018236316 6:161727326-161727348 GCTCAGAGCACACAGTGAGCCGG 0: 1
1: 0
2: 1
3: 31
4: 284

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018236316 Original CRISPR GCTCAGAGCACACAGTGAGC CGG Intronic
900142641 1:1145065-1145087 GCCCACAGCACCCAGTCAGCCGG + Intergenic
901237238 1:7673644-7673666 GCTCAAGGCACACTGAGAGCTGG + Intronic
901392678 1:8957245-8957267 GCTCTGAGCACACCGTGGACGGG + Exonic
901788170 1:11638328-11638350 TCTGAGGCCACACAGTGAGCTGG - Intergenic
902752967 1:18530129-18530151 GGTGAGAGCAGACAGTGAGGAGG - Intergenic
903861317 1:26366420-26366442 GCACAGAGCACAGAGTGAAACGG - Intronic
905840051 1:41168991-41169013 GCTTAGAGCAGACAGAGAGTGGG - Intronic
915034289 1:152909478-152909500 GACAAGAGCAGACAGTGAGCTGG + Intronic
915090215 1:153419000-153419022 GCTGAGAGCACAGGGTGAGTGGG - Intronic
915095277 1:153458092-153458114 GCTGAGAGCACAGGGTGAGTGGG + Intronic
917795446 1:178529602-178529624 GCTCAGAGGTCACAGCCAGCCGG + Intronic
919981786 1:202646377-202646399 GCACAGGGCACACAGGGAGAGGG - Intronic
920121414 1:203661508-203661530 GCTCAGAGAACACAGGCACCTGG - Intronic
920198608 1:204245510-204245532 GCTCTGAACACAGTGTGAGCTGG + Intronic
920284316 1:204868714-204868736 GCTCAGAGCAGGCAGAGAACAGG + Intronic
920285098 1:204873569-204873591 CCACAGAGCACACAAGGAGCTGG + Intronic
920963858 1:210686234-210686256 ACTCAGAGCACAGAGTGAAAAGG - Intronic
921270645 1:213466349-213466371 TCTCAGAGCACACAGTCTGATGG + Intergenic
921595602 1:217050815-217050837 GCCCAGGTAACACAGTGAGCTGG - Intronic
924660319 1:246010019-246010041 GGGCAGAGGTCACAGTGAGCTGG + Intronic
1062860030 10:803697-803719 GCAGAGGGCACAGAGTGAGCTGG - Intergenic
1065893933 10:30144852-30144874 CCTGTGAGCACACAGTGAGATGG + Intergenic
1066010807 10:31191963-31191985 GCTCGGGGGACACAGTGGGCTGG - Intergenic
1066178830 10:32939788-32939810 GCACAGAACACACACTGAACAGG + Intronic
1069753714 10:70760913-70760935 GCTCAGAGGACACACATAGCAGG + Exonic
1069994975 10:72336423-72336445 CCTCAGAGCACAGGGTGAGCAGG + Intronic
1070949952 10:80423030-80423052 GCTGAGAGCACACAGCAAGGAGG - Intronic
1071578362 10:86746986-86747008 TCTCAGTGCACACAATGGGCAGG - Intergenic
1072188129 10:93061218-93061240 GCTCAGAGCGCAGGGAGAGCAGG - Intergenic
1073208117 10:101779393-101779415 GGTCTGAGGCCACAGTGAGCCGG + Intronic
1077231116 11:1458589-1458611 GCTGAGAGCCCCCAGTGAGCAGG + Intronic
1077424433 11:2467716-2467738 GCCCAGTGCACACAGCCAGCAGG + Intronic
1077550772 11:3199288-3199310 GCTCAGAGGACACAGGGTGCAGG + Intergenic
1077610578 11:3641398-3641420 TCTCAGAGCTCACAGTGATTTGG - Intronic
1080034360 11:27697270-27697292 GTTCAGCACGCACAGTGAGCTGG - Intronic
1081679052 11:44989109-44989131 GCTAATGGCACACAGTGTGCGGG - Intergenic
1083258179 11:61509108-61509130 GCTCAGCGCGCACACTGCGCTGG - Exonic
1083322862 11:61857832-61857854 ACTCAGGGCCCACAGGGAGCGGG - Intronic
1083964909 11:66037424-66037446 GCTCTGAGTTCACAGTGATCTGG + Intergenic
1084322188 11:68379509-68379531 GCTCAGAGCTGCCAGTGAGGTGG - Intronic
1085732769 11:79013452-79013474 GCCCAGAGAACACAGTGAAGGGG - Intronic
1087129434 11:94655627-94655649 GTTAAATGCACACAGTGAGCAGG - Intergenic
1088119494 11:106351421-106351443 CCTCTGAGGACACAGTGAGAAGG - Intergenic
1089027375 11:115285720-115285742 TCTAAGAGCACACAGGCAGCTGG + Intronic
1089417101 11:118301415-118301437 GCTCAGAGCCTAGAGTTAGCGGG - Intergenic
1090048641 11:123358453-123358475 GCTCCGAGCCCACGGAGAGCGGG + Intergenic
1090208321 11:124897842-124897864 GCTCTGAGCTCACAGTGAAGAGG + Exonic
1090558222 11:127899103-127899125 GTTCAGAGGTGACAGTGAGCTGG - Intergenic
1090632425 11:128661444-128661466 CTACAGAGCACACAGTGAGAGGG + Intergenic
1091399474 12:173549-173571 GCTCAGAGCACAGAGGGAAAGGG - Intronic
1093713510 12:22354905-22354927 ATTCTTAGCACACAGTGAGCTGG - Intronic
1093917045 12:24816008-24816030 GCTCGGGGTACACAGTGCGCAGG + Intronic
1095698233 12:45164748-45164770 GGTCAGAGCACCCAGTGGGAGGG - Intergenic
1096525400 12:52207273-52207295 CCTGAGAGCATACAGTGAGATGG + Intergenic
1097168646 12:57099594-57099616 CCACAGAGCTCACAGTGAGAAGG + Intronic
1097757525 12:63423314-63423336 ACTCAGAGCTCCCAGTGTGCAGG - Intergenic
1100942405 12:99738926-99738948 GCTTAAAGGACACAGTGAGTTGG - Intronic
1101594353 12:106150828-106150850 ACTCATAGCAGACAGAGAGCAGG + Intergenic
1104084096 12:125458590-125458612 GATCAGATCACACATGGAGCTGG + Intronic
1104529230 12:129553335-129553357 GCACAGAGCAGAGAGTGAGGGGG - Intronic
1108720634 13:53127901-53127923 ACTCAGAGCCCCTAGTGAGCAGG - Intergenic
1109940039 13:69349766-69349788 GGTCAGAGTACACAGTGAAAAGG - Intergenic
1111304817 13:86395338-86395360 ATTCAGAGCATACAGTGACCAGG + Intergenic
1112448517 13:99489002-99489024 GTTAAGTGCACACAGGGAGCAGG + Intergenic
1113642192 13:111965628-111965650 GCTCTGAGGACAAAGTGAGAGGG - Intergenic
1114516475 14:23302823-23302845 GCTCAGAGCAGACCGCTAGCAGG - Exonic
1115480025 14:33851514-33851536 ACTCAGTGCACACAGTCAGAGGG + Intergenic
1117498385 14:56328430-56328452 CAACACAGCACACAGTGAGCAGG - Intergenic
1117549887 14:56824458-56824480 GCTCAGAGCAAAAATGGAGCAGG - Intergenic
1118908914 14:70045264-70045286 ACTCAGAGAAAACAGTGAGATGG + Exonic
1120842037 14:89094530-89094552 TATCAGAGCACGCAGTGGGCTGG + Intergenic
1120887113 14:89460464-89460486 CGTCAGAGTGCACAGTGAGCGGG + Intronic
1124619096 15:31264072-31264094 GCTCAGAGCAGAAACTGAGATGG + Intergenic
1125765146 15:42130653-42130675 CCTCAGACCCCCCAGTGAGCAGG + Intergenic
1126386177 15:48095678-48095700 GCTCAGAGCAGACATCAAGCTGG - Intergenic
1127922793 15:63505669-63505691 GCTTAGAGCAGACAATGAGAGGG - Intronic
1128733499 15:70036077-70036099 GCCCAGAGAACACAGTGACTTGG - Intergenic
1128848250 15:70921558-70921580 GGTCAGTGCATACAATGAGCAGG - Intronic
1128983160 15:72200745-72200767 GGCCAGAGCCCTCAGTGAGCTGG - Intronic
1129260831 15:74366235-74366257 GGTCAGAGCACAGAGTGAAAAGG - Intronic
1129786460 15:78313381-78313403 GCTCTGAGCACTCAGTCAGGAGG + Intergenic
1131022147 15:89107880-89107902 GCTCAGAGGACACAGACAGCTGG - Intronic
1131071322 15:89468002-89468024 GTTAAGTGCACACAGTGAGCAGG - Intergenic
1131508709 15:93037127-93037149 ACTAAGAGCACACGGTGGGCCGG + Intronic
1132825478 16:1903081-1903103 GCTCCCAGCACTCCGTGAGCGGG - Intergenic
1134325673 16:13205359-13205381 GCTCACAGGACACAGTGAGAAGG - Intronic
1135531571 16:23259070-23259092 GCTCAGAGAACAGAGCCAGCAGG + Intergenic
1136275603 16:29177699-29177721 GCTCAGAGGACACATCCAGCCGG - Intergenic
1136335320 16:29606784-29606806 GCTCAACGTGCACAGTGAGCAGG + Intergenic
1136418902 16:30120288-30120310 CTTCAGATCACACAGCGAGCTGG + Intronic
1136554466 16:30999692-30999714 GCACAGAGCACCCAGTGGGTGGG - Intronic
1136632765 16:31498685-31498707 GCACAGACCGCACAGTGAGCTGG - Intronic
1138344650 16:56312463-56312485 GCTCACAGCAAACACTGAGGCGG + Intronic
1138914838 16:61451235-61451257 GCTCAGAGGATACAATGAGAGGG - Intergenic
1139476861 16:67207198-67207220 GCTCAGTGCACACAGGGTGCTGG + Exonic
1140830241 16:78744123-78744145 GCTCTGAGAACACAGTAAACAGG + Intronic
1141023590 16:80521872-80521894 TCTCAGAGCACCCAGTTGGCTGG - Intergenic
1141207312 16:81942810-81942832 GCTTTGAGCACCCAGTGAGAGGG - Intronic
1141369243 16:83472067-83472089 TCTCAGAGAACACAGTGTCCTGG + Intronic
1141421357 16:83919572-83919594 GATCAGAACACACAGTGCACAGG + Exonic
1141671073 16:85491958-85491980 GCTCTGAGCACCCTGTGGGCTGG + Intergenic
1142210658 16:88806929-88806951 GCACAGACCACCCAGTGTGCTGG + Intronic
1142769267 17:2084930-2084952 ACTCAGAACCCACAGAGAGCAGG + Intronic
1142883231 17:2896950-2896972 GCATAGAGCAGACAGAGAGCAGG - Intronic
1143437292 17:6938761-6938783 GTTCAGTGCACACAGTGAGCAGG + Intronic
1144074202 17:11702152-11702174 GCTCAGAAGACAGGGTGAGCAGG + Intronic
1144666137 17:17103458-17103480 GATCAAAGCACAAGGTGAGCTGG - Intronic
1144956878 17:19023141-19023163 GCTGGGAGCTCACAGTGACCTGG + Intronic
1145269244 17:21395968-21395990 GCTCAGAGCCCAGAGAGGGCAGG - Intronic
1147219469 17:38919982-38920004 CCTCAGAACCCACAGTGAGAGGG + Exonic
1147965123 17:44190569-44190591 GTTCAGAGAACGCAGTGTGCGGG - Exonic
1148019139 17:44542069-44542091 GCACAGAGCCCACAGCGGGCTGG - Intergenic
1148067064 17:44879469-44879491 ACCCAGAGCACTGAGTGAGCTGG - Intronic
1148226411 17:45900764-45900786 GCTTAGGTCTCACAGTGAGCAGG - Intronic
1151181771 17:72334391-72334413 GCTCAGTCCTCTCAGTGAGCTGG + Intergenic
1151367587 17:73627485-73627507 GCACAGAGGCCACAGGGAGCAGG + Intronic
1152331490 17:79675745-79675767 GCTCAGAGCCCTCAGTCATCAGG + Intergenic
1153732649 18:8029860-8029882 GGTCAGATCACACAGGGGGCAGG - Intronic
1154201979 18:12306489-12306511 GCGCAGAGCGCACAGCGAGCAGG + Intergenic
1156228660 18:35133035-35133057 GCTCAGAACACCCAGAGACCGGG - Intronic
1156596841 18:38557262-38557284 GCTGTGAGCACATACTGAGCTGG + Intergenic
1158784731 18:60696644-60696666 GCTCAGACCCTACAGAGAGCAGG + Intergenic
1158831759 18:61287360-61287382 GCTCTGACGACACAGTGAGGTGG - Intergenic
1160081084 18:75727680-75727702 GCTAAGAGAACAAAGAGAGCAGG - Intergenic
1161055828 19:2190255-2190277 GGACGGGGCACACAGTGAGCTGG + Intronic
1161267449 19:3370891-3370913 GCCCTGAGCACACAGCGTGCGGG + Intronic
1162473319 19:10885386-10885408 GCTCCGAGAACACAATTAGCGGG - Intronic
1163243987 19:16081153-16081175 ACTCACAGGACACAATGAGCCGG + Intronic
1163382473 19:16978149-16978171 GCTCAGAGCAGCCAGTGGACAGG + Intronic
1163643350 19:18474245-18474267 GCTCAGGGCACACATGGAGCAGG - Intronic
1164854656 19:31511529-31511551 GCTCAGGGCAGACAGTGTCCAGG + Intergenic
1165142856 19:33712828-33712850 GATCAGGGCAGACACTGAGCAGG - Intronic
1165333709 19:35155073-35155095 GCTCAGAGGAAAAAGTGAGTTGG - Exonic
1165700355 19:37932649-37932671 GCTCTGATCACAAAGTGGGCAGG - Intronic
1166322049 19:42024619-42024641 GCCCAGAGCCCGCAGAGAGCAGG + Intronic
1166547479 19:43641884-43641906 TGTCAGAGCACAGAGTGAGCGGG - Intergenic
1166872413 19:45878933-45878955 GCTCAGAGTAGACAGAGAGACGG - Intergenic
1167627576 19:50602778-50602800 GCACAGAGGGCACAGAGAGCTGG - Intergenic
925010601 2:482691-482713 GCACAAACCCCACAGTGAGCTGG - Intergenic
925735128 2:6957256-6957278 GCTCAGAGCCCACATGTAGCGGG - Intronic
925746895 2:7051196-7051218 GCTCAGAGCACAGATTGGGAGGG + Intronic
925800941 2:7599726-7599748 GCCCAGAGCGCACCGGGAGCGGG + Intergenic
927441015 2:23117941-23117963 GCTCAAAGCACACAGCAGGCAGG + Intergenic
928169948 2:28997349-28997371 GCTGAGAGCATACAGGGAGCAGG - Intronic
928234265 2:29526341-29526363 TCTCTGAGCACACAGTGGGCAGG - Intronic
929437393 2:41939033-41939055 GCTTGGACCACACAGTGAGCTGG - Intronic
929545102 2:42850578-42850600 GCTCAGAGCAGAGAGTAAGGGGG - Intergenic
929614026 2:43294236-43294258 GCTCCTAGCACATAGTAAGCAGG - Intronic
929847988 2:45552816-45552838 GTTCAGAGCAGGGAGTGAGCAGG - Intronic
930749966 2:54925209-54925231 CCTGTGAGCACACAGTGAGAAGG + Intronic
932104757 2:68932373-68932395 ACTGAGAGCACAGAGTGAGCAGG - Intergenic
932494088 2:72138057-72138079 CCTCAGAGCCCACCGTGAGATGG + Intronic
933832524 2:86222435-86222457 GCTCAGCGGACACAGTGACTAGG - Intronic
934794400 2:97088116-97088138 GATTATAGCAGACAGTGAGCTGG - Intronic
934946470 2:98546160-98546182 GCCCAGAGCACACAGGGAAATGG - Intronic
935090414 2:99890541-99890563 GCTCAGAGGTCAGAGTGGGCAGG + Intronic
935299311 2:101680056-101680078 GATCAGAGGAAACAGTGGGCAGG + Intergenic
938131072 2:128716008-128716030 CCCCAGAGCACACAGCCAGCAGG - Intergenic
939232458 2:139447419-139447441 GCAGAGAGAAGACAGTGAGCAGG - Intergenic
939976023 2:148718646-148718668 GCTCAGAGCAGCCAGAGAGAAGG - Intronic
940193850 2:151071445-151071467 CCTCAGAGCCCACAGTCAACAGG + Intergenic
942248189 2:174026101-174026123 GCCCAGGGCACAGTGTGAGCCGG + Intergenic
943049639 2:182899490-182899512 GCTCAGGTCACACACGGAGCTGG - Intergenic
945025081 2:205612865-205612887 GCTCACAGCTCACAGTGAGGGGG - Intronic
946706416 2:222462856-222462878 TCTCAGAGCACAAAGCAAGCAGG + Intronic
947346351 2:229193333-229193355 GCTCAGAGCTTCCAGAGAGCTGG + Intronic
947536104 2:230941301-230941323 GCCCAGAGTCCACAGTGAGCAGG + Intronic
947670143 2:231930611-231930633 CCTCAGAGCACACAGAGGCCGGG + Intergenic
948490378 2:238308934-238308956 TCTCACAGGACACAGTGGGCTGG + Intergenic
948672764 2:239579085-239579107 GGGCAGAACACACAGTGAGAGGG + Intronic
1172009503 20:31838150-31838172 GCTGAGGGCACACAAGGAGCAGG + Intergenic
1172097046 20:32465608-32465630 GCTCTGAGAACACGGGGAGCAGG - Intronic
1172592008 20:36124364-36124386 GTTCAGAGCCCTGAGTGAGCCGG + Intronic
1172702298 20:36861167-36861189 GCTCAGAGCACCAAGAGGGCAGG + Intronic
1172903221 20:38349872-38349894 GCTCAGATCACACAGCCAGTAGG - Intronic
1173002921 20:39118382-39118404 CCTCAAAGCCCACAGTGAACAGG + Intergenic
1174114757 20:48219309-48219331 GCTCAGTGTCCAGAGTGAGCAGG - Intergenic
1174328297 20:49797160-49797182 CCTGAGATCACACAGTGAGCTGG - Intergenic
1174500824 20:50982663-50982685 GCTCTGAGCACAATTTGAGCTGG - Intergenic
1175408607 20:58751620-58751642 CCACAGAGCACAGAGGGAGCCGG + Intergenic
1175553331 20:59831038-59831060 GCACAGAGGAGACAGGGAGCAGG - Intronic
1176139849 20:63540152-63540174 GCACACAGCACTCAGTAAGCCGG - Intergenic
1178884767 21:36476368-36476390 GCTCAGTGCCCACAGTGGGCTGG - Intronic
1179540651 21:42081474-42081496 TCTCAGGGCACTCAGTCAGCTGG + Intronic
1179591578 21:42412599-42412621 GCTCAGAGCCTGTAGTGAGCGGG - Intronic
1180937678 22:19636919-19636941 GGTCAGAGGTCACAGAGAGCAGG - Intergenic
1181463916 22:23100661-23100683 GCTCAGAGCACAGGCTGTGCCGG - Intronic
1182351528 22:29702671-29702693 GATCAGAGCCCACAGCCAGCTGG - Intergenic
1182913702 22:34008780-34008802 GCACAGAGCAGACAGTGGGGAGG - Intergenic
1183583426 22:38738821-38738843 GCTCTGAGCACACTGAGGGCTGG - Intronic
1185181468 22:49365901-49365923 GCTCGGCACACACAGTGAGGAGG + Intergenic
1185181472 22:49365927-49365949 GCTGAGCACACACAGTGAGGAGG + Intergenic
1185181474 22:49365953-49365975 GCTGAGCACACACAGTGAGGAGG + Intergenic
1185181478 22:49365979-49366001 GCTGAGCACACACAGTGAGGAGG + Intergenic
1185181494 22:49366051-49366073 GCTGAGCACACACAGTGAGGAGG + Intergenic
1185181496 22:49366077-49366099 GCTGAGCACACACAGTGAGGAGG + Intergenic
1185354962 22:50362763-50362785 GCTGTGAGGACACAGTGAGAAGG + Intronic
1203295332 22_KI270736v1_random:37717-37739 GCTCTGTTTACACAGTGAGCTGG - Intergenic
950426556 3:12927629-12927651 GCTCAGAGCACAGAGGGAAGAGG + Intronic
952155391 3:30637983-30638005 AGTCAGATAACACAGTGAGCTGG - Intronic
953559307 3:43972186-43972208 CCTCAGAACCCACAGTGAGAGGG - Intergenic
953570362 3:44066610-44066632 CATCAGAGCACAGAGTAAGCAGG - Intergenic
955612002 3:60767812-60767834 GCTCAGGCCACACAGTCACCTGG - Intronic
955727073 3:61944449-61944471 TCTCAGAGCTCACAGTCAGCTGG + Intronic
960898872 3:122534098-122534120 GGGCAGAGCACACAGACAGCAGG + Intronic
961492023 3:127263032-127263054 CCTGTGAGCACACAGTGAGAAGG - Intergenic
962146305 3:132843587-132843609 GCTCACAGGACTCTGTGAGCTGG - Intergenic
962265140 3:133939381-133939403 GCTCAGAGCACAGAGAGTCCTGG - Intronic
962314909 3:134353271-134353293 GCTCAGAGCAGATAGTGTCCTGG + Intergenic
965622724 3:170656839-170656861 GCCCAGAGCACAGAGAGAGCTGG + Intronic
968231811 3:197008886-197008908 GCACAGTGCACACAGCGAGGAGG + Exonic
968536415 4:1133275-1133297 GCTCACAGCCCACAGTGTGTGGG + Intergenic
968944785 4:3658022-3658044 GCTCAGAACACACAGCGGCCGGG + Intergenic
969122975 4:4923370-4923392 GCTCAGAGGAAACAGTGGGTGGG + Intergenic
969507400 4:7596823-7596845 GCTCAGGCCACGCAGTGAGCAGG + Intronic
974557608 4:63471958-63471980 GCTCAGATCACACATTGACTTGG - Intergenic
975443121 4:74435474-74435496 GTTAAGTGCATACAGTGAGCAGG + Intergenic
976620901 4:87126323-87126345 CCTCGGAGCACAAGGTGAGCAGG + Exonic
976750751 4:88449468-88449490 GTTTAATGCACACAGTGAGCAGG - Intergenic
979052673 4:115954199-115954221 GGTCATAGCACACATTGGGCTGG - Intergenic
981074557 4:140578111-140578133 GCTCAGATCAGACATGGAGCAGG + Intergenic
981194990 4:141908961-141908983 CCTGTGAGCACACAGTGAGTAGG + Intergenic
982707066 4:158722350-158722372 GCTCAGAGCACAAAGGCTGCAGG - Intronic
983742759 4:171155765-171155787 GATCAGAACAGCCAGTGAGCAGG + Intergenic
985581008 5:695097-695119 GCGCAGGACACACAGTGACCGGG + Intergenic
985595633 5:786429-786451 GCGCAGGACACACAGTGACCGGG + Intergenic
985707895 5:1412198-1412220 GCTGTGAACCCACAGTGAGCGGG + Intronic
986646580 5:9921921-9921943 GCTCAGAGCACACTGAAGGCTGG + Intergenic
990292168 5:54363310-54363332 TCTCAGAGGAGACAGTGAGGAGG + Intergenic
991086116 5:62649608-62649630 GCTGTGAGGACACAGTGAGACGG + Intergenic
992859244 5:80894617-80894639 GTTGAATGCACACAGTGAGCAGG + Intergenic
992989473 5:82269571-82269593 GGTCATAGCACACATTGGGCTGG + Intronic
993884530 5:93400085-93400107 GGTCTGAGAAAACAGTGAGCTGG - Intergenic
994021122 5:95027341-95027363 ACTAAGGGCAGACAGTGAGCAGG + Intronic
994079026 5:95685547-95685569 TCACAAAGCACACTGTGAGCTGG - Intronic
994140842 5:96339508-96339530 GCTAAAATCACACAGTGAGCTGG + Intergenic
995297907 5:110541239-110541261 GTTAAGTGCACACAATGAGCAGG - Intronic
995598664 5:113773659-113773681 GTTAAGTGCACATAGTGAGCAGG + Intergenic
998114914 5:139529216-139529238 GGTCATAGCACACATTGGGCTGG - Intronic
998152228 5:139764119-139764141 GGGCTGAGCACACAGTCAGCGGG + Intergenic
998447030 5:142206318-142206340 GCTCAGAGGACACAATGTGTTGG + Intergenic
1001268754 5:170295068-170295090 TCTAAGGTCACACAGTGAGCTGG + Intronic
1001543305 5:172554193-172554215 CCCCAGGGCACACAGTGAGTTGG - Intergenic
1001633639 5:173194647-173194669 GCACACAGCACACAGTGCCCTGG + Intergenic
1001879301 5:175229406-175229428 GCCCAGAGCACACAGAGATGAGG + Intergenic
1001965021 5:175903980-175904002 ACTCTGAGGACACAGTGAGAAGG - Intergenic
1002251935 5:177935208-177935230 ACTCTGAGGACACAGTGAGAAGG + Intergenic
1002435260 5:179227568-179227590 GCTGGGACCACAGAGTGAGCAGG + Intronic
1002591172 5:180292287-180292309 GCGCAGTGCACGCGGTGAGCTGG + Intergenic
1002807941 6:596012-596034 GCCCAGCACACACAGTGACCCGG - Intronic
1002847913 6:965160-965182 GCCCTAAGCACACAGAGAGCAGG + Intergenic
1003052641 6:2793601-2793623 GCTGAGGGCCGACAGTGAGCAGG + Intergenic
1003916617 6:10792582-10792604 GCTTAGAGCACACAATGAATTGG + Intronic
1006060409 6:31414582-31414604 GGGCAGAGCCCACAGTGGGCAGG + Intronic
1006260754 6:32867432-32867454 GGTCAGACCACGCAGAGAGCAGG - Intergenic
1006800177 6:36754671-36754693 TCCCAGGTCACACAGTGAGCTGG - Intronic
1007654349 6:43443238-43443260 GCTCAGGGCACACATGCAGCAGG - Intronic
1011256596 6:85428012-85428034 GCCCAGAGCTCAGAGCGAGCGGG + Intergenic
1012794631 6:103743687-103743709 GCCCAGAACACACTGGGAGCTGG - Intergenic
1013466561 6:110422342-110422364 CCTGTGAGCACACAGTGAGATGG + Intergenic
1013642643 6:112101864-112101886 TCTCAGAGCTCACACTGAGCTGG + Exonic
1013894620 6:115071246-115071268 GCTGAGAGAGCACACTGAGCTGG - Intergenic
1013976012 6:116079696-116079718 GCTCAGGGCACACAGTGGGAGGG - Intergenic
1014048548 6:116924430-116924452 GGACAGTACACACAGTGAGCAGG + Intronic
1016868075 6:148789255-148789277 ACTCAGAACACACATTGAGGAGG - Intronic
1016868896 6:148797593-148797615 GTTCAGAGTACACAGTGATAAGG + Intronic
1018236316 6:161727326-161727348 GCTCAGAGCACACAGTGAGCCGG + Intronic
1018678215 6:166241493-166241515 GCTCAGACCCCACCGTCAGCAGG + Intergenic
1019220334 6:170468195-170468217 GGTCAGAGCACACTCTCAGCTGG - Intergenic
1019553454 7:1616563-1616585 GCTCACAGGACACAGAAAGCAGG - Intergenic
1019604460 7:1901592-1901614 GCCTTGAGCACACAGCGAGCCGG - Intronic
1022483549 7:30759964-30759986 GCTCAGTGCAGAGAGTCAGCTGG + Intronic
1023537069 7:41224962-41224984 GCTGAGAGAGCACAGTTAGCAGG + Intergenic
1023848247 7:44135447-44135469 ACACAGGGCTCACAGTGAGCAGG + Intergenic
1026231548 7:68488472-68488494 GCTCAGGGAACAGAGAGAGCAGG + Intergenic
1026276684 7:68884973-68884995 CCTGTGAGCACACAGTGAGAAGG - Intergenic
1027216227 7:76185638-76185660 GCTCACAGCTCACAGCCAGCTGG - Intergenic
1030064687 7:105650541-105650563 GGTCAGACCACACAGTTACCAGG + Intronic
1030246937 7:107392977-107392999 CCCCAGAGAACACAGTGACCTGG - Intronic
1034377254 7:150656958-150656980 GTTGAATGCACACAGTGAGCAGG + Intergenic
1034433595 7:151052654-151052676 GCTCCGAGGACACAGACAGCAGG - Exonic
1034728512 7:153363073-153363095 GCTCAGAGCAGACACTGAGAAGG + Intergenic
1035655161 8:1299988-1300010 TCCCTGAGGACACAGTGAGCAGG - Intergenic
1035946435 8:3968371-3968393 GCTCAGTGACCACACTGAGCTGG - Intronic
1038030265 8:23632494-23632516 GCACAGACTATACAGTGAGCTGG - Intergenic
1039428324 8:37505427-37505449 GCTCCTTGCACACGGTGAGCAGG - Intergenic
1039448387 8:37650513-37650535 GCTCAGATCACAGAGCCAGCTGG - Intergenic
1039625783 8:39050957-39050979 TCTCAGAGCACAGATGGAGCTGG - Intronic
1040979254 8:53228803-53228825 CCACACAGCATACAGTGAGCTGG + Exonic
1041833283 8:62181101-62181123 CCTCAGAGCACACACCAAGCTGG - Intergenic
1042423547 8:68620200-68620222 GCTCAGAGCACACAGGAACTGGG - Intronic
1043592652 8:81848153-81848175 GTTAAGTGCACACAGTGAGCAGG - Intergenic
1045559405 8:103246335-103246357 GGGGAGAGCCCACAGTGAGCTGG - Intergenic
1047220173 8:122912331-122912353 GCCCAGAGCACCCAGTGCCCAGG - Intronic
1047446460 8:124924584-124924606 GCCAAGATCACACACTGAGCTGG - Intergenic
1049076491 8:140400507-140400529 GCATTGAGCACACAGGGAGCCGG - Intronic
1049832814 8:144713166-144713188 TCTCAGAGCAGACCGAGAGCAGG + Intergenic
1051272925 9:15372480-15372502 GCTCAAAGCACGGAGTGACCAGG - Intergenic
1052995750 9:34550938-34550960 GCTCAGAGCACAGAGTGTCCTGG - Intergenic
1053130962 9:35615457-35615479 GCTCAGCACTCACAGTGAGGTGG - Intronic
1056682832 9:88734163-88734185 CCTGAGATCACACAGTGAGTAGG + Intergenic
1056823384 9:89860196-89860218 CCTCAGAGCACACACTGGACAGG + Intergenic
1057004209 9:91542366-91542388 GCAAAGAGCATTCAGTGAGCAGG - Intergenic
1061039571 9:128132087-128132109 CCTCAGAGCACACACTGGACAGG - Intergenic
1061331981 9:129900499-129900521 GCTCCCAGCACGCAGCGAGCAGG - Exonic
1061430215 9:130526215-130526237 GCTGAGGGCACACAGTGTGGAGG - Intergenic
1185556933 X:1028973-1028995 GCAAAGGCCACACAGTGAGCTGG + Intergenic
1186011344 X:5137733-5137755 GCTCAGATTACACAGTGGTCAGG + Intergenic
1186025047 X:5300147-5300169 GCTCAAATCACACAGCTAGCAGG - Intergenic
1186110539 X:6250678-6250700 GCTCAAAGCACAAAGTGATCAGG - Intergenic
1186500025 X:10043770-10043792 TTTGAGAGAACACAGTGAGCAGG - Intronic
1189144791 X:38644648-38644670 CCTAAGATCACACAGTGAGTTGG - Intronic
1197794622 X:130285943-130285965 GTTAAGTTCACACAGTGAGCAGG - Intergenic
1198100554 X:133418437-133418459 GGTCAGAGAACACAGTGCTCTGG + Intergenic
1200053939 X:153448894-153448916 GCACATGGCACACAGTGAGGAGG + Intronic
1202349693 Y:23974691-23974713 GCTCAGAGCAGACATTCAGCAGG - Intergenic
1202521086 Y:25695429-25695451 GCTCAGAGCAGACATTCAGCAGG + Intergenic