ID: 1018244163

View in Genome Browser
Species Human (GRCh38)
Location 6:161805876-161805898
Sequence TGCTGCATTTAGAGTGTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 132}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018244163 Original CRISPR TGCTGCATTTAGAGTGTTCC AGG (reversed) Intronic
905041796 1:34966573-34966595 TGCTGTACTTAGAGTGTTCAAGG + Intergenic
906521820 1:46471330-46471352 TGGGGCCTTCAGAGTGTTCCTGG - Intergenic
907681492 1:56568538-56568560 TCCTGCATTTAAAGTGTTTCTGG + Intronic
909591937 1:77360301-77360323 TGCTAAATTTAAAATGTTCCAGG + Intronic
910608335 1:89112053-89112075 TGTTGCACTTACTGTGTTCCAGG - Intronic
922056316 1:222045587-222045609 TGATGCACTCAGAGTGTTCAAGG + Intergenic
1066505727 10:36040361-36040383 TGCTGCATGTAGAGTTTTATAGG + Intergenic
1069891181 10:71653315-71653337 TGCTGCATTTGAAGTCCTCCAGG - Intronic
1071257031 10:83880111-83880133 TGGAACATTTAGAATGTTCCAGG - Intergenic
1073238632 10:102038689-102038711 TGATACATTTAGAATGCTCCAGG + Intronic
1073429530 10:103477159-103477181 TGCTGCTTTTGGAGGGTTACTGG - Intronic
1074239393 10:111622033-111622055 TGCTGGATTTTGAATGTTCATGG + Intergenic
1078504807 11:11928027-11928049 TGCTGCTATTAGAATTTTCCAGG + Intronic
1082189265 11:49223072-49223094 AGCTGCATTTTGAGTGGTGCAGG - Intergenic
1082792564 11:57356845-57356867 TGATGCAATTAGAGTGATCTTGG + Intronic
1086677258 11:89623518-89623540 AGCTGCATTTTGAGTGGTGCAGG + Intergenic
1087129324 11:94654782-94654804 AGCTGGATTTAAAGTGTTGCAGG - Intergenic
1088832812 11:113551963-113551985 TACTGCACTTAGAGTGTTCTTGG - Intergenic
1088981200 11:114865776-114865798 TGCTGCATTTCAGGTGTTCTTGG - Intergenic
1089397034 11:118143022-118143044 TGCTGCATTTTGTGTGTACCGGG - Intronic
1089723194 11:120449233-120449255 TGCTGCATTTTCAGTACTCCAGG + Intronic
1091442649 12:523512-523534 AGCTGCAGGTAGAGTATTCCGGG - Intronic
1091971129 12:4788056-4788078 TGCTGCTTTTAGAGCCATCCCGG + Intronic
1093414887 12:18908510-18908532 TGCTGCATTTAGATTCACCCGGG + Intergenic
1096958375 12:55550551-55550573 TGCCACATTCAGAGTCTTCCAGG - Intergenic
1098313707 12:69172057-69172079 TGCAGCTTTTAGACTCTTCCTGG - Intergenic
1100471171 12:94894580-94894602 TGCACCCCTTAGAGTGTTCCAGG + Intergenic
1103274555 12:119700808-119700830 TGCAGAATTTGGAGTGTTCGTGG - Exonic
1104042407 12:125139137-125139159 TTCAGCATTTAGGGGGTTCCTGG + Intronic
1110527816 13:76559735-76559757 TGCTGCATTTAGAAGTGTCCTGG - Intergenic
1110957944 13:81579885-81579907 TACTACATTTAGAGTCTTACTGG - Intergenic
1111365693 13:87241486-87241508 GGATGTATTTAGAGTGTTCAAGG + Intergenic
1115747974 14:36458352-36458374 TGCCTCATTCAGAGTGTGCCTGG + Intergenic
1119653845 14:76402606-76402628 TGGTGCATTTTGAGGCTTCCAGG + Intronic
1121044776 14:90779625-90779647 TGCAGCATTTAGAATGTGCCAGG + Intronic
1122582537 14:102779979-102780001 TGCTGCTTTGCGAGTGTTCATGG + Intronic
1122816359 14:104316056-104316078 TGGGGCATTTGGAGTTTTCCAGG + Intergenic
1128537634 15:68502825-68502847 TGCTGCATGTTGAGTGTTTGGGG - Intergenic
1133584180 16:7175948-7175970 TTCTGCATTTACAGCTTTCCAGG - Intronic
1134032498 16:11003651-11003673 TGCAGCATTTAGAATGGGCCAGG - Intronic
1135174106 16:20212848-20212870 AGCTTCATTTAGATTCTTCCTGG + Intergenic
1140779320 16:78280058-78280080 AGCTGAGTCTAGAGTGTTCCAGG + Intronic
1140987320 16:80170677-80170699 GGCTGCACTTCAAGTGTTCCAGG - Intergenic
1141462507 16:84186050-84186072 TGCAGCATTTAGCATGTGCCTGG - Intronic
1141815837 16:86408740-86408762 TTCTGCTTTTAGAGTTTTCCCGG + Intergenic
1203126839 16_KI270728v1_random:1594710-1594732 TGATCCCTATAGAGTGTTCCCGG - Intergenic
1143280083 17:5747421-5747443 TTCTGCATCTAGAATGTTGCTGG + Intergenic
1146464402 17:33074818-33074840 TGCTGCATTTAGAAAGGTTCTGG + Intronic
1147039613 17:37708446-37708468 GGCTGCATTTAGAGCGGCCCTGG + Intronic
1149050378 17:52297330-52297352 ATCTGCATTTAGAGACTTCCTGG - Intergenic
1150175597 17:63051529-63051551 GGCTGCATATAGACTGATCCAGG + Intronic
1151927967 17:77212730-77212752 TGCTGCCTTTACAGTTTTCAGGG + Intronic
1153668722 18:7390386-7390408 TTCAGCATATACAGTGTTCCAGG + Intergenic
1153858615 18:9175164-9175186 GGCAGCATTTAGTGAGTTCCAGG - Intronic
1155213912 18:23625650-23625672 TACTGCATTAAGAGTTTTGCAGG + Intronic
1156498808 18:37543935-37543957 TGCAGCAGTTAGAGGCTTCCTGG + Intronic
1157960979 18:52153074-52153096 AGCTGCAGTTAGAATGATCCGGG + Intergenic
1159577303 18:70195236-70195258 AGCTGCAAGAAGAGTGTTCCAGG - Intronic
1163460297 19:17433416-17433438 TGCGGCTTTCAGAGTGTTCCGGG - Intronic
1163797576 19:19346252-19346274 TGCTGCAGTCAGAGTGAGCCAGG - Intronic
1166599390 19:44080737-44080759 TGCTGCATTTAGAGTCCTAGAGG + Intronic
1166603318 19:44117578-44117600 TGCTGCATTTAGAGTCCTACAGG + Intronic
927714701 2:25343768-25343790 TGCGCCATTTAGAGTGTTCACGG - Intergenic
929326598 2:40619340-40619362 TACTGGATTAAGAGTGTTCTAGG - Intergenic
930433117 2:51305757-51305779 GGTGGCATTGAGAGTGTTCCAGG - Intergenic
933012137 2:77079459-77079481 TGCTGCATTCAAAGTGTCCTTGG - Intronic
934115003 2:88780038-88780060 TGATCCCTATAGAGTGTTCCCGG + Intergenic
934633994 2:95965317-95965339 TGATCCCTATAGAGTGTTCCCGG - Intronic
934799635 2:97139918-97139940 TGATCCCTATAGAGTGTTCCTGG + Intronic
937998003 2:127709603-127709625 TGCTGCACTCAGACTGTTCCTGG + Intronic
940541848 2:155030320-155030342 TGCTCCATTTAGAATGAGCCAGG + Intergenic
941132893 2:161676058-161676080 GGGTGGATTTAAAGTGTTCCAGG + Intronic
941920790 2:170848858-170848880 TGCTGCTTTTTGAGTTTTTCAGG + Intronic
943763691 2:191637312-191637334 TGGTGCATCTAGAGTGGCCCTGG + Intergenic
948012138 2:234657291-234657313 TGCTGCATTCAAAGCCTTCCTGG - Intergenic
1171205321 20:23274578-23274600 TGCTGAATTTAAATTGTTTCGGG + Intergenic
1174879826 20:54267113-54267135 TGCTGCAGTAAGAGTGAACCTGG - Intergenic
1174900079 20:54490530-54490552 TGTTGCATTTATGTTGTTCCTGG + Intronic
1174926185 20:54762722-54762744 TGCTGTTTTTAGAGAGTACCGGG + Intergenic
1179628053 21:42659622-42659644 TGCTGCTTCCAGAGTCTTCCGGG - Intronic
1181515765 22:23411094-23411116 TGTTGCATTTTGAGAGTTCTTGG + Intergenic
1181864133 22:25841850-25841872 TGCTGCATTTACAATGCTACAGG - Intronic
949837206 3:8282013-8282035 TGAAGAATTTAAAGTGTTCCTGG + Intergenic
950902237 3:16508299-16508321 AGCTTCGTTTAGAGTTTTCCTGG - Intronic
953923810 3:46970212-46970234 GGCTGCATTTGAAGTGGTCCTGG - Intronic
956108795 3:65850396-65850418 CCCTGGATTGAGAGTGTTCCTGG - Intronic
956784777 3:72633432-72633454 GACTGCATTGAGTGTGTTCCAGG + Intergenic
957643830 3:82893256-82893278 TTCTGCATTTGTAGTGCTCCAGG + Intergenic
964801225 3:160560716-160560738 TGCTTCATTGATAGTTTTCCTGG - Intronic
965275928 3:166682888-166682910 AGCTGCATCTAGAATATTCCTGG - Intergenic
968717915 4:2175622-2175644 TGCTGCCATTAGAGAGTCCCAGG + Intronic
969258686 4:6020546-6020568 TGCTGTATTTAGTGTGTGCCAGG - Intergenic
972121290 4:35707508-35707530 TGCAGTATTTAGAGTTTTCTAGG + Intergenic
973231377 4:47842727-47842749 TGCTGCATTTTTAGTGTTCTTGG + Intergenic
975050639 4:69860142-69860164 TTCTGCATTTGGAATGTTTCTGG + Exonic
976560689 4:86497271-86497293 TGATGCTTTTAGAATCTTCCAGG - Intronic
977312963 4:95410284-95410306 TCATGCATTTAGAGTGGTACAGG - Intronic
980259552 4:130430815-130430837 AGATACATTTAGAGTGTTACAGG + Intergenic
981802012 4:148668860-148668882 GGCTGCATTTAAAGTTATCCTGG + Intergenic
984907408 4:184641861-184641883 TAATGCATTTAAAGTGTTCATGG - Intronic
986622380 5:9689075-9689097 TCCTCCATTGAGAGTGATCCTGG - Intronic
986758089 5:10856220-10856242 TGCTGCATTTTGAGACTTACTGG + Intergenic
987188413 5:15448815-15448837 TGCTGTATGTAGAGAGTTCTAGG + Intergenic
987685912 5:21200762-21200784 TCCTAAATTTAGAGTGTGCCAGG + Intergenic
988149639 5:27361325-27361347 TGCTGAGTTTTAAGTGTTCCAGG - Intergenic
989480127 5:41921043-41921065 TGCTGCATTTATAGGGTTTTGGG + Exonic
995598764 5:113774492-113774514 AGCTGGATTCAGAGTGTTACAGG + Intergenic
996129738 5:119768072-119768094 TACTGCAATGAGAATGTTCCTGG - Intergenic
998845396 5:146303802-146303824 TGCTGCTTTTAGAATGTTTATGG + Intronic
999572346 5:152934000-152934022 AGCTGCCTACAGAGTGTTCCTGG - Intergenic
1002535626 5:179874006-179874028 TGCTGGATCTAGAGAGTCCCAGG + Intronic
1006794047 6:36721137-36721159 TGCTTCATTTCCAGTTTTCCTGG + Exonic
1006917748 6:37605945-37605967 TGTTGCATTTACAGTGTTGCTGG - Intergenic
1007514440 6:42400212-42400234 TGCTGCATTTAGGGTGTAGCTGG - Intronic
1013669388 6:112382726-112382748 TCCTGCACTTTGAGTGTTGCTGG + Intergenic
1018244163 6:161805876-161805898 TGCTGCATTTAGAGTGTTCCAGG - Intronic
1019019719 6:168908078-168908100 TGCTGCTTTGAGGGGGTTCCAGG - Intergenic
1019483649 7:1277630-1277652 TGCTGCATTTCCAGGGTTCCAGG - Intergenic
1019521382 7:1461936-1461958 TGCTGCATTTACTGCGTGCCTGG - Intergenic
1019521387 7:1461971-1461993 TGCTGCATTTATTGCGTGCCTGG - Intergenic
1021763576 7:23924984-23925006 TGCTGCATTTCCAATGCTCCTGG + Intergenic
1021801227 7:24308873-24308895 TGCTGCATTGAGCGTGAGCCAGG - Intergenic
1022038329 7:26555089-26555111 TGCTGCATCTGGAGGGTTCTGGG + Intergenic
1025727129 7:64076358-64076380 CCCTGCATTTTGAGTGGTCCAGG + Intronic
1026231926 7:68491298-68491320 TGCTGCCTTCAGACTGTCCCAGG + Intergenic
1026365262 7:69642241-69642263 TGCAGCCTTTTGAGAGTTCCAGG - Intronic
1027529349 7:79311400-79311422 TGCTGCATTCAAAGTCGTCCTGG + Intronic
1028950118 7:96625078-96625100 TGCTGCTTTTGGAGTGTTAAAGG + Intronic
1032157450 7:129480574-129480596 TGCTGTAGGTAGAGTCTTCCAGG + Intronic
1032521151 7:132546263-132546285 TGCTGCATTTTTTGTGGTCCTGG - Intronic
1034725357 7:153330714-153330736 GGCTGCATTTAGCCTGATCCTGG + Intergenic
1039379982 8:37076094-37076116 TGCTGGATTCAGATTGCTCCTGG + Intergenic
1041556695 8:59165247-59165269 TCCTCCATCTAGAATGTTCCTGG - Intergenic
1041740087 8:61148930-61148952 AGCTGCAATTGGAATGTTCCTGG - Intronic
1042606104 8:70548290-70548312 TGCTGCATTTGAAGAGTTCTGGG + Intergenic
1042875349 8:73436129-73436151 TGCTGCACTTAGCATATTCCTGG + Intronic
1043455406 8:80407360-80407382 TGGTGCATTTCCAGGGTTCCTGG - Intergenic
1048899347 8:139022650-139022672 TGCTTCATTCAGAGTCTTCCTGG - Intergenic
1052066550 9:24028682-24028704 TGCTTCATTTAAATTTTTCCTGG - Intergenic
1053560542 9:39189464-39189486 TGGTGCACTTAGTATGTTCCTGG + Intronic
1053824643 9:42009708-42009730 TGGTGCACTTAGTATGTTCCTGG + Intronic
1054136577 9:61429491-61429513 TGGTGCACTTAGTATGTTCCTGG - Intergenic
1054605928 9:67177655-67177677 TGGTGCACTTAGTATGTTCCTGG - Intergenic
1059437638 9:114286093-114286115 TGGAGGATTTAGTGTGTTCCAGG + Intronic
1059975252 9:119709252-119709274 TGCTTTAGTTAGAGTGTTTCCGG + Intergenic
1188598938 X:31937172-31937194 TTCTGTATTTACAGTGTTCTTGG + Intronic
1188634924 X:32417653-32417675 TGCTCCATAAAGAGTGTTCCTGG - Intronic
1195642775 X:107195154-107195176 TGCTGCTTTAACAGTGCTCCTGG - Intronic
1197669547 X:129261060-129261082 TGAAGCATTTAGATTATTCCAGG - Intergenic
1199255369 X:145713407-145713429 TGGTACAATTAAAGTGTTCCTGG + Intergenic