ID: 1018240576

View in Genome Browser
Species Human (GRCh38)
Location 6:161770265-161770287
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018240572_1018240576 -3 Left 1018240572 6:161770245-161770267 CCCAGTAGCTTAACCGCAGGGAG 0: 1
1: 0
2: 0
3: 2
4: 60
Right 1018240576 6:161770265-161770287 GAGCAGAACTTACATACAGAGGG No data
1018240573_1018240576 -4 Left 1018240573 6:161770246-161770268 CCAGTAGCTTAACCGCAGGGAGC 0: 1
1: 0
2: 0
3: 0
4: 35
Right 1018240576 6:161770265-161770287 GAGCAGAACTTACATACAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr